Knockout of Rlim Results in a Sex Ratio Shift toward Males but Superovulation Cannot Compensate for the Reduced Litter Size
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. gRNA Design and Synthesis, and Targeting Vector Construction
2.2. Microinjection of Fertilized Eggs
2.3. Genotype Identification by PCR
2.4. Southern Blotting
2.5. CMV-Cre-Transgenic Male Mice
2.6. Superovulation
2.7. Fetal Recovery
2.8. Statistical Analysis
3. Results
3.1. Production and Identification of F0 Generation Rlimfl Transgenic Male Mice and Rlimfl/+ Transgenic Female Mice
3.2. Production and Identification of Homozygous Rlimfl/fl and Heterozygous Rlimfl/+ Transgenic Female Mice
3.3. Knockout of the Maternal Rlim Allele in Embryos Resulted in Offspring Sex-Ratio Shift toward Males but Superovulation in the Mothers Did Not Compensate for the Reduced Litter Size
3.4. Superovulation in the Mother Mice Increased the Perinatal Death Rate of the Progeny
3.5. RNA Interference of Rlim in Embryos Resulted in Production of Male-Only Offspring
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Fuerst-Waltl, B.; Reichl, A.; Fuerst, C.; Baumung, R.; Solkner, J. Effect of Maternal Age on Milk Production Traits, Fertility, and Longevity in Cattle. J. Dairy Sci. 2004, 87, 2293–2298. [Google Scholar] [CrossRef]
- McWhir, J.; Wilton, J.W. Prediction of traits at constant finish for performance-tested beef cattle. J. Anim. Sci. 1986, 63, 1108. [Google Scholar] [CrossRef]
- Hendriks, R.W.; Schuurman, R.K.B. Genetics of human X-linked immunodeficiency diseases. Clin. Exp. Immunol. 1991, 85, 182–192. [Google Scholar] [CrossRef] [PubMed]
- Mauer, A.M. X-Linked Recessive Disorders: Chronic Granulomatous Disease and Wiskott Aldrich Syndrome. J. Investig. Dermatol. 1973, 60, 522–528. [Google Scholar] [CrossRef] [Green Version]
- Buchanan, B.R.; Seidel, G.E.; McCue, P.M.; Schenk, J.L.; Herickhoff, L.A.; Squires, E.L. Insemination of mares with low numbers of either unsexed or sexed spermatozoa. Theriogenology 2000, 53, 1333–1344. [Google Scholar] [CrossRef] [PubMed]
- Catt, S.L.; Catt, J.W.; Gomez, M.C.; Maxwell, W.M.C.; Evans, G. Birth of a male lamb derived from an in vitro matured oocyte fertilised by intracytoplasmic injection of a single presumptive male sperm. Vet. Rec. 1996, 139, 494–495. [Google Scholar] [CrossRef]
- Cran, D.G.; Johnson, L.A.; Miller, N.G.; Cochrane, D.; Polge, C. Production of bovine calves following separation of X- and Y-chromosome bearing sperm and in vitro fertilisation. Vet. Rec. 1993, 132, 40–41. [Google Scholar] [CrossRef]
- Johnson, L.A. Sex preselection in swine: Altered sex ratios in offspring following surgical insemination of flow sorted X- and Y-bearing sperm. Reprod. Domest. Anim. 1991, 26, 309–314. [Google Scholar] [CrossRef]
- Rath, D.; Ruiz, S.; Sieg, B. Birth of female piglets following intrauterine insemination of a sow using flow cytometrically sexed boar semen. Vet. Rec. 2003, 152, 400–401. [Google Scholar] [CrossRef]
- Seidel, G.E.; Allen, C.H.; Johnson, L.A.; Holland, M.D.; Brink, Z.; Welch, G.R.; Graham, J.K.; Cattell, M.B. Uterine horn insemination of heifers with very low numbers of nonfrozen and sexed spermatozoa. Theriogenology 1997, 48, 1255–1264. [Google Scholar] [CrossRef]
- Seidel, G.E.; Schenk, J.L.; Herickhoff, L.A.; Doyle, S.P.; Brink, Z.; Green, R.D.; Cran, D.G. Insemination of heifers with sexed sperm. Theriogenology 1999, 52, 1407–1420. [Google Scholar] [CrossRef]
- Grossfeld, R.; Klinc, P.; Sieg, B.; Rath, D. Production of piglets with sexed semen employing a non-surgical insemination technique. Theriogenology 2005, 63, 2269–2277. [Google Scholar] [CrossRef]
- Roca, J.; Parrilla, I.; Rodriguez-Martinez, H.; Gil, M.A.; Cuello, C.; Vazquez, J.M.; Martinez, E.A. Approaches towards efficient use of boar semen in the pig industry. Reprod. Domest. Anim. 2011, 46 (Suppl. S2), 79–83. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Spinaci, M.; Perteghella, S.; Chlapanidas, T.; Galeati, G.; Vigo, D.; Tamanini, C.; Bucci, D. Storage of sexed boar spermatozoa: Limits and perspectives. Theriogenology 2016, 85, 65–73. [Google Scholar] [CrossRef] [PubMed]
- Yosef, I.; Edry-Botzer, L.; Globus, R.; Shlomovitz, I.; Munitz, A.; Gerlic, M.; Qimron, U. A genetic system for biasing the sex ratio in mice. EMBO Rep. 2019, 20, e48269. [Google Scholar] [CrossRef]
- Douglas, C.; Maciulyte, V.; Zohren, J.; Snell, D.M.; Mahadevaiah, S.K.; Ojarikre, O.A.; Ellis, P.; Turner, J. CRISPR-Cas9 effectors facilitate generation of single-sex litters and sex-specific phenotypes. Nat. Commun. 2021, 12, 6926. [Google Scholar] [CrossRef]
- Bai, M.; Liang, D.; Cheng, Y.; Liu, G.; Wang, Q.; Li, J.; Wu, Y. Gonadal mosaicism mediated female-biased gender control in mice. Protein Cell. 2022, 13, 863–868. [Google Scholar] [CrossRef]
- Shin, J.; Bossenz, M.; Chung, Y.; Ma, H.; Byron, M.; Taniguchi-Ishigaki, N.; Zhu, X.; Jiao, B.; Hall, L.L.; Green, M.R.; et al. Maternal Rnf12/RLIM is required for imprinted X-chromosome inactivation in mice. Nature 2010, 467, 977–981. [Google Scholar] [CrossRef] [Green Version]
- Shin, J.; Wallingford, M.C.; Gallant, J.; Marcho, C.; Jiao, B.; Byron, M.; Bossenz, M.; Lawrence, J.B.; Jones, S.N.; Mager, J.; et al. RLIM is dispensable for X-chromosome inactivation in the mouse embryonic epiblast. Nature 2014, 511, 86–89. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, F.; Gervasi, M.G.; Boskovic, A.; Sun, F.; Rinaldi, V.D.; Yu, J.; Wallingford, M.C.; Tourzani, D.A.; Mager, J.; Zhu, L.J.; et al. Deficient spermiogenesis in mice lacking Rlim. eLife 2021, 10, e63556. [Google Scholar] [CrossRef]
- Van der Auwera, I.; D’Hooghe, T. Superovulation of female mice delays embryonic and fetal development. Hum. Reprod. 2001, 16, 1237–1243. [Google Scholar] [CrossRef] [Green Version]
- Wang, F.; Shin, J.; Shea, J.M.; Yu, J.; Boskovic, A.; Byron, M.; Zhu, X.; Shalek, A.K.; Regev, A.; Lawrence, J.B.; et al. Regulation of X-linked gene expression during early mouse development by Rlim. eLife 2016, 5, e19127. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bersell, K.; Choudhury, S.; Mollova, M.; Polizzotti, B.D.; Ganapathy, B.; Walsh, S.; Wadugu, B.; Arab, S.; Kuhn, B. Moderate and high amounts of tamoxifen in alphaMHC-MerCreMer mice induce a DNA damage response, leading to heart failure and death. Dis. Model. Mech. 2013, 6, 1459–1469. [Google Scholar] [PubMed]
- Sahasrabuddhe, V.; Ghosh, H.S. Cx3Cr1-Cre induction leads to microglial activation and IFN-1 signaling caused by DNA damage in early postnatal brain. Cell Rep. 2022, 38, 110252. [Google Scholar] [CrossRef] [PubMed]
- Semprini, S.; Troup, T.J.; Kotelevtseva, N.; King, K.; Davis, J.R.; Mullins, L.J.; Chapman, K.E.; Dunbar, D.R.; Mullins, J.J. Cryptic loxP sites in mammalian genomes: Genome-wide distribution and relevance for the efficiency of BAC/PAC recombineering techniques. Nucleic Acids Res. 2007, 35, 1402–1410. [Google Scholar] [CrossRef] [PubMed]
- Zeiträg, J.; Alterauge, D.; Dahlström, F.; Baumjohann, D. Gene dose matters: Considerations for the use of inducible CD4-CreERT2 mouse lines. Eur. J. Immunol. 2020, 50, 603–605. [Google Scholar] [CrossRef] [Green Version]
- Joo, J.K.; Joo, B.S.; Kim, S.C.; Choi, J.R.; Park, S.H.; Lee, K.S. Role of leptin in improvement of oocyte quality by regulation of ovarian angiogenesis. Anim. Reprod. Sci. 2010, 119, 329–334. [Google Scholar] [CrossRef] [PubMed]
- Qu, Y.; Zhang, J.; Guo, S.; Zhang, L.; Qian, J.; Zhu, X.; Duan, E.; Zhang, Y. Three-Dimensional Visualization of Mouse Endometrial Remodeling After Superovulation. Front. Cell. Dev. Biol. 2022, 10, 933852. [Google Scholar] [CrossRef]
- Kakar, M.A.; Maddocks, S.; Lorimer, M.F.; Kleemann, D.O.; Rudiger, S.R.; Hartwich, K.M.; Walker, S.K. The effect of peri-conception nutrition on embryo quality in the superovulated ewe. Theriogenology 2005, 64, 1090–1103. [Google Scholar] [CrossRef]
- Papadopoulos, S.; Lonergan, P.; Gath, V.; Quinn, K.M.; Evans, A.C.; O’Callaghan, D.; Bolan, M.P. Effect of diet quantity and urea supplementation on oocyte and embryo quality in sheep. Theriogenology 2001, 55, 1059–1069. [Google Scholar] [CrossRef]
- Pal, L.; Jindal, S.; Witt, B.R.; Santoro, N. Less is more: Increased gonadotropin use for ovarian stimulation adversely influences clinical pregnancy and live birth after in vitro fertilization. Fertil. Steril. 2008, 89, 1694–1701. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Seidel, G.J.; Garner, D.L. Current status of sexing mammalian spermatozoa. Reproduction 2002, 124, 733–743. [Google Scholar] [CrossRef] [PubMed]
- Tubman, L.M.; Brink, Z.; Suh, T.K.; Seidel, G.J. Characteristics of calves produced with sperm sexed by flow cytometry/cell sorting. J. Anim. Sci. 2004, 82, 1029–1036. [Google Scholar] [CrossRef] [PubMed]
Name | Sequence (5′~3′) |
---|---|
gRNA1 | AAACTACATCATCATAGTCGGGG |
gRNA2 | GCAGGGCAGTCTTATCTTCTGGG |
Rlim-siRNA | GAAGUCAAAUGGAUCGCUUTT |
AAGCGAUCCAUUUGACUUCTG | |
NC-siRNA | UUCUCCGAACGUGUCACGUTT |
ACGUGACACGUUCGGAGAATT |
Name | Forward Primer | Reverse Primer | Amplicon Size |
---|---|---|---|
Primers 1 | ACGTAAACGGCCACAAGTTC | AGAGTACTGGGGTTATCACAATCT | 3.7 kb |
Primers 2 | CTATGCATCTGGGTACAAAATAACC | GTGGATTCGGACCAGTCTGA | 3.7 kb |
5′Probe-Bsu36I | ACTGCTGTGTCTGCCTCACCTTTG | AGAGAAGCACCATTCCCCAGCATA | WT-7.30 kb MT-6.19 kb |
3′Probe-MfeI | AAAGGAAAGGACCGTGCAGAACC | CCCAAGAAAGCTCTGCCAAATGTACT | WT-10.15 kb MT-7.18 kb |
Primers for pair 1 | TTGTCGCAGGGCAGTCTTATC | GCAATGACTCAATTCAGCTTGTGA | Homozygotes: 242 bp Heterozygotes: 242 bp and 174 bp Wildtype allele: 174 bp |
Primers for pair 2 | AGCCTTGTTTATAGTTTTGCTCTGG | GCTGTGGGAAGGCATGAATTTT | Homozygotes: 281 bp Heterozygotes: 281 bp and 212 bp Wildtype allele: 212 bp |
CMV-Cre | GTAGGCGTGTACGGTGGGAGGT | TCCAGGTATGCTCAGAAAACGCC | 349 bp |
SRY | CTTTTTCCAGGAGGCACAGA | GACAGGCTGCCAATAAAAGC | 250 bp |
ZFX | AAGAGAGTCCATTCAAGTGTGA | GCTACCTTTGTTGCCGAAAT | 399 bp |
Groups | No. of Transferred Injected Embryos/Recipient Mothers | No. of Born Pups/Survive into Adulthood | Male:Female |
---|---|---|---|
NC-siRNA | 22/2 | 10/10 | 4:6 |
Rlim-siRNA | 22/2 | 12/12 | 12:0 *** |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Peng, J.; Hou, Y.; Wu, S.; Li, Z.; Wu, Z. Knockout of Rlim Results in a Sex Ratio Shift toward Males but Superovulation Cannot Compensate for the Reduced Litter Size. Animals 2023, 13, 1079. https://doi.org/10.3390/ani13061079
Peng J, Hou Y, Wu S, Li Z, Wu Z. Knockout of Rlim Results in a Sex Ratio Shift toward Males but Superovulation Cannot Compensate for the Reduced Litter Size. Animals. 2023; 13(6):1079. https://doi.org/10.3390/ani13061079
Chicago/Turabian StylePeng, Jingfeng, Yunfei Hou, Shici Wu, Zicong Li, and Zhenfang Wu. 2023. "Knockout of Rlim Results in a Sex Ratio Shift toward Males but Superovulation Cannot Compensate for the Reduced Litter Size" Animals 13, no. 6: 1079. https://doi.org/10.3390/ani13061079