Next Article in Journal
Natural Multi-Enriched Eggs with n-3 Polyunsaturated Fatty Acids, Selenium, Vitamin E, and Lutein
Previous Article in Journal
Comparative Analysis of the Potential for Germ Cell (GC) Differentiation of Bovine Peripheral Blood Derived-Mesenchymal Stem Cells (PB-MSC) and Spermatogonial Stem Cells (SSC) in Co-Culture System with Sertoli Cells (SC)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Biological Characteristics and Differential Expression Patterns of TSSK1B Gene in Yak and Its Infertile Hybrid Offspring

1
Key Laboratory of Qinghai-Tibetan Plateau Animal Genetic Reservation and Exploitation of Ministry of Education, Southwest Minzu University, Chengdu 610041, China
2
Key Laboratory of Animal Science of National Ethnic Affairs Commission, Southwest Minzu University, Chengdu 610041, China
*
Author to whom correspondence should be addressed.
Animals 2023, 13(2), 320; https://doi.org/10.3390/ani13020320
Submission received: 24 October 2022 / Revised: 5 January 2023 / Accepted: 14 January 2023 / Published: 16 January 2023
(This article belongs to the Section Animal Genetics and Genomics)

Abstract

:

Simple Summary

The TSSK1B gene has been demonstrated to play pivotal roles during spermatogenesis and is associated with male fertility. However, the potential mechanism on whether and how TSSK1B disrupts the fertility of yaks remains unknown. In this study, TSSK1B was found to be specifically expressed in the testes of yaks and especially highly expressed in adults. In contrast, it was rarely expressed in the testes of male cattle–yak, the hybrid F1 generation of the yak. The promoter region of TSSK1B in the adult cattle–yak testis was hypermethylated compared with that in the yak, which may be related to male cattle–yak infertility. This study provides the basis for further study of yak reproduction and male cattle–yak sterility.

Abstract

This study aimed to investigate the spatially and temporally expressed patterns and biological characteristics of TSSK1B in male yaks and explore the potential correlation between TSSK1B and male sterility of the yak hybrid offspring (termed cattle–yak). First, the coding sequence (CDS) of TSSK1B was cloned by RT-PCR, and bioinformatics analysis was conducted with relevant software. Quantitative real-time PCR (RT-qPCR) was employed to detect the expression profile of TSSK1B in various tissues of male adult yaks, the spatiotemporal expression of TSSK1B in different stages of yak testes, and the differential expression of TSSK1B between yak and cattle–yak testes. The cellular localization of TSSK1B was determined by immunohistochemistry (IHC). Furthermore, the methylation status of the TSSK1B promoter region was analyzed by bisulfite-sequencing PCR (BSP). The results showed that TSSK1B was 1235 bp long, including 1104 bp of the CDS region, which encoded 367 amino acids. It was a conserved gene sharing the highest homology with Bos mutus (99.67%). In addition, the bioinformatics analysis revealed that TSSK1B was an unstable hydrophilic protein mainly containing the alpha helix of 34.06% and a random coil of 44.41%, with a transmembrane structure of 29 amino acids long. The RT-qPCR results demonstrated that TSSK1B was specifically expressed in yak testes compared with that in other tissues and especially highly expressed in adult yak testes. On the contrary, TSSK1B was hardly expressed in the testis of adult cattle–yak. IHC confirmed that TSSK1B protein was more strongly expressed in the testes of adult yaks than in their fetal and juvenile counterparts. Interestingly, nearly no expression was observed in the testes of cattle–yak compared with the corresponding testes of yak. Bisulfite-sequencing PCR (BSP) revealed that the methylated CpG sites in the TSSK1B promoter region of cattle–yak was significantly higher than that in the yak. Taken together, this study revealed that TSSK1B was specifically expressed in yak testes and highly expressed upon sexual maturity. Moreover, the rare expression in cattle–yak may be related to the hypermethylation of the promoter region, thereby providing a basis for further studies on the regulatory mechanism of TSSK1B in male cattle–yak sterility.

1. Introduction

The yak (Bos grunniens), which mainly lives in the Qinghai–Tibetan Plateau and its vicinity 3500 m above sea level altitude, has strong adaptability to the alpine and hypoxic environment [1]. As one of the specific species that could subsist and reproduce in that area, the yak plays a crucial role in local livelihood and economy. However, the growth and reproductive performance of the yak are quite deficient due to the adverse environment of the plateau. To ameliorate this situation and improve the economic performance of the yak, different kinds of cattle with outstanding traits were introduced to hybridize with the yak, and the F1 generation was termed the cattle–yak [2]. The growth performance, nutrient digestibility, meat quality, and milk performance of the cattle–yak are significantly enhanced, which is called heterosis [3,4,5]. Simultaneously, its adaptability to the Qinghai–Tibetan Plateau is equivalent to that of the yak. Therefore, cattle–yak breeding is an important method to improve the production efficiency of the yak, which is beneficial for the development and economy in that region. However, the male cattle–yak is infertile, as the spermatogenesis is blocked, which greatly restricts its breeding capability and the effective utilization of heterosis. In recent decades, advances in the potential mechanisms have been demonstrated on the basis of cytobiology [6], transcriptomes [7], and proteomics [8] analysis, but uncovering the mechanism of male cattle–yak sterility remains a tremendous challenge.
Testis-specific serine threonine kinase 1B (TSSK1B), a kind of protein kinase, plays a key role in numerous biological processes, such as gene expression, signal transduction, and cellular metabolism, by transferring the phosphate groups to the serine, threonine, or tyrosine residuals of substrates. These kinds of phosphorylation of proteins are reversible post-translational modification, and they regulate the functions of cells [9]. Five members of TSSKs, namely TSSK1, TSSK2, TSSK3, TSSK4, and TSSK6, were found in previous studies [10,11,12,13,14,15] to be specifically expressed in the spermatozoa and testes, indicating that TSSKs play pivotal roles in male reproduction. In humans, TSSK1 presents as TSSK1A, a pseudogene that links to TSSK2 to form a tandem [16]. In the targeted knockout of TSSK1 and TSSK2, male chimeras appeared, and germ cells with mutant allele were generated, indicating that TSSKs are related to the infertility of male chimeras [17]. Other research also found that PPP1CC2 could form the complex with TSSK1 by directly interacting with testis-specific serine kinase substrate [18]. A recent transcriptome study reported that TSSK1B, TSSK2, and TSSK6 were significantly downregulated in cattle–yak testes compared with those in the yak [19], indicating that TSSKs may be associated with the blocked spermatogenesis of cattle–yaks. Hence, understanding the role of TSSKs in male spermatogenesis is fundamental for extensive research on the mechanism of male infertility.
This study aimed to characterize yak TSSK1B by providing the complete coding region sequence and molecular characterization. Tissue-specific TSSK1B mRNA expression levels in several yak tissues were detected. The spatial and temporal expression of TSSK1B in yak testes among various stages were determined, along with the comparison of the relative TSSK1B mRNA expression levels in testis tissue between yak and cattle–yak through quantitative real-time PCR (RT-qPCR). In addition, immunohistochemistry (IHC) was performed as a supplementary analysis of TSSK1B expression in the testis development of yaks and cattle–yaks. The methylation status of the TSSK1B promoter region was determined by bisulfite-sequencing PCR (BSP) to explore the possible cause that influenced the expression status of TSSK1B in cattle–yak testis. This study could facilitate the understanding of the biological role of TSSK1B in male reproduction and help explore the potential mechanism of cattle–yak male sterility.

2. Materials and Method

2.1. Ethics Statement

All chemicals used were purchased from Sigma Chemical Company (St. Louis, MO, USA), unless otherwise noted. All animal-related experiments were in accordance with the Southwest Minzu University Animal Care and Use Committee and performed in accordance with the National Research Council’s Guide Principles for Animal Welfare and Ethics.

2.2. Tissues Collection

The heart, liver, spleen, lung, kidney, intestine, muscle, and testis tissue samples of three healthy adult Maiwa yaks and hybridized cattle–yaks (3–4 years old) and testis tissue samples of three fetal (5–6 months old) and juvenile (1–2 years old) yaks were collected from a slaughterhouse in Hongyuan County (altitude of approximately 4000 m), Sichuan Province. The collected samples were conserved in a liquid nitrogen container immediately on the spot after cleaning with PBS for subsequent experiments.

2.3. RNA Extraction and cDNA Synthesis

The total RNAs of the collected tissues were extracted with TRIzol reagent in accordance with the manufacturer’s instructions. The concentration and purity of the RNA samples were detected by a NanoDrop 2000 spectrophotometer (ThermoFisher, Waltham, MA, USA). The ReverAid First Strand cDNA Synthesis Kit (ThermoFisher, Waltham, MA, USA) was used to reverse the transcription of RNA, following the manufacturer’s guidelines. The quality of the cDNA samples was evaluated by NanoPhotometer N60 (Implen, Westlake Village, CA, USA) and then stored at −20 °C for further use.

2.4. Gene Cloning and Sequencing

The primers of TSSK1B (shown in Table 1) were designed by NCBI Primer-BLAST (NCBI, Bethesda, MD, USA) according to the predicted sequence of hybrid cattle (Accession number: XM_027566040.1). The previous cloning protocol of the laboratory [20] was referred in each amplification system (25 μL), including 1 μL of forward and reverse primers, 12.5 μL of 2×Rapid Taq Master Mix (Vazyme, Nanjing, China), 1 μL of cDNA synthesized from all tissue samples, and 9.5 μL ddH2O. The PCR procedure was as follows: 95 °C for 3 min, followed by 35 cycles of 95 °C for 15 s, 57 °C for 15 s, 72 °C for 1 min, and 72 °C for 5 min. The PCR products were identified by gel electrophoresis. The purified amplification products were then recovered and ligated to pMD19-T vector (Takara, Japan) and finally transformed into E. coli DH5a cells. The positive colonies of TSSK1B were selected for sequencing by Sangon Biotech Co., Ltd. (Shanghai, China).

2.5. Bioinformatics Analysis

The yak TSSK1B cDNA sequences were subjected to BLAST analysis for confirmation. Then the cDNA sequence was analyzed by the ORF Reader program of NCBI (https://www.ncbi.nlm.nih.gov/orffinder/ (accessed on 15 August 2022). The amino acid sequence was predicted by DNAMAN 9.01, as described in a previous study [21], and the properties of the predicted amino acid sequence were inspected by BioEdit 7.0 software, the online Expasy ProtParam Tool (https://web.expasy.org/protparam/ (accessed on 15 August 2022)), and the SignalP-5.0 online program (https://services.healthtech.dtu.dk/service.php?SignalP-5.0) (accessed on 15 August 2022). In order to predict the secondary and tertiary structures and the domains of proteins encoding TSSK1B, the online tool SOPMA portal (https://npsa-prabi.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_sopma.html (accessed on 15 August 2022)), the SWISS-Model (https://swissmodel.expasy.org/interactive) (accessed on 15 August 2022), and InterPro (http://www.ebi.ac.uk/interpro/ (accessed on 15 August 2022)) were employed, respectively [22]. The phosphorylation sites were also analyzed by the online portal NetPhos 3.1 (https://services.healthtech.dtu.dk/service.php?NetPhos-3.1) (accessed on 15 August 2022). The Nucleotide BLAST portal of NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 15 August 2022) was utilized to obtain the homeotic sequence from various species based on the NCBI GenBank database, following the alignment of the coding sequence (CDS) region of cloning TSSK1B sequence with the retrieved homeotic sequences. An evolutionary tree was established by MEGA 7.0 software in accordance with the abovementioned analysis.

2.6. Quantitative Real-Time PCR (RT-qPCR)

The relative mRNA expression of TSSK1B in each tissue sample of yak and cattle–yak was detected by RT-qPCR, following the previous study [20]. The primers of TSSK1B for RT-qPCR were designed, as shown in Table 1. Each amplification system (20 μL) included 1 μL of forward and reverse primers, 10 μL of 2×NovoStart®SYBR qPCR SuperMix Plus (Novoprotein, Suzhou, China), and 1 μL of diluted cDNA supplied with 7 μL RNase free water up to 20 μL. The CFX96TM system (Bio-Rad, Hercules, CA, USA) was used with the following program steps: 95 °C for 1 min, 40 cycles of 95 °C for 20 s, and 60 °C for 1 min, followed by dissociation curve and cool down. The relative fold change of genes was calculated by 2–∆∆Ct method, and glyceraldehyde-3-phosphate dehydrogenase (Gapdh) was used as the housekeeping gene for data normalization. Each sample analysis was repeated independently in triplicate. For easy comparison of the relative expression of TSSK1B in various organs, the expression in heart was set to 1 (control group). The TSSK1B expression of adult yak testis was also set as the control group when contrasting the differential expression in yak testes of different ages and the expression in adult cattle–yak testes.

2.7. Immunohistochemistry (IHC) Analysis

IHC was performed as described in the previous study [23]. In brief, testicular samples from fetal, juvenile, and adult yaks and adult cattle–yaks (n = 3, respectively) were collected and immediately fixed with 4% paraformaldehyde. After being embedded in paraffin, 4 μm sections were obtained, and then the sections were deparaffinized and rehydrated in ethanol-to-water graded series, followed by hydrating with an ethanol gradient from 100% to 70%. After antigen retrieval was performed with 5% FBS at room temperature for 1 h, the sections were incubated with primary TSSK1B antibody (1:50, PA5-55706, Thermo, Waltham, MA, USA) overnight at 4 °C, washed with PBS, and incubated with HRP-conjugated secondary antibody (1:200, bs-0295G-HRP, Bioss, Beijing, China) at 37 °C for 2 h. Images were obtained by using a Zeiss LSM800 confocal microscope (Observer Z1, Zeiss, Germany).

2.8. Genome DNA Extraction and Bisulfite Modification

Samples of less than 25 mg were incubated overnight at 55 °C with protein kinase K and RNase before the utilization of DNA Extraction Kit (Solarbio, Beijing, China) Kit, in accordance with the manufacturer’s instructions, to extract the genome DNA from the testis tissues of yaks and cattle–yaks. The purified DNA samples were treated with the EpiArt® DNA Methylation Bisulfite Kit (EM101, Vazyme, Nanjing, China) by following the instructions of the manufacturer. The bisulfite treatment converted the unmethylated cytosine bases to thymine bases (C-T), whereas the methylated cytosine bases remained unchanged [24].

2.9. CpG Islands (CGI) Prediction and Bisulfite-Sequencing PCR (BSP)

For the analysis of the TSSK1B promoter methylation status of yak and cattle–yak testis, a 2000 bp sequence before transcription start sites of TSSK1B was selected to predict the CGIs [25]. The specific primers for BSP were designed in accordance with the online program MethPrimer (http://www.urogene.org/methprimer/ (accessed on 9 September 2022), as shown in Table 1).
BSP was performed by using 2× EpiArt ® HS Taq Master Mix (EM202, Vazyme, Nanjing, China), following the instructions of the manufacturer. The reaction conditions were as follows: 95 °C for 5 min, followed by 45 cycles of 95 °C for 30 s, 51 °C for 30 s, 72 °C for 30 s, and 72 °C for 5 min. The bisulfite-converted genomic DNA was used as the template. The PCR products were identified on 2.5% gel electrophoresis to purify the PCR products. Ten replicated amplification products of yak and cattle–yak were randomly selected and delivered to Sangon Biotech Co., Ltd. (Shanghai, China), for purification and sequencing. The sequencing results were aligned and analyzed by the BiQ-analyzer software. The methylation levels were represented as the ratio of unchanged CpG sites to all CpG sites in each sample.

2.10. Statistical Analysis

The mRNA expression and methylation status of TSSK1B were analyzed by SPSS 20.0, with one-way analysis of variance (ANOVA), and histograms were depicted by GraphPad Prism 8.0. The data are presented as the mean ± standard error (SE). A p < 0.05 was considered significantly different. * Represents p < 0.05, and ** represents p < 0.01.

3. Results

3.1. TSSK1B cDNA Cloning and Molecular Characterization

The cDNA from the testis tissue of yak was employed as the cloning template. According to the sequencing results, a 1235 bp fragment was obtained from yak testis (Figure 1A). The yak TSSK1B comprised a 1104 bp CDS region, which was predicted to encode 367 amino acids (Figure 1B). Aligning the sequence of yak TSSK1B with the orthologs derived from the NCBI showed the highest similarity of 99.67% to Bos mutus, followed by 99.42%, 98.27%, 96.29%, 94.97%, 94.72%, 89.99%, 88.56%, 88.35%, and 86.48% to Bos taurus, Bubalus bubalis, Cervus elaphus, Capra hircus, Ovis aries, Equus asinus, Camelus ferus, Mustela erminea, and Marmota monax, respectively. This finding indicated that the TSSK1B of yak was similar to that of cattle and highly conserved during evolution. A phylogenetic tree was also constructed and showed that the TSSK1B of yak was found to be clustered in an isoform with B. mutus, consistent with the ortholog analysis (Figure 2).
The deduced amino acid sequence was employed to analyze the protein structure and properties of yak TSSK1B. The predicted molecular weight was 41.5 kDa, with an isoelectric point (pI) of 7.49. The secondary structure of TSSK1B was mainly composed of 34.06% alpha helix, 6.81% beta turn, 14.71% extended strand, and 44.41% random coil (Figure 3A). The predicted tertiary structure of TSSK1B protein was close to the secondary structure (Figure 3B), and the characteristic sequence of protein kinase was obtained as the online report suggested. The estimated aliphatic index was 81.34, and the hydropathicity value was −0.532, which indicated that TSSK1B was a hydrophilic protein (Figure 3C). According to the signal peptide and transmembrane segment detection, a transmembrane structure of 29 amino acids long from 197 to 225 locus of the peptide chain was acquired (Figure 3D), whereas no signal peptide was discovered. The phosphorylation site analysis found twenty-nine positive phosphorylation sites, including nineteen serines, seven threonines, and three tyrosines, in yak TSSK1B (Figure 3E). The instability index was 57.06 (>40), implying that this protein was unstable. The prediction of the TSSK1B protein domain suggested that it possessed protein kinase activity and an ATP binding site that were usually considered to be the portions of the protein phosphorylation process.

3.2. Expression Pattern of TSSK1B in Yak and Cattle–Yak Tissue

RT-PCR and RT-qPCR were utilized to explore the expression pattern of TSSK1B in the testes of yak and cattle–yak, and the amplification products with a similar template concentration were detected by agarose gel electrophoresis. The expression levels of TSSK1B in eight tissues of adult yak (heart, liver, spleen, lung, kidney, intestine, muscle, and testis) were determined by RT-qPCR. The results indicated that the transcription level of TSSK1B in testis was significantly higher (p < 0.01) than that in the other seven tissues (Figure 4A), and no significant difference was found among these seven tissues. This finding is consistent with the gel electrophoresis image, in which a unique band appeared in the testicular sample (Figure 4D). The comparison of the mRNA expression of TSSK1B in yak testis from different ages implied that TSSK1B was highly expressed in adult yak testes and extremely lowly expressed in the fetal and juvenile stages (p < 0.01, Figure 4B), which was also identified by the absent band in the gel electrophoresis of fetal and juvenile yak testis samples (Figure 4E). A notable detail was that the RT-PCR and RT-qPCR reflected that TSSK1B was highly expressed in male adult yak testes and almost not expressed in cattle–yak testes (p < 0.01, Figure 4C, F).

3.3. The Immunohistochemistry Analysis of Yak and Cattle–Yak Testes

The cellular localization and differential expression of TSSK1B were evaluated by IHC (Figure 5), and the results indicated that TSSK1B was mainly expressed in the testes of adult yaks, including spermatogonial stem cells, spermatogonium (SP), primary spermatocyte (PS), secondary spermatocyte, and surrounding Leydig cells. Low expression was also found in the fetal and juvenile yak testes. However, almost no expression was observed during the growth of cattle–yak testes, significantly different from yaks. Compared with yak testes, the morphology of seminiferous tubule in cattle–yak testes was not significantly different at the fetal stage, but the cavity was smaller in adult cattle–yak testes, and only low numbers of SP, PS, and Sertoli cells (SCs) were loosely distributed in the cattle–yak testis.

3.4. DNA Methylation Status in the Promoter Region of TSSK1B

In accordance with BSP and sequencing, the DNA methylation status in the TSSK1B promoter region of yak and cattle–yak testes was determined. The agarose gel electrophoresis image (Figure 6A,B) indicated that the bisulfite-converted DNA fragments with 231 bp were obtained from yak and cattle–yak testes. A total of 15 available CpG sites of the amplified products were selected to analyze the methylation status (Figure 6C,D). The methylation frequencies of these 15 CpG sites in the yak and cattle–yak testis samples were 22.0% (33/150) and 45.3% (68/150), respectively (Figure 6E). These results suggested that the promotor region of TSSK1B was hypermethylated in the cattle–yak testis (p < 0.01).

4. Discussion

As a member of the protein kinase family, TSSK1B plays a key role in the germ-cell development of male animals. This study was the first to explore the molecular characterization and expression profile of yak TSSK1B, and the results indicated that TSSK1B was a highly conserved gene with a significant spatiotemporal-specific expression pattern. Furthermore, the mRNA and protein expression levels of TSSK1B was highly expressed in adult yak testis, accompanied by hypomethylation in the promotor region, compared with that of cattle–yak. This study may be beneficial for improving the male reproductive efficiency of yaks and exploring the mechanism of male sterility in the cattle–yak.
First, the completed cDNA sequence of TSSK1B was obtained from adult yak testis, and the deduced CDS region encoded 367 amino acids, similar to the results of the previous study on other species [26,27,28]. The ortholog analysis results suggested that TSSK1B was highly conserved during evolution among mammals, and the homology analysis results showed that the TSSK1B in yaks had similar homology to that in B. mutus (wild yak) and B. taurus (cattle), which was higher than 98%. Although the lowest homology was found in M. monax, it was also more than 86%. The results of the present study are consistent with those of a previous study on the Pacific abalone [29]. Furthermore, working as a protein kinase, TSSK1B possessed a specific catalytic domain of protein kinase, and it probably catalyzed the transfer of the gamma-phosphory l group from ATP to hydroxyl groups in specific substrates, such as serine or threonine residues of proteins. Similar to other types of protein kinase, TSSK1B plays a crucial role in intercellular signaling [9]. The findings on multiple phosphorylation sites, especially those enriching serine and threonine residues, confirmed this feature. The property analysis of TSSK1B protein showed instability, which may be related to its potential catalysis function during the phosphorylation and dephosphorylation process. These results indicated that the yak TSSK1B was highly conserved in evolution, with poor protein stability.
The testis is a crucial organ for male domestic animals to generate germ cells and sexual hormones. In the testis, the spermatogenesis could be divided into three phases: the proliferation stage, where the spermatogonia generates a pool of spermatocytes by mitotic division; the meiosis stage, where haploid spermatids are generated; and the spermiogenesis stage, which allows the spermatids to be differentiated into spermatozoa [30]. In the current study, the expression pattern of TSSK1B in various yak tissues was detected by RT-qPCR, and the results showed that TSSK1B was specifically expressed in yak testis, which was typically observed in mammalian TSSK1B and in agreement with other previous study [13,31]. Furthermore, the mRNA expression abundances of yak TSSK1B transcripts were correlated with the age of the males, in which a positive relationship could be observed between TSSK1-like expression levels and the degree of testis maturation. Based on the result of the RT-qPCR, TSSK1B was highly expressed in adult yak testis and significantly differed with the stage before sexual maturity. The IHC data were in agreement with the results of the RT-qPCR and previous studies [32]. In addition, the expression of TSSK1B mRNA in yak testis was significantly higher than that in their cattle–yak counterparts. This finding indirectly provided a possible assumption of TSSK1B involvement in male germ-cell differentiation during late-phase spermatogenesis. The previous study showed that the TSSK family was almost highly expressed in the testis compared to that in other tissues in the mouse, and the expression started at 21 d after birth, indicating that TSSKs were expressed after meiosis [15]. Furthermore, TSSK1 was expressed in the later stage of spermiogenesis and mainly detected in condensed spermatids [15]. However, additional monitoring for TSSK1B expression in older males may be required to confirm the present study’s hypothesis and verify the developmental stage showing the onset of TSSK1B expression during spermatogenesis.
As the F1 hybridized offspring of yak with other cattle, cattle–yaks attract much attention due to their remarkable traits compared with yak, though the male cattle–yak is infertile. The expression of TSSK1B in male cattle–yak testis was investigated in this study to explore the potential reason for sterility. A notable detail is that the relative expression of TSSK1B in adult cattle–yak testis was significantly lower than that in yak testis, indicating that the male sterility with no sperm may be related to the expression abundance of TSSK1B. The histological analysis of cattle–yak testis also exhibited smaller seminiferous tubules with few SC, PS, and other cells. This finding was explained by other research on the cattle–yak; that is, such a phenomenon may be due to the germ-cell apoptosis being initiated at the pachytene stage and the meiosis being blocked [33]. This phenomenon was also observed in a medical case in which a patient with a heterozygous deletion in 5q22.2q23.1 (including TSSK1B) suffered from asthenoteratozoospermia, with cephalic defects, numerous atypical sperm morphologies, and low sperm motility, thus demonstrating that TSSK1B regulates spermatozoan development and quality [34]. Other studies on the transcriptome of gonad and gametogenesis demonstrated that the TSSK1-like gene is vital to male gonadal development and spermatogenesis [35,36]. Considering the specific expression of TSSK1B in yak testis with increasing age and the relationship between TSSK1B expression and the developmental status of the germline in testis, the low expression of TSSK1B in male cattle–yak testis may influence the generation of mature spermatozoa and lead to the infertility of male cattle–yak.
DNA methylation is an essential reversible epigenetic modification of the genome for mammalian gametogenesis and embryonic development, which undergoes extensive reprogramming during the oogenesis and spermatogenesis, with changes in the expression of related genes. DNA methylation has been proven to regulate gene expression and contribute to the alteration of the transcriptome and deregulation of cellular pathways [37]. It is usually considered to be a transcriptional repressive mark because of the ability to decrease the efficiency of promoters [38]. A study on the promoter region of yak HIF found that demethylation may be related to the higher expression of HIF in yak tissues than in general cattle [39]. Abnormal DNA methylation has always served as the biomarker of many diseases [40,41,42], such as cancers [43]. As for the genome, the upstream 2000 bp from the transcription start site is generally considered as the promoter region of the gene [25]. The CpG-rich regions, which are also known as CGIs, are widely recognized at the promoter region and associated with the TSS of genes [44]. In vertebrates, the inheritable DNA methylation often occurs at CpG sites and is related to the transcriptional silencing of genes [45]. The CGIs that overlap with the promoter regions usually remain unmethylated in the germline [46]. For further exploration of the potential mechanism of the expression suppression of TSSK1B in cattle–yak testis, the methylated CpG sites in the predicted CGIs of the TSSK1B promoter region were detected via BSP, a general method that is based on cloning and sequencing to detect DNA methylation at specific CpG sites, to contrast the methylation levels of TSSK1B in yak and cattle–yak testis. The results showed that the methylation level of the TSSK1B promoter region of cattle–yak was significantly higher than that of yak, in agreement with the result of RT-qPCR. This inhibition effect of the highly methylated promoter region was also reported in the study of sperm samples from infertile men, in which asthenoteratospermia and oligoasthenoteratospermia could easily appear and the methylation frequencies in the promoter regions of hsa-miR-449 and hsa-miR-34b family were significantly high [47,48]. Given the low expression of TSSK1B in cattle–yak testis, as shown in the RT-qPCR results, the higher methylation of CGIs in the TSSK1B promoter region of cattle–yak testis may downregulate the transcription and expression of TSSK1B and ultimately influence the spermateleosis in cattle–yak testis, which leads to infertility.
Throughout the whole study, we found a potential relationship between TSSK1B expression and male cattle–yak infertility. However, the complete mechanism and regulatory pathway of male infertility in male cattle–yak require further study, such as establishing cell and animal knockout models and conducting a proteome analysis.

5. Conclusions

In summary, TSSK1B was a relatively conserved gene that was specifically expressed in yak testis, especially after sexual maturity, indicating a close relationship to spermatogenesis. Furthermore, the differential expression of TSSK1B in the cattle–yak testis was associated with the hypermethylation of the promoter region, which may be one of the causes for the male sterility of cattle–yak.

Author Contributions

Y.Z. and X.X. designed the study and drafted the original manuscript; Y.Z., B.P. and X.F. carried out all the experimental analysis; Y.H. analyzed the data, contributed new analytical tools; M.Y. and H.Y. contributed to writing—review and editing the manuscript. J.L. provided funding for this project. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Key Research and Development Program of Sichuan Provincial Science and Technology Program (No. 2021YFN0121), Special Project of Sichuan Beef Cattle Innovation Team of National Agricultural Industrial Technology System (SCCXTD-2022-13), and the Fundamental Research Funds for the Central Universities of Southwest Minzu University (No. 2022NYXXS032).

Institutional Review Board Statement

The experimental animals and operating procedures in this study obeyed the policies of national and local animal welfare agencies and were approved by the Animal Care and Use Committee of Southwest Minzu University and performed in accordance with animal welfare and ethics.

Informed Consent Statement

No human samples were involved in this study.

Data Availability Statement

Data sharing is not applicable to this article.

Acknowledgments

All authors thanks for the help of Sangon Biotech Co., Ltd. (Shanghai, China) for providing the servers of sequencing for this research.

Conflicts of Interest

The authors declare that the authors or author’s institution have no financial or other relationship with other people or organizations that may inappropriately influence the author’s work, and manuscript is approved by all authors for publication.

References

  1. Yang, L.; Min, X.; Zhu, Y.; Hu, Y.; Yang, M.; Yu, H.; Li, J.; Xiong, X. Polymorphisms of SORBS 1 Gene and Their Correlation with Milk Fat Traits of Cattleyak. Animals 2021, 11, 3461. [Google Scholar] [PubMed]
  2. Shah, M.A.; Xu, C.; Wu, S.; Zhao, W.; Luo, H.; Yi, C.; Liu, W.; Cai, X. Isolation and characterization of spermatogenic cells from cattle, yak and cattleyak. Anim. Reprod. Sci. 2018, 193, 182–190. [Google Scholar] [PubMed]
  3. Dai, Q.; Ma, J.; Cao, G.; Hu, R.; Zhu, Y.; Li, G.; Zou, H.; Wang, Z.; Peng, Q.; Xue, B.; et al. Comparative study of growth performance, nutrient digestibility, and ruminal and fecal bacterial community between yaks and cattle-yaks raised by stall-feeding. AMB Express 2021, 11, 98. [Google Scholar] [PubMed]
  4. Wang, Y.; Wang, Z.; Hu, R.; Peng, Q.; Xue, B.; Wang, L. Comparison of carcass characteristics and meat quality between Simmental crossbred cattle, cattle-yaks and Xuanhan yellow cattle. J. Sci. Food Agric. 2021, 101, 3927–3932. [Google Scholar] [PubMed]
  5. Marquardt, S.; Barsila, S.R.; Amelchanka, S.L.; Devkota, N.R.; Kreuzer, M.; Leiber, F. Fatty acid profile of ghee derived from two genotypes (cattle-yak vs yak) grazing different alpine Himalayan pasture sites. Anim. Prod. Sci. 2016, 58, 358–368. [Google Scholar]
  6. Shimazaki, M.; Wittayarat, M.; Sambuu, R.; Sugita, A.; Kawaguchi, M.; Hirata, M.; Tanihara, F.; Takagi, M.; Taniguchi, M.; Otoi, T.; et al. Disruption of cell proliferation and apoptosis balance in the testes of crossbred cattle-yaks affects spermatogenic cell fate and sterility. Reprod. Domest. Anim. 2022, 57, 999–1006. [Google Scholar] [PubMed]
  7. Wu, S.; Mipam, T.D.; Xu, C.; Zhao, W.; Shah, M.A.; Yi, C.; Luo, H.; Cai, X.; Zhong, J. Testis transcriptome profiling identified genes involved in spermatogenic arrest of cattleyak. PLoS ONE 2020, 15, e0229503. [Google Scholar]
  8. Zhao, W.; Ahmed, S.; Liu, J.; Ahmed, S.; Quansah, E.; Solangi, T.H.; Wu, Y.; Yangliu, Y.; Wang, H.; Zhu, J.; et al. Comparative iTRAQ proteomics identified proteins associated with sperm maturation between yak and cattleyak epididymis. BMC Vet. Res. 2021, 17, 255. [Google Scholar]
  9. Bononi, A.; Agnoletto, C.; De Marchi, E.; Marchi, S.; Patergnani, S.; Bonora, M.; Giorgi, C.; Missiroli, S.; Poletti, F.; Rimessi, A.; et al. Protein kinases and phosphatases in the control of cell fate. Enzym. Res. 2011, 2011, 329098. [Google Scholar]
  10. Bielke, W.; Blaschke, R.J.; Miescher, G.C.; Zürcher, G.; Andres, A.C.; Ziemiecki, A. Characterization of a novel murine testis-specific serine/threonine kinase. Gene 1994, 139, 235–239. [Google Scholar]
  11. Kueng, P.; Nikolova, Z.; Djonov, V.; Hemphill, A.; Rohrbach, W.; Boehlen, D.; Zuercher, G.; Andres, A.C.; Ziemiecki, A. A novel family of serine/threonine kinases participating in spermiogenesis. J. Cell Biol. 1997, 139, 1851–1859. [Google Scholar] [PubMed] [Green Version]
  12. Visconti, P.E.; Hao, Z.; Purdon, M.A.; Stein, P.; Balsara, B.R.; Testa, J.R.; Moss, S.B.; Kopf, G.S. Cloning and chromosomal localization of a gene encoding a novel serine/threonine kinase belonging to the subfamily of testis-specific kinases. Genomics 2001, 77, 163–170. [Google Scholar] [PubMed]
  13. Hao, Z.; Jha, K.N.; Kim, Y.H.; Vemuganti, S.; Westbrook, V.A.; Chertihin, O.; Markgraf, K.; Flickinger, C.J.; l Coppola, M.; Herr, J.C.; et al. Expression analysis of the human testis-specific serine/threonine kinase (TSSK) homologues. A TSSK member is present in the equatorial segment of human sperm. Mol. Hum. Reprod. 2004, 10, 433–444. [Google Scholar] [PubMed]
  14. Spiridonov, N.A.; Wong, L.; Zerfas, P.M.; Starost, M.F.; Pack, S.D.; Paweletz, C.P.; Johnson, G.R. Identification and characterization of SSTK, a serine/threonine protein kinase essential for male fertility. Mol. Cell. Biol. 2005, 25, 4250–4261. [Google Scholar]
  15. Li, Y.; Sosnik, J.; Brassard, L.; Reese, M.; Spiridonov, N.A.; Bates, T.C.; Johnson, G.R.; Anguita, J.; Visconti, P.E.; Salicioni, A.M. Expression and localization of five members of the testis-specific serine kinase (Tssk) family in mouse and human sperm and testis. Mol. Hum. Reprod. 2011, 17, 42–56. [Google Scholar]
  16. Shang, P.; Hoogerbrugge, J.; Baarends, W.M.; Grootegoed, J.A. Evolution of testis-specific kinases TSSK1B and TSSK2 in primates. Andrology 2013, 1, 160–168. [Google Scholar] [PubMed]
  17. Xu, B.; Hao, Z.; Jha, K.N.; Zhang, Z.; Urekar, C.; Digilio, L.; Pulido, S.; Strauss, J.F.; Flickinger, C.J.; Herr, J.C. Targeted deletion of Tssk1 and 2 causes male infertility due to haploinsufficiency. Dev. Biol. 2008, 319, 211–222. [Google Scholar] [PubMed]
  18. MacLeod, G.; Shang, P.; Booth, G.T.; Mstropaolo, L.A.; Manafpoursakha, N.; Vogl, A.W.; Varmuza, S. PPP1CC2 can form a kinase/phosphatase complex with the testis-specific proteins TSSK1 and TSKS in the mouse testis. Reproduction 2014, 147, 1–12. [Google Scholar] [PubMed] [Green Version]
  19. Cai, X.; Yu, S.M.; Mipam, T.D.; Yang, F.; Zhao, W.; Liu, W.; Cao, S.; Shen, L.; Zhao, F.; Sun, L.; et al. Comparative analysis of testis transcriptomes associated with male infertility in cattleyak. Theriogenology 2017, 88, 28–42. [Google Scholar]
  20. Zhao, D.; Wu, J.; Ma, Y.; Zhang, J.; Feng, X.; Fan, Y.; Xiong, X.; Fu, W.; Li, J.; Xiong, Y. The molecular characteristic analysis of TRIB2 gene and its expressional patterns in Bos grunniens tissue and granulosa cells. Anim. Biotechnol. 2022, 1–9. [Google Scholar] [CrossRef]
  21. Wang, H.; Wang, L.; Luo, X.; Guan, J.; Zhang, X.; Xiang, Y. Molecular characterization, expression and anti-tumor function analysis of yak IFITM2 gene. Int. J. Biol. Macromol. 2022, 209, 405–412. [Google Scholar]
  22. Pei, S.; Qin, F.; Wang, L.; Li, W.; Li, F.; Yue, X. PRAMEY: A Bovid-Specific Y-Chromosome Multicopy Gene Is Highly Related to Postnatal Testicular Growth in Hu Sheep. Animals 2022, 12, 2380. [Google Scholar]
  23. Zhao, D.; Fan, Y.; Xiong, X.; Yin, S.; Fu, W.; Ma, Y.; Yue, Y.; Zhao, Z.; Li, J.; Xiong, Y. Molecular characterization of TRIB1 gene and its role in regulation of steroidogenesis in Bos grunniens granulosa cells. Theriogenology 2022, 191, 1–9. [Google Scholar]
  24. Schrott, R.; Modliszewski, J.L.; Hawkey, A.B.; Grenier, C.; Holloway, Z.; Evans, J.; Pippen, E.; Corcoran, D.L.; Levin, E.D.; Murphy, S.K. Sperm DNA methylation alterations from cannabis extract exposure are evident in offspring. Epigenet. Chromatin 2022, 15, 33. [Google Scholar] [PubMed]
  25. Luo, H.; Mipam, T.D.; Wu, S.; Xu, C.; Yi, C.; Zhao, W.; Chai, Z.; Chen, X.; Wu, Z.; Wang, J.; et al. DNA methylome of primary spermatocyte reveals epigenetic dysregulation associated with male sterility of cattleyak. Theriogenology 2022, 191, 153–167. [Google Scholar]
  26. Wang, P.; Huo, H.L.; Wang, S.Y.; Miao, Y.W.; Zhang, Y.Y.; Zhang, Q.L.; Li, F.Q.; Liu, L.X.; Li, W.Z.; Zeng, Y.Z.; et al. Cloning, sequence characterization, and expression patterns of members of the porcine TSSK family. Genet. Mol. Res. 2015, 14, 14908–14919. [Google Scholar] [PubMed]
  27. Li, X.; Li, Y.; Song, W.; Xie, D.; Zhu, F.; Yang, M.; Li, Y. cDNA cloning, expression and bioinformatical analysis of Tssk genes in tree shrews. Comput. Biol. Chem. 2021, 92, 107474. [Google Scholar]
  28. Li, H.H.; Kong, L.F.; Yu, R.; Yu, H.; Li, Q. Characterization, expression, and functional analysis of testis-specific serine/threonine kinase 1 (Tssk1) in the pen shell Atrina pectinata. Invertebr. Reprod. Dev. 2016, 60, 118–125. [Google Scholar]
  29. Kim, E.J.; Kim, S.J.; Park, C.J.; Nam, Y.K. Characterization of testis-specific serine/threonine kinase 1-like (TSSK1-like) gene and expression patterns in diploid and triploid Pacific abalone (Haliotis discus hannai; Gastropoda; Mollusca) males. PLoS ONE 2019, 14, e0226022. [Google Scholar]
  30. Nishimura, H.; L’Hernault, S.W. Spermatogenesis. Curr. Biol. 2017, 27, R988–R994. [Google Scholar] [PubMed] [Green Version]
  31. Xue, X.; Zhang, L.; Li, Y.; Wei, H.; Wu, S.; Liu, T.; Liu, L.; Xing, Q.; Wang, S.; Bao, Z. Expression of the testis-specific serine/threonine kinases suggests their role in spermiogenesis of bay scallop argopecten irradians. Front. Physiol. 2021, 12, 657559. [Google Scholar] [CrossRef] [PubMed]
  32. Shang, P.; Baarends, W.M.; Hoogerbrugge, J.; Ooms, M.P.; van Cappellen, W.A.; de Jong, A.A.W.; Dohle, G.R.; van Eenennaam, H.; Gossen, J.A.; Grootegoed, J.A. Functional transformation of the chromatoid body in mouse spermatids requires testis-specific serine/threonine kinases. J. Cell Sci. 2010, 123, 331–339. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Niayale, R.; Cui, Y.; Adzitey, F. Male hybrid sterility in the cattle-yak and other bovines: A review. Biol. Reprod. 2021, 104, 495–507. [Google Scholar] [CrossRef]
  34. Kadiyska, T.; Tourtourikov, I.; Petrov, A.; Chavoushian, A.; Antalavicheva, M.; König, E.M.; Klopocki, E.; Vessela, N.; Stanislavov, R. Interstitial deletion of 5q22. 2q23. 1 including APC and TSSK1B in a patient with adenomatous polyposis and asthenoteratozoospermia. Mol. Syndromol. 2018, 9, 235–240. [Google Scholar] [CrossRef] [PubMed]
  35. Li, J.; Zhou, Y.; Zhou, Z.; Li, C.; Wei, J.; Qin, Y.; Xiang, Z.; Ma, H.; Zhang, Y.; Zhang, Y.; et al. Comparative transcriptome analysis of three gonadal development stages reveals potential genes involved in gametogenesis of the fluted giant clam (Tridacna squamosa). BMC Genom. 2020, 21, 872. [Google Scholar] [CrossRef] [PubMed]
  36. Luo, S.; Gao, X.; Ding, J.; Liu, C.; Du, C.; Hou, C.; Zhu, J.; Lou, B. Transcriptome sequencing reveals the traits of spermatogenesis and testicular development in large yellow croaker (Larimichthys crocea). Genes 2019, 10, 958. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Skvortsova, K.; Stirzaker, C.; Taberlay, P. The DNA methylation landscape in cancer. Essays Biochem. 2019, 63, 797–811. [Google Scholar]
  38. De Mendoza, A.; Nguyen, T.V.; Ford, E.; Poppe, D.; Buckberry, S.; Pflueger, J.; Grimmer, M.R.; Stolzenburg, S.; Bogdanovic, O.; Oshlack, A.; et al. Large-scale manipulation of promoter DNA methylation reveals context-specific transcriptional responses and stability. Genome Biol. 2022, 23, 163. [Google Scholar] [CrossRef]
  39. Xiong, X.; Fu, M.; Lan, D.; Li, J.; Zi, X.; Zhong, J. Yak response to high-altitude hypoxic stress by altering mRNA expression and DNA methylation of hypoxia-inducible factors. Anim. Biotechnol. 2015, 26, 222–229. [Google Scholar] [CrossRef] [PubMed]
  40. Devall, M.A.; Eaton, S.; Ali, M.W.; Dampier, C.H.; Weisenberger, D.; Powell, S.M.; Li, L.; Casey, G. DNA methylation analysis of normal colon organoids from familial adenomatous polyposis patients reveals novel insight into colon cancer development. Clin. Epigenet. 2022, 14, 104. [Google Scholar] [CrossRef] [PubMed]
  41. Zhou, Z.; Sun, B.; Huang, S.; Zhao, L. Roles of circular RNAs in immune regulation and autoimmune diseases. Cell Death Dis. 2019, 10, 503. [Google Scholar] [CrossRef] [Green Version]
  42. Li, P.; Liu, S.; Du, L.; Mohseni, G.; Zhang, Y.; Wang, C. Liquid biopsies based on DNA methylation as biomarkers for the detection and prognosis of lung cancer. Clin. Epigenet. 2022, 14, 118. [Google Scholar] [CrossRef]
  43. Zheng, Y.; Huang, G.; Silva, T.C.; Yang, Q.; Jiang, Y.Y.; Koeffler, H.P.; Lin, D.C.; Berman, B.P. A pan-cancer analysis of CpG Island gene regulation reveals extensive plasticity within Polycomb target genes. Nat. Commun. 2021, 12, 2485. [Google Scholar] [CrossRef] [PubMed]
  44. Jones, P.A. Functions of DNA methylation: Islands, start sites, gene bodies and beyond. Nat. Rev. Genet. 2012, 13, 484–492. [Google Scholar] [CrossRef]
  45. Schübeler, D. Function and information content of DNA methylation. Nature 2015, 517, 321–326. [Google Scholar] [CrossRef]
  46. Smallwood, S.A.; Tomizawa, S.; Krueger, F.; Ruf, N.; Carli, N.; Segonds-Pichon, A.; Sato, S.; Hata, K.; Andrews, S.R.; Kelsey, G. Dynamic CpG island methylation landscape in oocytes and preimplantation embryos. Nat. Genet. 2011, 43, 811–814. [Google Scholar] [CrossRef] [PubMed]
  47. Najafipour, R.; Momeni, A.; Yousefipour, F.; Mousavi, S.; Moghbelinejad, S. Underexpression of hsa-miR-449 family and their promoter hypermethylation in infertile men: A case-control study. Int. J. Reprod. Biomed. 2021, 19, 23. [Google Scholar] [CrossRef] [PubMed]
  48. Momeni, A.; Najafipour, R.; Hamta, A.; Jahani, S.; Moghbelinejad, S. Expression and methylation pattern of hsa-miR-34 family in sperm samples of infertile men. Reprod. Sci. 2020, 27, 301–308. [Google Scholar] [CrossRef] [PubMed]
Figure 1. The sequence analysis of yak TSSK1B gene. (A) The agarose gel electrophoresis of TSSK1B amplification product obtained from adult yak testis. (B) The predicted coding protein sequence generated by ORF of yak TSSK1B. The underline represents the initiation codon, and the asterisk “*” denotes the termination codon.
Figure 1. The sequence analysis of yak TSSK1B gene. (A) The agarose gel electrophoresis of TSSK1B amplification product obtained from adult yak testis. (B) The predicted coding protein sequence generated by ORF of yak TSSK1B. The underline represents the initiation codon, and the asterisk “*” denotes the termination codon.
Animals 13 00320 g001
Figure 2. The phylogenetic tree of the TSSK1B gene established from the abovementioned alignment. The asterisk “★” represents the TSSK1B sequence obtained from yak testis.
Figure 2. The phylogenetic tree of the TSSK1B gene established from the abovementioned alignment. The asterisk “★” represents the TSSK1B sequence obtained from yak testis.
Animals 13 00320 g002
Figure 3. The physicochemical properties of predicted protein coding by TSSK1B gene. (A) The predicted secondary structure of protein encoded by TSSK1B gene. Blue line, alpha helix; green line, beta-turn; red line, extended strand; orange line, random coil. (B) The predicted tertiary structure of protein. (C) The predicted hydrophobicity profile of protein encoded by TSSK1B gene. Hydrophobic: The mean hydrophobicity of each position is more than 0. Hydrophilic: The mean hydrophobicity of each position is less than 0. (D) The transmembrane structure of protein coding by TSSK1B gene. The square frame represents the position transmembrane site. (E) The phosphorylation sites analysis of TSSK1B. The prediction scores above 0.5 indicate positive predictions.
Figure 3. The physicochemical properties of predicted protein coding by TSSK1B gene. (A) The predicted secondary structure of protein encoded by TSSK1B gene. Blue line, alpha helix; green line, beta-turn; red line, extended strand; orange line, random coil. (B) The predicted tertiary structure of protein. (C) The predicted hydrophobicity profile of protein encoded by TSSK1B gene. Hydrophobic: The mean hydrophobicity of each position is more than 0. Hydrophilic: The mean hydrophobicity of each position is less than 0. (D) The transmembrane structure of protein coding by TSSK1B gene. The square frame represents the position transmembrane site. (E) The phosphorylation sites analysis of TSSK1B. The prediction scores above 0.5 indicate positive predictions.
Animals 13 00320 g003
Figure 4. The expression pattern of TSSK1B gene in tissues of yak and cattle–yak based on the RT-PCR and RT-qPCR. (A) The expression level of TSSK1B gene in eight tissues of adult male yaks. (B) The expression level of TSSK1B gene in yak testis from different growth stages. (C) The expression level of TSSK1B gene in testis of adult yak and cattle–yak. (D) The amplification product of TSSK1B in adult male yak tissues detected by agarose gel electrophoresis. (E) The expression level of TSSK1B in different ages of yak testis, as detected by agarose gel electrophoresis. Analysis of TSSK1B expression by RT-PCR in different tissues. (F) The electrophoresis figure that reflected the expression level of TSSK1B between adult yak and cattle–yak testes. ** represents p < 0.01 and “ns” means there is no significance.
Figure 4. The expression pattern of TSSK1B gene in tissues of yak and cattle–yak based on the RT-PCR and RT-qPCR. (A) The expression level of TSSK1B gene in eight tissues of adult male yaks. (B) The expression level of TSSK1B gene in yak testis from different growth stages. (C) The expression level of TSSK1B gene in testis of adult yak and cattle–yak. (D) The amplification product of TSSK1B in adult male yak tissues detected by agarose gel electrophoresis. (E) The expression level of TSSK1B in different ages of yak testis, as detected by agarose gel electrophoresis. Analysis of TSSK1B expression by RT-PCR in different tissues. (F) The electrophoresis figure that reflected the expression level of TSSK1B between adult yak and cattle–yak testes. ** represents p < 0.01 and “ns” means there is no significance.
Animals 13 00320 g004
Figure 5. The localization and expression of TSSK1B in cattle–yak and yak testes. Testes from different stages (fetal, juvenile, and adult) of yak and cattle–yak development were embedded in paraffin, and sections of 4 μm thickness were prepared and stained with anti-TSSK1B antibody (brown) and counterstained with hematoxylin to visualize DNA (blue). The following pictures offer an enlarged view of the red box in the above figures. SSC, spermatogonial stem cells; SC, Sertoli cells; SP, spermatogonium; PS, primary spermatocyte; SS, secondary spermatocyte; IC, Leydig cells; RS, round spermatid; ES, elongating spermatid.
Figure 5. The localization and expression of TSSK1B in cattle–yak and yak testes. Testes from different stages (fetal, juvenile, and adult) of yak and cattle–yak development were embedded in paraffin, and sections of 4 μm thickness were prepared and stained with anti-TSSK1B antibody (brown) and counterstained with hematoxylin to visualize DNA (blue). The following pictures offer an enlarged view of the red box in the above figures. SSC, spermatogonial stem cells; SC, Sertoli cells; SP, spermatogonium; PS, primary spermatocyte; SS, secondary spermatocyte; IC, Leydig cells; RS, round spermatid; ES, elongating spermatid.
Animals 13 00320 g005
Figure 6. The methylation status of TSSK1B promoter region. (A,B) Ten BSP-amplified products of bisulfite-converted DNA sequence selected from TSSK1B promoter region, including the CpG island, in adult yak and cattle–yak testis, respectively. (C,D) The methylation status of CpG sites from adult yak and cattle–yak testes drew out with the sequencing results. The black circles represent methylated CpGs, and white circles represent unmethylated CpGs. (E) The methylation percentages of CpG sites in adult yak and cattle–yak testis calculated from (C,D). ** represents p < 0.01.
Figure 6. The methylation status of TSSK1B promoter region. (A,B) Ten BSP-amplified products of bisulfite-converted DNA sequence selected from TSSK1B promoter region, including the CpG island, in adult yak and cattle–yak testis, respectively. (C,D) The methylation status of CpG sites from adult yak and cattle–yak testes drew out with the sequencing results. The black circles represent methylated CpGs, and white circles represent unmethylated CpGs. (E) The methylation percentages of CpG sites in adult yak and cattle–yak testis calculated from (C,D). ** represents p < 0.01.
Animals 13 00320 g006
Table 1. The primers for TSSK1B analysis.
Table 1. The primers for TSSK1B analysis.
Primer NameSequence (5′→3′)Product Size (bp)Annealing Temperature (°C)Application
pTSSK1BF: ATGTCCCGCAGGGATGTAGA
R: CACGAAAATAGCGGCACGTC
128757 °CRT-PCR
qGAPDHF: GAAGGTCGGAGTGAACGGAT
R: TGACTGTGCCGTTGAACTTG
17060 °CRT-qPCR
qTSSK1BF: TGCACATCGACGAGATCCTCA
R: AGCTCTCGCCCTCCTTGTTG
9060 °CRT-qPCR
bTSSK1BF: TTTTTATTGGTTGATTAGAGAAGGG
R: CTCAAAAATTCTCCAAATCTCCTC
23157 °CBSP
F, forward primer; R, reverse primer.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhu, Y.; Pan, B.; Fei, X.; Hu, Y.; Yang, M.; Yu, H.; Li, J.; Xiong, X. The Biological Characteristics and Differential Expression Patterns of TSSK1B Gene in Yak and Its Infertile Hybrid Offspring. Animals 2023, 13, 320. https://doi.org/10.3390/ani13020320

AMA Style

Zhu Y, Pan B, Fei X, Hu Y, Yang M, Yu H, Li J, Xiong X. The Biological Characteristics and Differential Expression Patterns of TSSK1B Gene in Yak and Its Infertile Hybrid Offspring. Animals. 2023; 13(2):320. https://doi.org/10.3390/ani13020320

Chicago/Turabian Style

Zhu, Yanjin, Bangting Pan, Xixi Fei, Yulei Hu, Manzhen Yang, Hailing Yu, Jian Li, and Xianrong Xiong. 2023. "The Biological Characteristics and Differential Expression Patterns of TSSK1B Gene in Yak and Its Infertile Hybrid Offspring" Animals 13, no. 2: 320. https://doi.org/10.3390/ani13020320

APA Style

Zhu, Y., Pan, B., Fei, X., Hu, Y., Yang, M., Yu, H., Li, J., & Xiong, X. (2023). The Biological Characteristics and Differential Expression Patterns of TSSK1B Gene in Yak and Its Infertile Hybrid Offspring. Animals, 13(2), 320. https://doi.org/10.3390/ani13020320

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop