ACADL Promotes the Differentiation of Goat Intramuscular Adipocytes
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Construction of Overexpression Vectors and siRNA of ACADL
2.3. Oil Red O and Bodipy Staining
2.4. Cell Transfection
2.5. qRT-PCR
2.6. Library Preparation for Transcriptome Sequencing
2.7. Quality Control, GO and KEGG Enrichment Analysis of Differentially Expressed Genes
2.8. Statistical Analysis
2.9. MTT Assay
3. Results
3.1. The effect of ACADL on the Intramuscular Preadipocytes Differentiation
3.2. RNA-Seq of ACADL Overexpression
3.3. Sequencing Data Quality Assessment
3.4. Analysis of Gene Expression
3.5. TNF Pathway Rescues the Effect of ACADL Overexpression in Goat Intramuscular Adipocytes Differentiation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
Correction Statement
Abbreviation
Abbreviation | Content |
IMF | Intramuscular fat |
ACADL | Long-chain acyl-CoA dehydrogenase |
TNF | Tumor necrosis factor |
PREF-1 | Preadipocyte Factor 1 |
CEBPβ | CCAT enhancer binding protein |
CEBPα | CCAT enhancer binding protein |
PPARγ | Peroxisome proliferator activated receptor gamma |
SREBP-1 | Sterol regulating element binding protein isoform 1 |
AP2 | APETALA-2-Like transcription factor gene |
LPL | Lipoprotein lipase |
ACADCL | Very long chain acyl-CoA dehydrogenase |
ACADM | Middle chain acyl-CoA dehydrogenase |
ACADS | Short chain acyl-CoA dehydrogenases |
OE ACADL | Over-expression ACADL vector |
PCDNA3.1 | The control group of oe |
SI ACADL | Interference of ACADL |
NC | The negative control group of SI |
GO | Gene Ontology |
UXT | Ubiquitously expressed transcript |
DEGs | Differentially expressed genes |
SNP | Single nucleotide polymorphism |
MF | Molecular function |
CC | Cellular component |
BP | Biological process |
CC-5013 | Lenalidomide S1093 was a specific inhibitor in TNF-signaling pathway |
MTT assay | The method used in this experiment to detect cell viability |
CCL5 | CC-chemokine 5, a member of the chemokine family |
CCL20 | CC-chemokine 20, a member of the chemokine family |
SELE | E-selectin |
TNFAIP3 | Tumor necrosis factorα inducer protein 3 |
References
- Sethi, J.K.; Vidal-Puig, A.J. Thematic review series: Adipocyte biology. Adipose 14 tissue function and plasticity orchestrate nutritional adaptation. J. Lipid Res. 2007, 48, 1253–1262. [Google Scholar] [CrossRef]
- Miller, R. Drivers of Consumer Liking for Beef, Pork, and Lamb: A Review. Foods 2020, 9, 428. [Google Scholar] [CrossRef]
- Nguyen, D.V.; Nguyen, O.C.; Malau-Aduli, A.E.O. Main regulatory factors of marbling level in beef cattle. Vet. Anim. Sci. 2022, 14, 100219. [Google Scholar] [CrossRef] [PubMed]
- Yao, D.; Su, R.; Zhang, Y.; Wang, B.; Hou, Y.; Luo, Y.; Sun, L.; Guo, Y.; Jin, Y. Impact of dietary Lactobacillus supplementation on intramuscular fat deposition and meat quality of Sunit sheep. J. Food Biochem. 2022, 46, e14207. [Google Scholar] [CrossRef] [PubMed]
- Guo, L.; Li, X.; Tang, Q.Q. Transcriptional regulation of adipocyte differentiation: A central role for CCAAT/enhancer-binding protein (C/EBP) β. J. Biol. Chem. 2015, 290, 755–761. [Google Scholar] [CrossRef] [PubMed]
- Hishida, T.; Nishizuka, M.; Osada, S.; Imagawa, M. The role of C/EBPdelta in the early stages of adipogenesis. Biochimie 2009, 91, 654–657. [Google Scholar] [CrossRef]
- Faghfouri, A.H.; Khajebishak, Y.; Payahoo, L.; Faghfuri, E.; Alivand, M. PPAR-gamma agonists: Potential modulators of autophagy in obesity. Eur. J. Pharmacol. 2021, 912, 174562. [Google Scholar] [CrossRef]
- Zhang, Y.; Bharathi, S.S.; Beck, M.E.; Goetzman, E.S. The fatty acid oxidation enzyme long-chain acyl-CoA dehydrogenase can be a source of mitochondrial hydrogen peroxide. Redox Biol. 2019, 26, 101253. [Google Scholar] [CrossRef]
- Kurtz, D.M.; Tolwani, R.J.; Wood, P.A. Structural characterization of the mouse long chain acyl-CoA dehydrogenase gene and 5′ regulatory region. Mamm. Genome 1998, 9, 361–365. [Google Scholar] [CrossRef]
- Zhang, M.; Sunaba, T.; Sun, Y.; Shibata, T.; Sasaki, K.; Isoda, H.; Kigoshi, H.; Kita, M. Acyl-CoA dehydrogenase long chain (ACADL) is a target protein of stylissatin A, an anti-inflammatory cyclic heptapeptide. J. Antibiot. 2020, 73, 589–592. [Google Scholar] [CrossRef]
- Wang, H.; Zhong, J.; Zhang, C. The whole-transcriptome landscape of muscle and adipose tissues reveals the ceRNA regulation network related to intramuscular fat deposition in yak. BMC Genom. 2020, 21, 347. [Google Scholar] [CrossRef] [PubMed]
- Kurtz, D.M.; Rinaldo, P.; Rhead, W.J. Targeted disruption of mouse long-chain acyl-CoA dehydrogenase gene reveals crucial roles for fatty acid oxidation. Proc. Natl. Acad. Sci. USA 1998, 95, 15592–15597. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.; Liu, Z.X.; Choi, C.S. Mitochondrial dysfunction due to long-chain Acyl-CoA dehydrogenase deficiency causes hepatic steatosis and hepatic insulin resistance. Proc. Natl. Acad. Sci. USA 2007, 104, 17075–17080. [Google Scholar] [CrossRef] [PubMed]
- Xu, Q.; Lin, S.; Wang, Y.; Zhu, J.; Lin, Y. Fibroblast growth factor 10 (FGF10) promotes the adipogenesis of intramuscular preadipocytes in goat. Mol. Biol. Rep. 2018, 45, 1881–1888. [Google Scholar] [CrossRef] [PubMed]
- Xiong, Y.; Xu, Q.; Lin, S.; Wang, Y.; Lin, Y.; Zhu, J. Knockdown of LXRα inhibits goat intramuscular preadipocyte differentiation. Int. J. Mol. Sci. 2018, 19, 3037. [Google Scholar] [CrossRef]
- Cai, R.; Sun, Y.; Qimuge, N. Adiponectin as lncRNA inhibits adipogenesis by transferring from nucleus to cytoplasm and attenuating adiponectin mRNA 16 translation. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2018, 1863, 420–432. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Parkhomchuk, D.; Borodina, T.; Amstislavskiy, V. Transcriptome analysis by strand-specific sequencing of complementary DNA. Nucleic Acids Res. 2009, 37, e123. [Google Scholar] [CrossRef]
- Gulyaeva, O.; Dempersmier, J.; Sul, H.S. Genetic and epigenetic control of adipose development. Biochim. Biophys. Acta Mol. Cell Biol. Lipids. 2018, 1864, 3–12. [Google Scholar] [CrossRef]
- Voelkl, J.; Tuffaha, R.; Luong, T.T.D. Zinc inhibits phosphate-induced vascular calcification through TNFAIP3-Mediated suppression of NF-κB. J. Am. Soc. Nephrol. 2018, 29, 1636–1648. [Google Scholar] [CrossRef]
- Alaterre, E.; Ovejero, S.; Herviou, L. Comprehensive characterization of the epigenetic landscape in multiple myeloma. Theranostics 2022, 12, 1715–1729. [Google Scholar] [CrossRef] [PubMed]
- Lam, A.; Cao, X.; Eisenthal, R.; Hubble, J. Effect of contact time and inhibitor concentration on the affinity mediated adsorption of cells to surfaces. Enzyme Microb. Technol. 2001, 29, 28–33. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Luo, Y.; Huang, Z.; Jia, G.; Liu, G.; Zhao, H. Role of Phosphotyrosine interaction domain containing 1 in porcine intramuscular preadipocyte proliferation and differentiation. Anim. Biotechnol. 2016, 27, 287–294. [Google Scholar] [CrossRef] [PubMed]
- Haczeyni, F.; Bell-Anderson, K.S.; Farrell, G.C. Causes and mechanisms of adipocyte enlargement and adipose expansion. Obes. Rev. 2018, 19, 406–420. [Google Scholar] [CrossRef]
- Farmer, S.R. Transcriptional control of adipocyte formation. Cell Metab. 2006, 4, 263–273. [Google Scholar] [CrossRef]
- Siersbæk, R.; Nielsen, R.; Mandrup, S. Transcriptional networks and chromatin remodeling controlling adipogenesis. Trends Endocrinol. Metab. 2012, 23, 56–64. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Kim, K.A.; Kim, J.H.; Sul, H.S. Pref-1, a preadipocyte secreted factor that inhibits adipogenesis. J. Nutr. 2006, 136, 2953–2956. [Google Scholar] [CrossRef]
- Tada, A.; Islam, M.A.; Kober, A.H. Transcriptome modifications in the porcine intramuscular adipocytes during differentiation and exogenous stimulation with TNF-α and serotonin. Int. J. Mol. Sci. 2020, 21, 638. [Google Scholar] [CrossRef]
- Pham, T.X.; Lee, J.Y. Anti-Inflammatory effect of spirulina platensis in 6 macrophages is beneficial for adipocyte differentiation and maturation by inhibiting nuclear factor-κB pathway in 3T3-L1 adipocytes. J. Med. Food 2016, 19, 535–542. [Google Scholar] [CrossRef] [PubMed]
- Hohmann, H.P.; Brockhaus, M.; Baeuerle, P.A.; Remy, R.; Kolbeck, R.; van Loon, A.P. Expression of the types A and B tumor necrosis factor (TNF) receptors is independently regulated, and both receptors mediate activation of the transcription factor NF-kappa B. TNFalpha is not needed for induction of a biological effect via TNF receptors. J. Biol. Chem. 1990, 265, 22409–22417. [Google Scholar] [CrossRef]
- Urbano, P.C.M.; Aguirre-Gamboa, R.; Ashikov, A. TNF-α-induced protein 3 (TNFAIP3)/A20 acts as a master switch in TNF-α blockade-driven IL-17A expression. J. Allergy Clin. Immunol. 2018, 142, 517–529. [Google Scholar] [CrossRef]
- Hong, J.; Yan, J.; Chen, J. Identification of key potential targets for TNF-α/TNFR1- related intervertebral disc degeneration by bioinformatics analysis. Connect Tissue Res. 2021, 62, 531–541. [Google Scholar] [CrossRef]
- Tan, X.; Cao, Z.; Li, M.; Xu, E.; Wang, J.; Xiao, Y. TNF-α downregulates CIDEC via MEK/ERK pathway in human adipocytes. Obesity 2016, 24, 1070–1080. [Google Scholar] [CrossRef]
- Roldán, V.; Marín, F.; Lip, G.Y.; Blann, A.D. Soluble E-selectin in cardiovascular disease and its risk factors. A review of the literature. Thromb. Haemost. 2003, 90, 1007–1020. [Google Scholar] [CrossRef] [PubMed]
- Ley, K. The role of selectins in inflammation and disease. Trends Mol. Med. 2003, 9, 263–268. [Google Scholar] [CrossRef]
- Kao, C.Y.; Huang, F.; Chen, Y. Up-regulation of CC chemokine ligand 20 expression in human airway epithelium by IL-17 through a JAK-independent but MEK/NF- kappaB-dependent signaling pathway. J. Immunol. 2005, 175, 6676–6685. [Google Scholar] [CrossRef]
- Lee, J.S.; Lee, J.Y.; Son, J.W. Expression and regulation of the CC-chemokine ligand 20 during human tuberculosis. Scand J. Immunol. 2008, 67, 77–85. [Google Scholar] [CrossRef] [PubMed]
- Jamali, Z.; Nazari, M.; Khoramdelazad, H. Expression of CC chemokines CCL2, CCL5, and CCL11 is associated with duration of disease and complications in type-1 diabetes: A study on Iranian diabetic patients. Clin. Lab. 2013, 59, 993–1001. [Google Scholar] [CrossRef] [PubMed]
- Herder, C.; Illig, T.; Baumert, J. RANTES/CCL5 gene polymorphisms, serum concentrations, and incident type 2 diabetes: Results from the MONICA/KORA Augsburg case cohort study, 1984–2002. Eur. J. Endocrinol. 2008, 158, R1–R5. [Google Scholar] [CrossRef]
- Bernfield, M.; Götte, M.; Park, P.W. Functions of cell surface heparan sulfate proteoglycans. Annu. Rev. Biochem. 1999, 68, 729–777. [Google Scholar] [CrossRef]
- Grivennikov, S.I.; Karin, M. Inflammatory cytokines in cancer: Tumour necrosis factor and interleukin 6 take the stage. Ann. Rheum. Dis. 2011, 70 (Suppl. 1), i104–i108. [Google Scholar] [CrossRef] [PubMed]
Sequence Name | Sequence | Tm/°C |
---|---|---|
Si-ACADL-1 | GCCUGUACAAUUUGAAUAUTT AUAUUCAAAUUGUACAGGCTT | |
Si-ACADL-2 | CCACCCAUUAGUGACAAAUTT AUUUGUCACUAAUGGGUGGTT | |
Si-ACADL-3 | GCUCUUGCAUGAGGUAAUATT UAUUACCUCAUGCAAGAGCTT | |
SREBP-1 | S: AACATCTGTTGGAGCGAGCA A: TCCAGCCATATCCGAACAGC | 60 °C |
LPL | S: GAGGCCTTGGAGATGTGGAC A: AATTGCACCGGTACGCCTTA | 60 °C |
PPARγ | S: AAGCGTCAGGGTTCCACTATG A: GAACCTGATGGCGTTATGAGAC | 60 °C |
AP2 | S: TGAAGTCACTCCAGATGACAG A: TGACACATTCCAGCACCAG | 58 °C |
CEBPα | S: CTCCGGATCTCAAGACTGCC A: CCCCTCATCTTAGACGCACC | 60 °C |
PREF-1 | S: CCTGAAAATGGATTCTGCGACG A: GACACAGGAGCACTCGTACTG | 60 °C |
CEBPβ | S: CAACCTGGAGACGCAGCACAAG A: GCTTGAACAAGTTCCGCAGGGT | 60 °C |
UXT | S: GCAAGTGGATTTGGGCTGTAAC A: ATGGAGTCCTTGGTGAGGTTGT | 60 °C |
Sample | Raw Reads | Raw Bases | Clean Reads | Clean Bases | Error-Rate | Q20 | Q30 | GC-Pct |
---|---|---|---|---|---|---|---|---|
ACADLOE | 48,014,900 | 7.2 G | 44,044,956 | 6.61 G | 0.03 | 97.03 | 92.32 | 51.91 |
ACADLNC | 46,690,324 | 7 G | 42,324,680 | 6.35 G | 0.03 | 96.51 | 90.88 | 50.6 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, A.; Li, Y.; Wang, Y.; Wang, Y.; Li, X.; Qubi, W.; Xiong, Y.; Zhu, J.; Liu, W.; Lin, Y. ACADL Promotes the Differentiation of Goat Intramuscular Adipocytes. Animals 2023, 13, 281. https://doi.org/10.3390/ani13020281
Li A, Li Y, Wang Y, Wang Y, Li X, Qubi W, Xiong Y, Zhu J, Liu W, Lin Y. ACADL Promotes the Differentiation of Goat Intramuscular Adipocytes. Animals. 2023; 13(2):281. https://doi.org/10.3390/ani13020281
Chicago/Turabian StyleLi, An, Yanyan Li, Youli Wang, Yong Wang, Xin Li, Wuqie Qubi, Yan Xiong, Jiangjiang Zhu, Wei Liu, and Yaqiu Lin. 2023. "ACADL Promotes the Differentiation of Goat Intramuscular Adipocytes" Animals 13, no. 2: 281. https://doi.org/10.3390/ani13020281