Lactiplantibacillus plantarum Postbiotics Suppress Salmonella Infection via Modulating Bacterial Pathogenicity, Autophagy and Inflammasome in Mice
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacteria Preparation
2.2. Animal Experimental Design
2.3. Effects of LPC on ST Growth
2.3.1. Turbidimetry Test
2.3.2. Agar Diffusion Assay
2.4. Biofilm Inhibition Assay
2.5. Intestinal Morphological Analysis
2.6. Inflammatory Cytokines Analysis
2.7. Western Blot
2.8. mRNA Relative Expression Analysis by Real-Time PCR Assay
2.9. Statistical Analysis
3. Results
3.1. Effects of LPC on Salmonella Growth
3.2. Effects of LPC on Salmonella Pathogenicity
3.3. Effects of LP Postbiotics on Salmonella-Induced Intestinal Injury in Mice
3.4. Effects of LP Postbiotics on the Levels of Inflammatory Cytokines in Mice under Salmonella Challenge
3.5. Effects of LP Postbiotics on NLRP3 Inflammasome in Mice under Salmonella Challenge
3.6. Effects of LP Postbiotics on Autophagy under Salmonella Challenge
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- El-Saadony, M.T.; Alagawany, M.; Patra, A.K.; Kar, I.; Tiwari, R.; Dawood, M.A.O.; Dhama, K.; Abdel-Latif, H.M.R. The functionality of probiotics in aquaculture: An overview. Fish Shellfish Immun. 2021, 117, 36–52. [Google Scholar] [CrossRef]
- Cui, Y.; Wang, S.; Ding, S.; Shen, J.; Zhu, K. Toxins and mobile antimicrobial resistance genes in Bacillus probiotics constitute a potential risk for One Health. J. Hazard. Mater. 2020, 382, 121266. [Google Scholar] [CrossRef]
- Shori, A.B. Microencapsulation improved probiotics survival during gastric transit. HAYATI J. Biosci. 2017, 24, 1–5. [Google Scholar] [CrossRef]
- Aguilar-Toalá, J.; Garcia-Varela, R.; Garcia, H.; Mata-Haro, V.; González-Córdova, A.; Vallejo-Cordoba, B.; Hernández-Mendoza, A. Postbiotics: An evolving term within the functional foods field. Trends Food Sci. Technol. 2018, 75, 105–114. [Google Scholar] [CrossRef]
- Collado, M.C.; Vinderola, G.; Salminen, S. Postbiotics: Facts and open questions. A position paper on the need for a consensus definition. Benef. Microbes 2019, 10, 711–719. [Google Scholar] [CrossRef] [PubMed]
- Salminen, S.; Collado, M.C.; Endo, A.; Hill, C.; Lebeer, S.; Quigley, E.M.M.; Sanders, M.E.; Shamir, R.; Swann, J.R.; Szajewska, H.; et al. Author Correction: The International Scientific Association of Probiotics and Prebiotics (ISAPP) consensus statement on the definition and scope of postbiotics. Nat. Rev. Gastroenterol. Hepatol. 2022, 19, 551. [Google Scholar] [CrossRef] [PubMed]
- Rad, A.H.; Maleki, L.A.; Kafil, H.S.; Zavoshti, H.F.; Abbasi, A. Postbiotics as novel health-promoting ingredients in functional foods. Health Promot. Perspect. 2020, 10, 3–4. [Google Scholar]
- Xu, X.; Wu, J.; Jin, Y.; Huang, K.; Zhang, Y.; Liang, Z. Both Saccharomyces boulardii and Its Postbiotics Alleviate Dextran Sulfate Sodium-Induced Colitis in Mice, Association with Modulating Inflammation and Intestinal Microbiota. Nutrients 2023, 15, 1484. [Google Scholar] [CrossRef]
- Alameri, F.; Tarique, M.; Osaili, T.; Obaid, R.; Abdalla, A.; Masad, R.; Al-Sbiei, A.; Fernandez-Cabezudo, M.; Liu, S.-Q.; Al-Ramadi, B. Lactic acid bacteria isolated from fresh vegetable products: Potential probiotic and postbiotic characteristics including immunomodulatory effects. Microorganisms 2022, 10, 389. [Google Scholar] [CrossRef]
- de Almada, C.N.; Almada, C.N.; Martinez, R.C.; Sant’Ana, A.S. Paraprobiotics: Evidences on their ability to modify biological responses, inactivation methods and perspectives on their application in foods. Trends Food Sci. Technol. 2016, 58, 96–114. [Google Scholar] [CrossRef]
- Marchello, C.S.; Birkhold, M.; Crump, J.A.; Martin, L.B.; Ansah, M.O.; Breghi, G.; Canals, R.; Fiorino, F.; Gordon, M.A.; Kim, J.-H. Complications and mortality of non-typhoidal salmonella invasive disease: A global systematic review and meta-analysis. Lancet Infect. Dis. 2022, 22, 692–705. [Google Scholar] [CrossRef]
- Shi, S.; Gong, L.; Yu, H.; He, G.; Zhang, J.; Han, Y.; Liu, Y.; Hu, J.; Dong, J.; Liu, J. Antagonistic activity and mechanism of Lactobacillus rhamnosus SQ511 against Salmonella enteritidis. 3 Biotech 2022, 12, 126. [Google Scholar] [CrossRef]
- Abd El-Ghany, W.A.; Abdel-Latif, M.A.; Hosny, F.; Alatfeehy, N.M.; Noreldin, A.E.; Quesnell, R.R.; Chapman, R.; Sakai, L.; Elbestawy, A.R. Comparative efficacy of postbiotic, probiotic, and antibiotic against necrotic enteritis in broiler chickens. Poult. Sci. 2022, 101, 101988. [Google Scholar] [CrossRef]
- Sibinelli-Sousa, S.; de Araújo-Silva, A.L.; Hespanhol, J.T.; Bayer-Santos, E. Revisiting the steps of Salmonella gut infection with a focus on antagonistic interbacterial interactions. FEBS J. 2022, 289, 4192–4211. [Google Scholar] [CrossRef]
- Blevins, H.M.; Xu, Y.; Biby, S.; Zhang, S. The NLRP3 inflammasome pathway: A review of mechanisms and inhibitors for the treatment of inflammatory diseases. Front. Aging Neurosci. 2022, 14, 879021. [Google Scholar] [CrossRef]
- Lamkanfi, M.; Dixit, V.M. Mechanisms and functions of inflammasomes. Cell 2014, 157, 1013–1022. [Google Scholar] [CrossRef]
- Chauhan, D.; Vande Walle, L.; Lamkanfi, M. Therapeutic modulation of inflammasome pathways. Immunol. Rev. 2020, 297, 123–138. [Google Scholar] [CrossRef]
- Peng, G.; Tsukamoto, S.; Ikutama, R.; Nguyen, H.L.T.; Umehara, Y.; Trujillo-Paez, J.V.; Yue, H.; Takahashi, M.; Ogawa, T.; Kishi, R. Human β-defensin-3 attenuates atopic dermatitis–like inflammation through autophagy activation and the aryl hydrocarbon receptor signaling pathway. J. Clin. Investig. 2022, 132, e156501. [Google Scholar] [CrossRef]
- Liu, W.; Zhuang, J.; Jiang, Y.; Sun, J.; Prinz, R.A.; Sun, J.; Jiao, X.; Xu, X. Toll-like receptor signalling cross-activates the autophagic pathway to restrict Salmonella Typhimurium growth in macrophages. Cell. Microbiol. 2019, 21, e13095. [Google Scholar] [CrossRef]
- Xia, Y.; Liu, N.; Xie, X.; Bi, G.; Ba, H.; Li, L.; Zhang, J.; Deng, X.; Yao, Y.; Tang, Z.; et al. The macrophage-specific V-ATPase subunit ATP6V0D2 restricts inflammasome activation and bacterial infection by facilitating autophagosome-lysosome fusion. Autophagy 2019, 15, 960–975. [Google Scholar] [CrossRef] [PubMed]
- Conte, M.; Nigro, F.; Porpora, M.; Bellomo, C.; Furone, F.; Budelli, A.L.; Nigro, R.; Barone, M.V.; Nanayakkara, M. Gliadin Peptide P31-43 Induces mTOR/NFkβ Activation and Reduces Autophagy: The Role of Lactobacillus paracasei CBA L74 Postbiotc. Int. J. Mol. Sci. 2022, 23, 3655. [Google Scholar] [CrossRef] [PubMed]
- Dinić, M.; Lukić, J.; Djokić, J.; Milenković, M.; Strahinić, I.; Golić, N.; Begović, J. Lactobacillus fermentum postbiotic-induced autophagy as potential approach for treatment of acetaminophen hepatotoxicity. Front. Microbiol. 2017, 8, 594. [Google Scholar] [CrossRef] [PubMed]
- Zheng, J.; Wittouck, S.; Salvetti, E.; Franz, C.M.; Harris, H.M.; Mattarelli, P.; O’toole, P.W.; Pot, B.; Vandamme, P.; Walter, J. A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int. J. Syst. Evol. Microbiol. 2020, 70, 2782–2858. [Google Scholar] [CrossRef]
- Prateeksha; Rao, C.V.; Das, A.K.; Barik, S.K.; Singh, B.N. ZnO/curcumin nanocomposites for enhanced inhibition of Pseudomonas aeruginosa virulence via LasR-RhlR quorum sensing systems. Mol. Pharm. 2019, 16, 3399–3413. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Liu, Q.; Yu, Z.; Tian, F.; Zhao, J.; Zhang, H.; Zhai, Q.; Chen, W. Surface components and metabolites of probiotics for regulation of intestinal epithelial barrier. Microb. Cell Factories 2020, 19, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Toumi, R.; Samer, A.; Soufli, I.; Rafa, H.; Touil-Boukoffa, C. Role of probiotics and their metabolites in inflammatory bowel diseases (IBDs). Gastroenterol. Insight 2021, 12, 56–66. [Google Scholar]
- Johnson, C.N.; Kogut, M.H.; Genovese, K.; He, H.; Kazemi, S.; Arsenault, R.J. Administration of a Postbiotic Causes Immunomodulatory Responses in Broiler Gut and Reduces Disease Pathogenesis Following Challenge. Microorganisms 2019, 7, 268. [Google Scholar] [CrossRef]
- Thuy, T.T.D.; Kuo, P.-Y.; Lin, S.-M.; Kao, C.-Y. Anti-Helicobacter pylori activity of potential probiotic Lactiplantibacillus pentosus SLC13. BMC Microbiol. 2022, 22, 277. [Google Scholar]
- Russo, P.; de Chiara, M.L.V.; Capozzi, V.; Arena, M.P.; Amodio, M.L.; Rascón, A.; Dueñas, M.T.; López, P.; Spano, G. Lactobacillus plantarum strains for multifunctional oat-based foods. LWT-Food Sci. Technol. 2016, 68, 288–294. [Google Scholar] [CrossRef]
- Mekky, A.F.; Hassanein, W.A.; Reda, F.M.; Elsayed, H.M. Anti-biofilm potential of Lactobacillus plantarum Y3 culture and its cell-free supernatant against multidrug-resistant uropathogen Escherichia coli U12. Saudi J. Biol. Sci. 2022, 29, 2989–2997. [Google Scholar] [CrossRef] [PubMed]
- Horvath, P.; Kato, T.; Miyata, T.; Namba, K. Structure of Salmonella Flagellar Hook Reveals Intermolecular Domain Interactions for the Universal Joint Function. Biomolecules 2019, 9, 462. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Qazi, I.H.; Wang, L.; Zhou, G.; Han, H. Salmonella Virulence and Immune Escape. Microorganisms 2020, 8, 407. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.S.; Corredig, M.; Morales-Rayas, R.; Hassan, A.; Griffiths, M.W.; LaPointe, G. Downregulation of Salmonella Virulence Gene Expression During Invasion of Epithelial Cells Treated with Lactococcus lactis subsp. cremoris JFR1 Requires OppA. Probiotics Antimicrob. Proteins 2020, 12, 577–588. [Google Scholar] [CrossRef]
- Horstmann, J.A.; Lunelli, M.; Cazzola, H.; Heidemann, J.; Kühne, C.; Steffen, P.; Szefs, S.; Rossi, C.; Lokareddy, R.K.; Wang, C. Methylation of Salmonella Typhimurium flagella promotes bacterial adhesion and host cell invasion. Nat. Commun. 2020, 11, 2013. [Google Scholar] [CrossRef]
- Mannan, T.; Rafique, M.W.; Bhatti, M.H.; Matin, A.; Ahmad, I. Type 1 fimbriae and motility play a pivotal role during interactions of Salmonella typhimurium with Acanthamoeba castellanii (T4 Genotype). Curr. Microbiol. 2020, 77, 836–845. [Google Scholar] [CrossRef]
- Shi, S.; Qi, Z.; Sheng, T.; Tu, J.; Shao, Y.; Qi, K. Antagonistic trait of Lactobacillus reuteri S5 against Salmonella enteritidis and assessment of its potential probiotic characteristics. Microb. Pathog. 2019, 137, 103773. [Google Scholar] [CrossRef]
- Flemming, H.-C.; Wingender, J.; Szewzyk, U.; Steinberg, P.; Rice, S.A.; Kjelleberg, S. Biofilms: An emergent form of bacterial life. Nat. Rev. Microbiol. 2016, 14, 563–575. [Google Scholar] [CrossRef]
- Steenackers, H.; Hermans, K.; Vanderleyden, J.; De Keersmaecker, S.C. Salmonella biofilms: An overview on occurrence, structure, regulation and eradication. Food Res. Int. 2012, 45, 502–531. [Google Scholar] [CrossRef]
- Iliadis, I.; Daskalopoulou, A.; Simões, M.; Giaouris, E. Integrated combined effects of temperature, pH and sodium chloride concentration on biofilm formation by Salmonella enterica ser. Enteritidis and Typhimurium under low nutrient food-related conditions. Food Res. Int. 2018, 107, 10–18. [Google Scholar] [CrossRef]
- Divyashree, S.; Anjali, P.; Somashekaraiah, R.; Sreenivasa, M. Probiotic properties of Lactobacillus casei–MYSRD 108 and Lactobacillus plantarum-MYSRD 71 with potential antimicrobial activity against Salmonella paratyphi. Biotechnol. Rep. 2021, 32, e00672. [Google Scholar] [CrossRef] [PubMed]
- Tazehabadi, M.H.; Algburi, A.; Popov, I.V.; Ermakov, A.M.; Chistyakov, V.A.; Prazdnova, E.V.; Weeks, R.; Chikindas, M.L. Probiotic Bacilli inhibit Salmonella biofilm formation without killing planktonic cells. Front. Microbiol. 2021, 12, 615328. [Google Scholar] [CrossRef]
- Ijaz, A.; Veldhuizen, E.J.; Broere, F.; Rutten, V.P.; Jansen, C.A. The interplay between Salmonella and intestinal innate immune cells in chickens. Pathogens 2021, 10, 1512. [Google Scholar] [CrossRef] [PubMed]
- Shanmugasundaram, R.; Applegate, T.; Selvaraj, R. Effect of Bacillus subtilis and Bacillus licheniformis probiotic supplementation on cecal Salmonella load in broilers challenged with salmonella. J. Appl. Poult. Res. 2020, 29, 808–816. [Google Scholar] [CrossRef]
- Guan, F.; Shen, L.; Zhou, X.; Chen, Z.; Yu, C.; Zhang, J.; Yuan, Y. Effects of underwater and semi-aquatic environments on gut tissue and microbiota of the mudskipper Boleophthalmus pectinirostris. J. Comp. Physiol. B 2021, 191, 741–753. [Google Scholar] [CrossRef]
- Zhaxi, Y.; Meng, X.; Wang, W.; Wang, L.; He, Z.; Zhang, X.; Pu, W. Duan-Nai-An, A Yeast probiotic, improves intestinal mucosa integrity and immune function in weaned piglets. Sci. Rep. 2020, 10, 4556. [Google Scholar] [CrossRef] [PubMed]
- Olsen, M.S.R.; Thøfner, I.; Sandvang, D.; Poulsen, L.L. Research Note: The effect of a probiotic E. faecium 669 mitigating Salmonella Enteritidis colonization of broiler chickens by improved gut integrity. Poult. Sci. 2022, 101, 102029. [Google Scholar] [CrossRef]
- Rodríguez-Sorrento, A.; Castillejos, L.; López-Colom, P.; Cifuentes-Orjuela, G.; Rodríguez-Palmero, M.; Moreno-Muñoz, J.A.; Martin-Orue, S.M. Effects of Bifidobacterium longum subsp. infantis CECT 7210 and Lactobacillus rhamnosus HN001, combined or not with oligofructose-enriched inulin, on weaned pigs orally challenged with Salmonella typhimurium. Front. Microbiol. 2020, 11, 2012. [Google Scholar] [CrossRef]
- Chanez-Paredes, S.D.; Turner, J.R. Epithelia and gastrointestinal function. In Yamada's Textbook of Gastroenterology; John Wiley & Sons: Hoboken, NJ, USA, 2022; pp. 271–282. [Google Scholar]
- Dong, N.; Li, X.; Xue, C.; Wang, C.; Xu, X.; Bi, C.; Shan, A.; Li, D. Astragalus polysaccharides attenuated inflammation and balanced the gut microflora in mice challenged with Salmonella typhimurium. Int. Immunopharmacol. 2019, 74, 105681. [Google Scholar] [CrossRef]
- Li, Y.; Deng, S.-L.; Lian, Z.-X.; Yu, K. Roles of toll-like receptors in nitroxidative stress in mammals. Cells 2019, 8, 576. [Google Scholar] [CrossRef]
- De Marco, S.; Sichetti, M.; Muradyan, D.; Piccioni, M.; Traina, G.; Pagiotti, R.; Pietrella, D. Probiotic Cell-Free Supernatants Exhibited Anti-Inflammatory and Antioxidant Activity on Human Gut Epithelial Cells and Macrophages Stimulated with LPS. Evid.-Based Complement. Altern. Med. 2018, 2018, 1756308. [Google Scholar] [CrossRef] [PubMed]
- Lebeer, S.; Claes, I.J.; Vanderleyden, J. Anti-inflammatory potential of probiotics: Lipoteichoic acid makes a difference. Trends Microbiol. 2012, 20, 5–10. [Google Scholar] [CrossRef]
- Huang, F.C.; Huang, S.C. The Combined Beneficial Effects of Postbiotic Butyrate on Active Vitamin D3-Orchestrated Innate Immunity to Salmonella Colitis. Biomedicines 2021, 9, 1296. [Google Scholar] [CrossRef]
- Lu, Q.; Guo, Y.; Yang, G.; Cui, L.; Wu, Z.; Zeng, X.; Pan, D.; Cai, Z. Structure and anti-inflammation potential of lipoteichoic acids isolated from Lactobacillus strains. Foods 2022, 11, 1610. [Google Scholar] [CrossRef] [PubMed]
- Kwon, D.H.; Song, H.K. A structural view of xenophagy, a battle between host and microbes. Mol. Cells 2018, 41, 27. [Google Scholar] [PubMed]
- Wu, S.; Shen, Y.; Zhang, S.; Xiao, Y.; Shi, S. Salmonella Interacts With Autophagy to Offense or Defense. Front. Microbiol. 2020, 11, 721. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Wang, J.F.; Liu, N.; Wang, X.; Wang, J.; Yang, G.H.; Yang, G.Y.; Zhu, Y.H. Lactobacillus johnsonii L531 Protects against Salmonella Infantis-Induced Intestinal Damage by Regulating the NOD Activation, Endoplasmic Reticulum Stress, and Autophagy. Int. J. Mol. Sci. 2022, 23, 10395. [Google Scholar] [CrossRef]
- Yuan, L.; Chu, B.; Chen, S.; Li, Y.; Liu, N.; Zhu, Y.; Zhou, D. Exopolysaccharides from Bifidobacterium animalis Ameliorate Escherichia coli-Induced IPEC-J2 Cell Damage via Inhibiting Apoptosis and Restoring Autophagy. Microorganisms 2021, 9, 2363. [Google Scholar] [CrossRef]
- Woo, S.M.; Seo, S.U.; Kim, S.H.; Nam, J.-O.; Kim, S.; Park, J.-W.; Min, K.-J.; Kwon, T.K. Hispidulin enhances TRAIL-mediated apoptosis via CaMKKβ/AMPK/USP51 axis-mediated bim stabilization. Cancers 2019, 11, 1960. [Google Scholar] [CrossRef] [PubMed]
- Shang, L.; Wang, X. AMPK and mTOR coordinate the regulation of Ulk1 and mammalian autophagy initiation. Autophagy 2011, 7, 924–926. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Liu, F.; Xu, C.; Liu, Z.; Ma, J.; Gu, L.; Jiang, Z.; Hou, J. Lactobacillus plantarum 69-2 combined with galacto-oligosaccharides alleviates d-galactose-induced aging by regulating the AMPK/SIRT1 signaling pathway and gut microbiota in mice. J. Agric. Food Chem. 2021, 69, 2745–2757. [Google Scholar] [CrossRef] [PubMed]
- Zhuang, J.; Ji, X.; Zhu, Y.; Liu, W.; Sun, J.; Jiao, X.; Xu, X. Restriction of intracellular Salmonella typhimurium growth by the small-molecule autophagy inducer A77 1726 through the activation of the AMPK-ULK1 axis. Vet. Microbiol. 2021, 254, 108982. [Google Scholar] [CrossRef] [PubMed]






| Gene Names | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| InvA | GCTTGGCTATGTGTTGCGGAAC | CGTGGCATGTCTGAGCACTTCT |
| InvF | TTTGCTGAGTCCTGAGTTTCGC | TCATCGTGTTGCCGCTGGTT |
| SopE | GCCAGACCCGTGAAGCTATACT | TCGCTGCTTCGCCAATTTCCT |
| SopB | GATGCCCGTTATGCGTGAGTGT | TCAGCAGCAGGATGGCTTACCT |
| SipB | GCTGATTGGCAAGGCGATTACC | CGACAACTGCGACCACCACAAT |
| HilA | AATCGTCCGGTCGTAGTGGTGT | TGCGGCAGTTCTTCGTAATGGT |
| SipA | CAACGCCACCAGTGATTCTCCT | GCTTCGCTTCCGCTTTCTTTGT |
| SopD2 | AGCCCGTTTGATGAGTCCTG | ACCTCCAGCACCTCTTGTTT |
| FliF | GAAGCCATTCTGTCGCCTAT | TGTAGTGCTCTTCCGTCTGC |
| LpfA | TTTGCTCTGTCTGCTCTCGC | CTGACCCAGCACAACTTCCT |
| SefA | CTGTCCCGTTCGTTGATGGA | CTGCTGGCAGGGTCGATTTA |
| FimF | CCATTGCCGTATCAGCAAGC | ACAAAACAGCTTCACGTCGC |
| FlhD | CGCCTCGGTATCAACGAAGA | GCGCGAATCCTGAGTCAAAC |
| FliC | TCTGTCCTCTGGTCTGCGTA | TCATTCAGCGCACCTTCAGT |
| FliD | GCCAATTACCAAACAGCAGAG | GACGCCACGGTAGACTTAAATA |
| 16sRNA | CGATGTCTACTTGGAGGTTGTG | CTCTGGAAAGTTCTGTGGATGTC |
| Caspase-1 | GCTCCAACCCTCGGAGAAAG | AACCTTGGGCTTGTCTT |
| IL-1β | GCCACCTTTTGACAGTGATG | GATGTGCTGCTGCGAGATTT |
| IL-18 | ACCTGAAGAAAATGGAGACCTGG | GGGGTTCACTGGCACTTTGA |
| β-actin | GATGTGCTGCTGCGAGATTT | AGGAAGGCTGGAAGAGTGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hu, A.; Huang, W.; Shu, X.; Ma, S.; Yang, C.; Zhang, R.; Xiao, X.; Wu, Y. Lactiplantibacillus plantarum Postbiotics Suppress Salmonella Infection via Modulating Bacterial Pathogenicity, Autophagy and Inflammasome in Mice. Animals 2023, 13, 3215. https://doi.org/10.3390/ani13203215
Hu A, Huang W, Shu X, Ma S, Yang C, Zhang R, Xiao X, Wu Y. Lactiplantibacillus plantarum Postbiotics Suppress Salmonella Infection via Modulating Bacterial Pathogenicity, Autophagy and Inflammasome in Mice. Animals. 2023; 13(20):3215. https://doi.org/10.3390/ani13203215
Chicago/Turabian StyleHu, Aixin, Wenxia Huang, Xin Shu, Shiyue Ma, Caimei Yang, Ruiqiang Zhang, Xiao Xiao, and Yanping Wu. 2023. "Lactiplantibacillus plantarum Postbiotics Suppress Salmonella Infection via Modulating Bacterial Pathogenicity, Autophagy and Inflammasome in Mice" Animals 13, no. 20: 3215. https://doi.org/10.3390/ani13203215
APA StyleHu, A., Huang, W., Shu, X., Ma, S., Yang, C., Zhang, R., Xiao, X., & Wu, Y. (2023). Lactiplantibacillus plantarum Postbiotics Suppress Salmonella Infection via Modulating Bacterial Pathogenicity, Autophagy and Inflammasome in Mice. Animals, 13(20), 3215. https://doi.org/10.3390/ani13203215

