The Novel Structural Variation in the GHR Gene Is Associated with Growth Traits in Yaks (Bos grunniens)
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Sample Collection
2.3. Genomic DNA (gDNA) Extraction and Polymerase Chain Reaction (PCR)
2.4. RNA Extraction and Quantitative PCR Identification
2.5. Cell Culture and Cell Transfection
2.6. Plasmid Construction and Prediction of Transcription-Factor Binding Sites (TFBSs)
2.7. Statistical Analysis
3. Results
3.1. Identification of SV of Yak GHR Gene
3.2. Identification of SV of Yak GHR Gene
3.3. The Association of the 246 bp Deletion of GHR with Growth Traits of Yak
3.4. Identification of Fluorescence Activity of GHR Gene Polymorphism in Yak
3.5. Effect of Transcription Factors on the Transcriptional Activity of Mutant Recombinant Plasmids
3.6. mRNA Expression Profile of the GHR Gene in Yak
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Li, A.; Wang, Y.; Pei, L.; Mehmood, K.; Li, K.; Qamar, H.; Iqbal, M.; Waqas, M.; Liu, J.; Li, J. Influence of dietary supplementation with Bacillus velezensis on intestinal microbial diversity of mice. Microb. Pathog. 2019, 136, 103671. [Google Scholar] [CrossRef] [PubMed]
- Ruan, C.-M.; Wang, J.; Yang, Y.-X.; Hu, J.-J.; Ma, Y.-J.; Zhang, Y.; Zhao, X.-X. Proteomic analysis of Tianzhu White Yak (Bos grunniens) testis at different sexual developmental stages. Anim. Sci. J. 2019, 90, 333–343. [Google Scholar] [CrossRef] [PubMed]
- Ding, L.; Wang, Y.; Kreuzer, M.; Guo, X.; Mi, J.; Gou, Y.; Shang, Z.; Zhang, Y.; Zhou, J.; Wang, H.; et al. Seasonal variations in the fatty acid profile of milk from yaks grazing on the Qinghai-Tibetan plateau. J. Dairy Res. 2013, 80, 410–417. [Google Scholar] [CrossRef]
- Ma, Z.; Xu, J.; Zhong, J.; Dou, Q.; Sun, Y.; Mu, Y. Structural features of the 5’ flanking region of the Yak (Bos grunniens) growth hormone receptor (GHR) gene (Brief Report). Arch. Anim. Breed. 2010, 53, 372–376. [Google Scholar] [CrossRef]
- Guo, Z.; Ge, X.; Yang, L.; Ma, G.; Ma, J.; Yu, Q.-L.; Han, L. Ultrasound-assisted thawing of frozen white yak meat: Effects on thawing rate, meat quality, nutrients, and microstructure. Ultrason. Sonochem. 2021, 70, 105345. [Google Scholar] [CrossRef]
- Etherton, T.D.; Bauman, D.E. Biology of Somatotropin in Growth and Lactation of Domestic Animals. Physiol. Rev. 1998, 78, 745–761. [Google Scholar] [CrossRef]
- Li, W.-Y.; Liu, Y.; Gao, C.-F.; Lan, X.-Y.; Wu, X.-F. A novel duplicated insertion/deletion (InDel) of the CPT1a gene and its effects on growth traits in goat. Anim. Biotechnol. 2021, 32, 343–351. [Google Scholar] [CrossRef]
- Yang, S.; Liu, Z.; Yan, Z.; Zhao, Z.; Zhang, C.; Gong, Q.; Du, X.; Wu, J.; Feng, Y.; Du, J.; et al. Improvement of skeletal muscle growth by GH/IGF growth-axis contributes to growth performance in commercial fleshy sturgeon. Aquaculture 2021, 543, 736929. [Google Scholar] [CrossRef]
- Slifierz, M.J.; Friendship, R.; de Lange, C.F.; Rudar, M.; Farzan, A. An epidemiological investigation into the association between biomarkers and growth performance in nursery pigs. BMC Veter. Res. 2013, 9, 247. [Google Scholar] [CrossRef]
- Yang, Q.; Yan, H.; Li, J.; Xu, H.; Wang, K.; Zhu, H.; Chen, H.; Qu, L.; Lan, X. A novel 14-bp duplicated deletion within goat GHR gene is significantly associated with growth traits and litter size. Anim. Genet. 2017, 48, 499–500. [Google Scholar] [CrossRef]
- Blott, S.; Kim, J.-J.; Moisio, S.; Schmidt-Küntzel, A.; Cornet, A.; Berzi, P.; Cambisano, N.; Ford, C.; Grisart, B.; Johnson, D.; et al. Molecular dissection of a quantitative trait locus: A phenylalanine-to-tyrosine substitution in the transmembrane domain of the bovine growth hormone receptor is associated with a major effect on milk yield and composition. Genetics 2003, 163, 253–266. [Google Scholar] [CrossRef]
- Waters, S.M.; McCabe, M.S.; Howard, D.J.; Giblin, L.; Magee, D.A.; MacHugh, D.E.; Berry, D.P. Associations between newly discovered polymorphisms in the Bos taurus growth hormone receptor gene and performance traits in Holstein-Friesian dairy cattle. Anim. Genet. 2011, 42, 39–49. [Google Scholar] [CrossRef]
- Shen, R.; Wang, L.; Liu, X.; Wu, J.; Jin, W.; Zhao, X.; Xie, X.; Zhu, Q.; Tang, H.; Li, Q.; et al. Genomic structural variation-mediated allelic suppression causes hybrid male sterility in rice. Nat. Commun. 2017, 8, 1310. [Google Scholar] [CrossRef]
- Gong, J.-Y.; Wen, C.-J.; Tang, M.-L.; Duan, R.-F.; Chen, J.-N.; Zhang, J.-Y.; Zheng, K.-W.; He, Y.-D.; Hao, Y.-H.; Yu, Q.; et al. G-quadruplex structural variations in human genome associated with single-nucleotide variations and their impact on gene activity. Proc. Natl. Acad. Sci. USA 2021, 118, e2013230118. [Google Scholar] [CrossRef]
- Flisikowski, K.; Venhoranta, H.; Nowacka-Woszuk, J.; McKay, S.; Flyckt, A.; Taponen, J.; Schnabel, R.; Schwarzenbacher, H.; Szczerbal, I.; Lohi, H.; et al. A Novel Mutation in the Maternally Imprinted PEG3 Domain Results in a Loss of MIMT1 Expression and Causes Abortions and Stillbirths in Cattle (Bos taurus). PLoS ONE 2010, 5, e15116. [Google Scholar] [CrossRef]
- Sakar, Ç.M.; Zülkadir, U. Determination of the relationship between Anatolian black cattle growth properties and myostatin, GHR and Pit-1 gene. Anim. Biotechnol. 2022, 33, 536–545. [Google Scholar] [CrossRef] [PubMed]
- Ren, T.; Li, W.; Liu, D.; Liang, K.; Wang, X.; Li, H.; Jiang, R.; Tian, Y.; Kang, X.; Li, Z. Two insertion/deletion variants in the promoter region of the QPCTL gene are significantly associated with body weight and carcass traits in chickens. Anim. Genet. 2019, 50, 279–282. [Google Scholar] [CrossRef] [PubMed]
- Upadhyay, M.; Derks, M.F.; Andersson, G.; Medugorac, I.; Groenen, M.A.; Crooijmans, R.P. Introgression contributes to distribution of structural variations in cattle. Genomics 2021, 113, 3092–3102. [Google Scholar] [CrossRef] [PubMed]
- Gilbert, R.P.; Bailey, D.R.; Shannon, N.H. Linear body measurements of cattle before and after 20 years of selection for postweaning gain when fed two different diets2. J. Anim. Sci. 1993, 71, 1712–1720. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Florini, J.R.; Ewton, D.Z.; Coolican, S.A. Growth hormone and the insulin-like growth factor system in myogenesis. Endocr. Rev. 1996, 17, 481–517. [Google Scholar] [PubMed]
- Rehfeldt, C.; Nissen, P.M.; Kuhn, G.; Vestergaard, M.; Ender, K.; Oksbjerg, N. Effects of maternal nutrition and porcine growth hormone (pGH) treatment during gestation on endocrine and metabolic factors in sows, fetuses and pigs, skeletal muscle development, and postnatal growth. Domest. Anim. Endocrinol. 2004, 27, 267–285. [Google Scholar] [CrossRef] [PubMed]
- Liang, K.; Wang, X.; Tian, X.; Geng, R.; Li, W.; Jing, Z.; Han, R.; Tian, Y.; Liu, X.; Kang, X.; et al. Molecular characterization and an 80-bp indel polymorphism within the prolactin receptor (PRLR) gene and its associations with chicken growth and carcass traits. 3 Biotech 2019, 9, 296. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.; Wang, T.; Lu, W.; Zhang, W.; Chen, W.; Kang, X.; Huang, Y. Three indel variants in chicken LPIN1 exon 6/flanking region are associated with performance and carcass traits. Br. Poult. Sci. 2015, 56, 621–630. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.Z.; He, H.; Wang, J.; Li, Z.J.; Lan, X.Y.; Lei, C.Z.; Zhang, E.P.; Zhang, C.L.; Shen, Q.W.; Chen, H. Sequence variants in the bovine nucleophosmin 1 gene, their linkage and their associations with body weight in native cattle breeds in China. Anim. Genet. 2011, 42, 556–559. [Google Scholar] [CrossRef]
- Zhang, Q.; Jin, Y.; Jiang, F.; Cheng, H.; Wang, Y.; Lan, X.; Song, E. Relationship between an indel mutation within the SIRT4 gene and growth traits in Chinese cattle. Anim. Biotechnol. 2019, 30, 352–357. [Google Scholar] [CrossRef] [PubMed]
- Kim, B.-Y.; Park, J.H.; Jo, H.-Y.; Koo, S.K.; Park, M.-H. Optimized detection of insertions/deletions (INDELs) in whole-exome sequencing data. PLoS ONE 2017, 12, e0182272. [Google Scholar] [CrossRef] [PubMed]
- Stewart, C.E.; Rotwein, P.; Vélez, E.J.; Azizi, S.; Millán-Cubillo, A.; Fernández-Borràs, J.; Blasco, J.; Chan, S.J.; Calduch-Giner, J.A.; Pérez-Sánchez, J.; et al. Growth, differentiation, and survival: Multiple physiological functions for insulin-like growth factors. Physiol. Rev. 1996, 76, 1005–1026. [Google Scholar] [CrossRef] [PubMed]
- Hosokawa, H.; Koizumi, M.; Masuhara, K.; Romero-Wolf, M.; Tanaka, T.; Nakayama, T.; Rothenberg, E.V. Stage-specific action of Runx1 and GATA3 controls silencing of PU.1 expression in mouse pro–T cells. J. Exp. Med. 2021, 218, e20202648. [Google Scholar] [CrossRef]
- Zheng, W.; Leng, X.; Vinsky, M.; Li, C.; Jiang, H. Association of body weight gain with muscle, fat, and liver expression levels of growth hormone receptor, insulin-like growth factor I, and beta-adrenergic receptor mRNAs in steers. Domest. Anim. Endocrinol. 2018, 64, 31–37. [Google Scholar] [CrossRef]
- Xu, H.; Li, T.; Wang, Z.; Adu-Asiamah, P.; Leng, Q.; Zheng, J.; Zhao, Z.; An, L.; Zhang, X.; Zhang, L. Roles of chicken growth hormone receptor antisense transcript in chicken muscle development and myoblast differentiation. Poult. Sci. 2019, 98, 6980–6988. [Google Scholar] [CrossRef] [PubMed]
- Pena, V.; Rozov, A.; Fabrizio, P.; Lührmann, R.; Wahl, M.C. Structure and function of an RNase H domain at the heart of the spliceosome. EMBO J. 2008, 27, 2929–2940. [Google Scholar] [CrossRef] [PubMed]
- Ostrovsky, O.; Baryakh, P.; Morgulis, Y.; Mayorov, M.; Bloom, N.; Beider, K.; Shimoni, A.; Vlodavsky, I.; Nagler, A. The HPSE Gene Insulator-A Novel Regulatory Element That Affects Heparanase Expression, Stem Cell Mobilization, and the Risk of Acute Graft versus Host Disease. Cells 2021, 10, 2523. [Google Scholar] [CrossRef]
- Boriushkin, E.; Zhang, H.; Becker, M.; Peachey, J.; Shatat, M.A.; Adams, R.H.; Hamik, A. Kruppel-like factor 4 regulates developmental angiogenesis through disruption of the RBP-J–NICD–MAML complex in intron 3 of Dll4. Angiogenesis 2019, 22, 295–309. [Google Scholar] [CrossRef]
- Su, K.; Chen, S.; Ye, J.; Kuang, L.; Zhang, T.; Wang, H.; Yang, X. A functional indel polymorphism rs34396413 in TFAP2A intron-5 significantly increases female encephalocele risk in Han Chinese population. Child’s Nerv. Syst. 2019, 35, 965–972. [Google Scholar] [CrossRef]
- Lin, W.; Ren, T.; Li, W.; Liu, M.; He, D.; Liang, S.; Luo, W.; Zhang, X. Novel 61-bp Indel of RIN2 Is Associated With Fat and Hatching Weight Traits in Chickens. Front. Genet. 2021, 12, 672888. [Google Scholar] [CrossRef]
- Morita, K.; Maeda, S.; Suzuki, K.; Kiyose, H.; Taniguchi, J.; Liu, P.P.; Sugiyama, H.; Adachi, S.; Kamikubo, Y. Paradoxical enhancement of leukemogenesis in acute myeloid leukemia with moderately attenuated RUNX1 expressions. Blood Adv. 2017, 1, 1440–1451. [Google Scholar] [CrossRef]
- Bao, M.; Liu, S.; Yu, X.-Y.; Wu, C.; Chen, Q.; Ding, H.; Shen, C.; Wang, B.; Wang, S.; Song, Y.-H.; et al. Runx1 promotes satellite cell proliferation during ischemia—Induced muscle regeneration. Biochem. Biophys. Res. Commun. 2018, 503, 2993–2997. [Google Scholar] [CrossRef]
- Umansky, K.B.; Gruenbaum-Cohen, Y.; Tsoory, M.; Feldmesser, E.; Goldenberg, D.; Brenner, O.; Groner, Y. Runx1 Transcription Factor Is Required for Myoblasts Proliferation during Muscle Regeneration. PLoS Genet. 2015, 11, e1005457. [Google Scholar] [CrossRef] [PubMed]
Levels | Gene | Primer Sequence (5′-3′) | Product Length (bp) | Tm (°C) | |
---|---|---|---|---|---|
DNA | GHR | F1 | TCAGAGATGAGCAACAGTGCC | 778 | 58.0 |
R1 | TGCGTATCTACACCTGAGCAC | ||||
F2 | GGggtaccTGAGCAACAGTGCCCCATTT | 324 | 64.9 | ||
R2 | GAagatctTCACACACTCTAGACCTTAAAGCTG | ||||
RNA | F3 | CAGCAGCCCAGTGTTATCCT | 230 | 64.0 | |
R3 | AATGTCGCTTACCTGGGCAT | ||||
β-actin | F4 | GCAGGTCATCACCATCGG | 177 | 64.0 | |
R4 | CCGTGTTGGCGTAGAGGT |
Breeds | Sample Size/n | Genotype Frequency | Allele Frequency | Description | |||
---|---|---|---|---|---|---|---|
II | ID | DD | I | D | |||
Ashidan yak (ASD) | 315 | 0.714 | 0.181 | 0.105 | 0.805 | 0.195 | Domestic, Datong Qianghai, PRC |
Datong yak (DT) | 22 | 0.636 | 0.364 | 0 | 0.818 | 0.182 | Domestic, Datong Qianghai, PRC |
Xueduo yak (XD) | 21 | 0.762 | 0.238 | 0 | 0.881 | 0.119 | Domestic, Henan Qianghai, PRC |
Huanhu yak (HH) | 21 | 0.524 | 0.286 | 0.190 | 0.667 | 0.333 | Domestic, Haibei Qianghai, PRC |
Gannan yak (GN) | 21 | 0.950 | 0.0500 | 0 | 0.977 | 0.0230 | Domestic, Gannan Gansu, PRC |
Tianzhubai yak (TZB) | 21 | 0.666 | 0.286 | 0.0480 | 0.810 | 0.190 | Domestic, Tianzhu Gansu, PRC |
Niangya yak (NY) | 18 | 0.889 | 0.111 | 0 | 0.944 | 0.0560 | Domestic, Naqu Tibet, PRC |
Leiwuqi yak (LWQ) | 21 | 0.714 | 0.286 | 0 | 0.857 | 0.143 | Domestic, Changdu Tibet, PRC |
Sibu yak (SB) | 18 | 0.500 | 0.500 | 0 | 0.500 | 0.500 | Domestic, Sibu Tibet, PRC |
Muli yak (ML) | 23 | 0.957 | 0.0430 | 0 | 0.979 | 0.0210 | Domestic, Liangshan Sichuan, PRC |
Jiulong yak (JL) | 21 | 0.667 | 0.0950 | 0.238 | 0.714 | 0.286 | Domestic, Jiulong Sichuan, PRC |
Maiwa yak (MW) | 21 | 0.500 | 0.0910 | 0.409 | 0.545 | 0.455 | Domestic, Hongyuan Sichuan, PRC |
Bazhou (BZ) | 21 | 0.667 | 0.238 | 0.0950 | 0.786 | 0.214 | Domestic, Hejing Xinjiang, PRC |
Zhongdian yak (ZD) | 21 | 0.571 | 0.333 | 0.0960 | 0.738 | 0.262 | Domestic, Zhongdian Yunnan, PRC |
Total | 586 | 0.723 | 0.202 | 0.0750 | 0.824 | 0.176 |
Breeds | Sample Size/n | HWE p-Value | Genetic Parameters | Description | |||
---|---|---|---|---|---|---|---|
Ho | He | Ne | PIC | ||||
Ashidan yak (ASD) | 315 | 0.493 | 0.686 | 0.313 | 1.45 | 0.265 | Domestic, Datong Qianghai, PRC |
Datong yak (DT) | 22 | 0.474 | 0.702 | 0.298 | 1.42 | 0.253 | Domestic, Datong Qianghai, PRC |
Xueduo yak (XD) | 21 | 0.365 | 0.790 | 0.210 | 1.27 | 0.187 | Domestic, Henan Qianghai, PRC |
Huanhu yak (HH) | 21 | 0.636 | 0.556 | 0.444 | 1.80 | 0.346 | Domestic, Haibei Qianghai, PRC |
Gannan yak (GN) | 21 | 0.109 | 0.955 | 0.0449 | 1.04 | 0.0439 | Domestic, Gannan Gansu, PRC |
Tianzhubai yak (TZB) | 21 | 0.486 | 0.692 | 0.308 | 1.44 | 0.260 | Domestic, Tianzhu Gansu, PRC |
Niangya yak (NY) | 18 | 0.216 | 0.894 | 0.106 | 1.12 | 0.100 | Domestic, Naqu Tibet, PRC |
Leiwuqi yak (LWQ) | 21 | 0.410 | 0.755 | 0.245 | 1.32 | 0.215 | Domestic, Changdu Tibet, PRC |
Sibu yak (SB) | 18 | 0.693 | 0.500 | 0.500 | 2.00 | 0.375 | Domestic, Sibu Tibet, PRC |
Muli yak (ML) | 23 | 0.102 | 0.959 | 0.0411 | 1.04 | 0.0403 | Domestic, Liangshan Sichuan, PRC |
Jiulong yak (JL) | 21 | 0.599 | 0.592 | 0.408 | 1.69 | 0.325 | Domestic, Jiulong Sichuan, PRC |
Maiwa yak (MW) | 21 | 0.689 | 0.504 | 0.496 | 1.98 | 0.373 | Domestic, Hongyuan Sichuan, PRC |
Bazhou (BZ) | 21 | 0.519 | 0.664 | 0.336 | 1.51 | 0.280 | Domestic, Hejing Xinjiang, PRC |
Zhongdian yak (ZD) | 21 | 0.575 | 0.613 | 0.387 | 1.63 | 0.312 | Domestic, Zhongdian Yunnan, PRC |
Age | Growth Trait | SV Types | p-Value | ||
---|---|---|---|---|---|
II (0.714) | ID (0.181) | DD (0.105) | |||
6 months (n = 315) | Body weight | 84.711 ± 0.692 | 83.754 ± 1.374 | 83.000 ± 1.806 | 0.601 |
Body length | 91.667 ± 0.485 b | 91.386 ± 0.963 b | 95.242 ± 1.266 a | <0.05 * | |
Body height | 94.356 ± 0.350 | 94.684 ± 0.695 | 94.758 ± 0.914 | 0.861 | |
Chest girth | 123.938 ± 0.513 | 124.175 ± 1.020 | 124.364 ± 1.341 | 0.944 | |
12 months (n = 315) | Body weight | 82.698 ± 0.690 | 81.140 ± 1.389 | 83.970 ± 1.826 | 0.433 |
Body length | 95.920 ± 0.332 | 95.807 ± 0.659 | 97.182 ± 0.866 | 0.370 | |
Body height | 90.502 ± 0.281 | 90.561 ± 0.558 | 91.121 ± 0.734 | 0.733 | |
Chest girth | 117.187 ± 0.332 | 117.281 ± 0.660 | 117.970 ± 0.867 | 0.701 | |
18 months (n = 226) | Body weight | 122.329 ± 1.023 | 123.550 ± 2.014 | 120.548 ± 2.288 | 0.616 |
Body length | 101.335 ± 0.455 | 102.600 ± 0.895 | 101.581 ± 1.017 | 0.454 | |
Body height | 102.903 ± 0.459 | 102.900 ± 0.903 | 102.258 ± 1.026 | 0.843 | |
Chest girth | 138.387 ± 0.827 | 142.350 ± 1.628 | 138.129 ± 1.849 | 0.084 | |
30 months (n = 180) | Body weight | 154.944 ± 1.121 | 155.375 ± 2.621 | 159.273 ± 3.161 | 0.451 |
Body length | 113.421 ± 0.509 | 112.906 ± 1.009 | 113.136 ± 1.217 | 0.893 | |
Body height | 99.286 ± 0.450 | 99.125 ± 0.892 | 100.955 ± 1.076 | 0.322 | |
Chest girth | 146.484 ± 0.730 | 147.125 ± 1.448 | 146.818 ± 1.746 | 0.919 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, F.; Wu, X.; Ma, X.; Bao, Q.; Zheng, Q.; Chu, M.; Guo, X.; Liang, C.; Yan, P. The Novel Structural Variation in the GHR Gene Is Associated with Growth Traits in Yaks (Bos grunniens). Animals 2023, 13, 851. https://doi.org/10.3390/ani13050851
Wang F, Wu X, Ma X, Bao Q, Zheng Q, Chu M, Guo X, Liang C, Yan P. The Novel Structural Variation in the GHR Gene Is Associated with Growth Traits in Yaks (Bos grunniens). Animals. 2023; 13(5):851. https://doi.org/10.3390/ani13050851
Chicago/Turabian StyleWang, Fubin, Xiaoyun Wu, Xiaoming Ma, Qi Bao, Qingbo Zheng, Min Chu, Xian Guo, Chunnian Liang, and Ping Yan. 2023. "The Novel Structural Variation in the GHR Gene Is Associated with Growth Traits in Yaks (Bos grunniens)" Animals 13, no. 5: 851. https://doi.org/10.3390/ani13050851
APA StyleWang, F., Wu, X., Ma, X., Bao, Q., Zheng, Q., Chu, M., Guo, X., Liang, C., & Yan, P. (2023). The Novel Structural Variation in the GHR Gene Is Associated with Growth Traits in Yaks (Bos grunniens). Animals, 13(5), 851. https://doi.org/10.3390/ani13050851