Next Article in Journal
Gas/Liquid Chromatography–Mass Spectrometry Analysis of Key Functional Substances Regulating Poll Gland Secretion in Male Camels during Seasonal Estrus
Next Article in Special Issue
Comparative Transcriptomics Identify Key Pituitary Circular RNAs That Participate in Sheep (Ovis aries) Reproduction
Previous Article in Journal
Effect of Dietary Ensiled Olive Cake Supplementation on Performance and Meat Quality of Apulo-Calabrese Pigs
Previous Article in Special Issue
Effect of CXCL17 on Subcutaneous Preadipocytes Proliferation in Goats
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 13
Issue 12
10.3390/ani13122023
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Goat Pleomorphic Adenoma Gene 1 (PLAG1): mRNA Expression, CNV Detection and Associations with Growth Traits

by
Qian Wang
1,†,
Zhenyu Wei
1,†,
Haijing Zhu
2,3,
Chuanying Pan
1,
Zhanerke Akhatayeva
1,
Xiaoyue Song
2,3,* and
Xianyong Lan
1,*
1
Key Laboratory of Animal Genetics, Breeding and Reproduction of Shaanxi Province, College of Animal Science and Technology, Northwest A&F University, Yangling 712100, China
2
Shaanxi Provincial Engineering and Technology Research Center of Cashmere Goats, Yulin University, Yulin 719000, China
3
Life Science Research Center, Yulin University, Yulin 719000, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Animals 2023, 13(12), 2023; https://doi.org/10.3390/ani13122023
Submission received: 24 March 2023 / Revised: 19 May 2023 / Accepted: 12 June 2023 / Published: 18 June 2023
(This article belongs to the Collection Small Ruminant Genetics and Breeding)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

The pleomorphic adenoma gene 1 (PLAG1) gene has attracted a lot of attention as a gene related to myogenesis. The PLAG1 gene is a key gene for growth traits in sheep, cattle, pigs, and chickens. However, it has also become the focus of research to determine whether it is the dominant gene affecting growth traits in goats. To address this problem, a bioinformatics analysis, mRNA expression (n = 6), and identification of copy number variants (CNVs) (n = 224) of PLAG1 were conducted in Shaanbei white cashmere (SBWC) goats. The findings indicated that the gene had a large number of conserved motifs, the expression level of the gene was higher in fetal goats than in adult goats, and all CNV loci were found to be associated with goat growth traits (p < 0.05), making them effective molecular marker loci for goat breeding.

Abstract

The pleomorphic adenoma gene 1 (PLAG1) gene, as the major gene responsible for growth, plays a vital role in myogenesis. Meanwhile, the relationship between copy number variation (CNV) of this gene and growth traits in goats remains unclear. Therefore, this study investigated four aspects: bioinformatics analysis, mRNA expression (n = 6), CNV detection (n = 224), and association analysis. The findings indicated that the gene had a large number of conserved motifs, and the gene expression level was higher in fetal goats than in adult goats. Three CNV loci were selected from the database, among which CNV1 was located in the bidirectional promoter region and was associated with goat growth traits. CNV analysis showed that CNV2 and CNV3 of the PLAG1 gene were associated with growth traits such as body weight, heart girth, height at hip cross, and hip width (p < 0.05), with CNV1 loss genotype being the superior genotype, and CNV2 and CNV3 median and gain genotypes of being superior genotypes. This finding further confirms that the PLAG1 gene is the dominant gene for growth traits, which will serve as theoretical guidance for goat breeding.

1. Introduction

As an important economic indicator, an animal’s growth performance is related to national living standards. In addition, animal body size is a key factor in differences in growth rate, energy metabolism, and body composition [1], which are regulated by multiple genes. Therefore, the search for the key genes controlling growth traits is the focus of researchers. In recent years, copy number variation (CNV), as a molecular marker for marker-assisted selection (MAS), can efficiently and easily select candidate genes related to the growth traits of animals, making a major contribution to animal breeding [2].
The pleomorphic adenoma gene 1 (PLAG1) gene is a zinc-finger transcription factor, which is involved in cell proliferation by directly regulating multiple target genes and is the main locus determining the height and weight of animals [3]. Mice with the PLAG1 gene knockout exhibited phenomena such as growth retardation and decreased fertility [4]. Studies have shown that the PLAG1 gene upregulates phosphorylation of Cyclin D1, p-Akt, Akt, (p)-PI3K, PI3K, and CDK2, inhibits the expression of p21 and p27 to enhance myoblasts proliferation, and increases the expression of Bcl-2 and Bcl-xL to suppress apoptosis [5]. Numerous experiments have demonstrated that the PLAG1 gene is significantly associated with growth traits in livestock and poultry. Genome-wide association analysis reported that the PLAG1 gene was associated with the body weight of broiler chickens [6], the shank weight of Simmental cattle [7], and the skeletal size of Japanese Black steers [8]. In addition, the insertion/deletion (InDel) in the PLAG1 gene was significantly associated with the chest circumference and chest width of Luxi blackhead sheep [9] and Chinese cattle [10,11]. Furthermore, the single nucleotide polymorphism (SNP) in PLAG1 was significantly associated with body size [12] and meat weight [13] of cattle, as well as with the number of vertebrae in pigs [14].
In addition, the PLAG1 gene has been identified as a key gene involved in disease development, nervous system development, and reproductive function in animals. Previous studies have reported that the PLAG1 gene was a key regulator of lung cancer [15], leiomyosarcoma [16,17], ovarian cancer [18], and rhabdomyosarcoma [19]. Hypermethylation of PLAG1 has been associated with male infertility [20], and the PLAG1 gene deficiency can cause abnormal curling of the epididymis [21], impair sperm movement [22], and reduce fertility [23]. Additionally, the PLAG1 gene regulates neuronal gene expression and neuronal differentiation [24].
Although the PLAG1 gene has been studied in myogenesis, CNV has not been reported in goats. Therefore, this study screened three CNV loci from the database, and Shaanbei white cashmere (SBWC) goats were taken as experimental subjects. The function of the PLAG1 gene was explored from four aspects: gene sequence analysis, mRNA expression, CNV detection, and association analysis using bioinformatics analysis and quantitative real-time PCR (qRT-PCR). The results obtained can serve as a theoretical foundation for the MAS breeding of goats.

2. Materials and Methods

2.1. Animal Welfare Explanation

The collection of samples was conducted in accordance with China’s national standards: the Guidelines on Welfare and Ethical Review for Laboratory Animals (GB/T 35892-2018), and the experiments were approved by the Regulations on the Administration of Experimental Animals in Northwest A&F University (NWAFU-314020038).

2.2. Identification and Bioinformatics Analysis of the PLAG1 Gene

The PLAG1 gene sequences (Human (NC_000008), macaque (NC_041761.1), mouse (NC_000070), rat (NC_051340), pig (NC_010446), cattle (NC_037341), goat (NC_030821), sheep (NC_056062), and chicken (NC_052533)), and protein sequences (Human (XP_016869065.1), macaque (XP_005563402.1), mouse (XP_036020164.1), rat (XP_017448710.1), pig (XP_020945013.1), cow (XP_005215489.1), goat (XP_017913986.1), sheep (XP_042110165.1), and chicken (NP_001385307.1)), were derived from the NCBI (https://www.ncbi.nlm.nih.gov/, accessed on 10 May 2022) database. The conserved protein motifs of the PLAG1 gene were predicted using the online analysis tool MEME (http://meme-suite.org/index.html, accessed on 10 May 2022), where the parameter was set to maximum, the number of motifs was 15, and the length of motifs ranged from 6 to 200 aa. The gene structure and motifs were visualized and further tuned using the online platform Evolview (https://www.evolgenius.info/evolview/#login, accessed on 10 May 2022).
We used protein sequences of the human, macaque, mouse, rat, pig, cattle, goat, sheep, and chicken PLAG1 gene to construct an evolutionary tree. The maffT software (http://mafft.cbrc.jp/alignment/server/large.html, accessed on 10 May 2022) was used for multiple sequence alignment of this gene (parameter: --localpair--maxiterate 1000) [25], and then the maximum likelihood (ML) method of IQ-TREE (http://www.iqtree.org, accessed on 10 May 2022) was used to construct the evolutionary tree, where the number of bootstraps was set to 1000. The Evoview online tool was used to analyze the evolutionary tree [26].

2.3. Extraction of Genomic DNA and RNA

Goat ear tissue (n = 224) from adult female goats (2–3 years old) was randomly selected for DNA extraction, and other tissues, including liver, spleen, lung, kidney, and muscle from female fetus (n = 9) and female adult (1.5 years) (n = 9) goats were collected for RNA extraction. All tissue samples were from the Yulin breeding base in Shaanxi province. Female goats were randomly selected to be raised in the same environment and under the same management conditions, and there is no kinship between individuals. Then, tissue samples were stored in 70% ethanol at −80 °C. Tissue RNA was extracted using the Trizol method and then reversely transcribed into cDNA using PrimeScript™ RT Reagent Kit (Takara Biotech, Dalian, China) [27]. A high salt extraction method was used to extract DNA from ear tissues [28]. The OD260/280 ratios of DNA and RNA samples were measured by a NanoDrop™1000 Spectrophotometer (Thermo Scientific, Waltham, MA, USA), and OD260/280 values were 1.6–1.8 for all DNA samples and 1.8–2.0 for RNA samples, finally diluted to 20 ng/uL and at −20 °C.

2.4. Designing of Primers

CNV loci were retrieved from the Animal Omics database (http://animal.nwsuaf.edu.cn/, accessed on 19 March 2022) [29], and we found three CNV loci of the PLAG1 gene in goats. Based on reference sequences (NC_030821.1), the primers for mRNA expression and CNV detection were then designed using the Primer-blast tool in the NCBI database (https://www.ncbi.nlm.nih.gov/tools/primer-blast/, accessed on 19 March 2022) and the Primer Premier 5.0 software (Thermo Scientific, Waltham, USA) (Table 1). The GAPDH gene was used as the reference gene for mRNA expression, and the MCIR gene was utilized as the reference gene for CNV detection. GAPDH and MC1R were referred to in a previous article [30,31].

2.5. Detection of the PLAG1 Gene mRNA Expression Levels

The qRT-PCR method was used to detect the expression level of the PLAG1 gene in fetal female goat tissues and adult female goat tissues. SYBR Premix Ex TaqTMII (Takara Biotech, Dalian, China) was used for detection, and the total detection system and amplification steps were based on a previous study [32]. The total system was 10 μL, including 5 μL of SYBR Premix Ex TaqTMII, 0.5 μL of F primer, 0.5 μL of R primer, and 4 μL of cDNA. The amplification steps were 45 s at 95 °C, 40 cycles of 15 s at 95 °C, and 60 °C for 45 s. The 2−δδCt method was used to analyze data [30].

2.6. CNV Genotyping of the PLAG1 Gene

After testing the primers through the DNA pool, a total of 224 SBWC goat samples were used to detect CNV loci. The total detection system was 10 μL, including 5 μL of SYBR Premix Ex TaqTMII, 0.5 μL of F primer, 0.5 μL of R primer, 1 μL of DNA, and 3 μL of ddH2O. The amplification system and steps of qRT-PCR were as described above, i.e., 45 s at 95 °C, 40 cycles of 15 s at 95 °C and 60 °C for 45 s. The result was calculated using the 2−δδCt method [33]. If the 2−δδCt = 1, it was the median genotype, the 2−δδCt > 1 was the gain genotype, the 2−δδCt < 1 was the loss genotype.

2.7. Statistical Analyses

The frequency of CNV genotypes was analyzed using the chi-square test (χ2). After that, the association between the genotypes of CNVs and growth traits was analyzed by the Analysis of Variance (ANOVA) test in SPSS 26.0 (IBM, USA). When p < 0.05, the presence of an association between CNV and body weight, body height, height at hip cross, body length, hip width, heart girth, and other growth traits was established, and the line model was referred to a study by Yang et al. [34]. Where Yijk = αi + βj + eijk + u acts as a linear model, Yijk is the evaluation of growth traits at the i level of fixed factor age (αi) and j level of fixed factor genotype (βj), u is the overall mean, and eijk is the random error.

3. Results

3.1. Bioinformatics Analysis of PLAG1 Gene

Sequence analysis of the PLAG1 gene using an online platform revealed that the PLAG1 gene contains five conserved protein motifs (Figure 1a). In addition to this, multiple sequence alignment and evolutionary analysis of nine representative species, including pig, cattle, goat, sheep, and chicken, showed that goat had the highest sequence homology with sheep and cattle, and the pig was the closest relative to ruminants among several domestic animals, while the chicken was the most distant relative of these species (Figure 1b).

3.2. mRNA Expression Levels of Fetal and Adult Goats

To preliminary explore the PLAG1 gene expression during different periods of goat development, qRT-PCR was used to find that the PLAG1 gene in goat tissue was also expressed in fetal and adult goats, and the PLAG1 gene expression was high in lung, kidney, spleen, liver, and muscle in fetal goats. Moreover, with growth and development, the relative expression of adult goats was relatively stable compared with fetal goats, while the expression levels decreased in the spleen, kidney, lung and muscle (Figure 2, Supplement Table S1). It has been suggested that the PLAG1 gene may be involved in the development of multiple tissues in animals.

3.3. Frequency of CNV Genotypes

CNVs of the PLAG1 gene were found in the database, and CNV1 covers both the first exon and the bidirectional promoter of the PLAG1 gene and the upstream CHCHD7 gene, which was detected by comparing the gene sequence annotation information with mutation location information in the database (Figure 3).
The large-scale detection revealed that the percentage of CNV1 loss and gain genotypes was 42.47%, respectively, and the median genotype was 15.07%. In CNV2 and CNV3, the number of individuals with the median genotype (CNV2 = 153, 70.18%; CNV3 = 155, 74.52%) was greater than those with the loss genotype (CNV2 = 15, 6.88%; CNV3 = 10, 4.81%) and the gain genotype (CNV2 = 50, 22.94%; CNV3 = 43, 20.67%) (Figure 4, Supplement Table S2), and the genotypes of the three CNV loci were not significantly different (p = 0.252).

3.4. Association Analyses between CNV and the Goat PLAG1 Gene

Association analysis showed that three CNV loci were associated with growth traits in SBWC goats. Among them, CNV1 was significantly associated with body weight (p = 2.701 × 10−8), body height (p = 0.002), height at hip cross (p = 8.000 × 10−6), body length (p = 0.008), hip width (p = 8.252 × 10−8), heart girth (p = 0.001), and cannon circumference (p = 4.660 × 10−4) (Table 2). CNV2 was significantly associated with body weight (p = 4.023 × 10−3), height at hip cross (p = 0.002), hip width (p = 2.000 × 10−6), heart girth (p = 3.270 × 10−4), and chest depth (p = 0.013) (Table 3). CNV3 was significantly associated with body weight (p = 0.020), height at hip cross (p = 0.003), body length (p = 0.022), hip width (p = 1.540 × 10−4), heart girth (p = 3.480 × 10−4), and cannon circumference (p = 0.020) (Table 4).
Additionally, we found that in CNV1, individuals with the loss genotype were superior to those with median and gain genotypes in terms of growth traits (Table 2), but the individuals with CNV2 and CNV3 with the median and gain genotypes were better than those with the loss genotypes (Table 3 and Table 4).

4. Discussion

The PLAG1 gene is a key gene affecting animal growth [3]. Relevant studies have shown that the PLAG1 gene plays an important role in growth regulation in mice [4], broiler chickens [6], Simmental cattle [7], Japanese Black steers [8], Luxi blackhead sheep [9], Chinese cattle [10,11], and other domestic animals by enhancing myoblasts proliferation and suppressing apoptosis [5]. Amino acid sequence alignment revealed that the sequences of this gene in cattle, sheep, and goats have high similarity [31]. In this study, the phylogenetic tree of the PLAG1 gene showed a high degree of homology among cattle, goats, and sheep. Thus, given the importance of the PLAG1 gene in growth performance in cattle, we hypothesized that it also plays a crucial role in goat growth traits.
Moreover, understanding the expression of the gene in various tissues is very important to explore its function. The results showed that the expression level of this gene was reduced in adult goats compared to fetal goats, which suggests that this gene can potentially be expressed in embryos and was consistent with previous reports [35,36,37]. The reason for this phenomenon is that this gene is necessary for the activation of other transcription factors and embryo development [38].
To further explore the function of this gene, we identified three CNVs from the database, in which CNV1 spans the PLAG1 gene and the CHCHD7 gene and is located in the bidirectional promoter region, which has a significant impact on the body size of livestock [39,40]. Among the three CNVs, CNV1 had the lowest proportion of median genotypes: the gain genotype and loss genotype accounted for an equal proportion. While CNV2 and CNV3 had the highest proportion of median genotypes, the loss genotype accounted for the smallest proportion. This may be due to the fact the mutation sites are located in different locations on the chromosome and have different effects on transcription factors, so they show different genotypes [41]. The results of the association analysis showed that CNVs were associated with the growth traits of goats (p < 0.05). CNV1 was significantly associated with body weight, body height, height at hip cross, body length, hip width, heart girth, and cannon circumference. CNV2 was significantly associated with body weight, height at hip cross, hip width, heart girth, and chest depth. CNV3 was significantly associated with body weight, height at hip cross, body length, hip width, heart girth and cannon circumference. In addition, the loss genotype of CNV1 was the dominant genotype, while the median and gain genotypes of CNV2 and CNV3 were superior genotypes. This may be due to artificial selection and genetic drift. Previous studies have also reported that SNP, InDel and CNV within PLAG1 can affect growth traits in cattle and sheep [9,10,11,12], which are consistent with the results of this study.
Although the growth trait is a multi-gene controlled trait, the influence of CNV on the genetic trait of livestock and poultry has also been proven. Li et al. found that CNVs of 52 candidate genes were significantly associated with the tail type, tail length, and tail fat of Hulunbuir sheep [42]. In Hu sheep and Small Tail Han sheep, the CNVs of the SHE gene were associated with chest circumference and chest width [43], and the CNVs of the BAG4 gene were associated with body slanting length and body height [44]. In addition, Liu et al. revealed the population differentiation of CNVs in different geographical regions, which may reflect the population history of different goat breeds [45]. In the MYLK4 gene of Guizhou white goats, CNV had significant differences in weight, height, and body length [46]. Previous studies have shown that CNVs of EIF4A2 [47], GAL3ST1 [48], and DYNC1I2 [49] genes were associated with growth traits in Chinese cattle. Skinner et al. supported the hypothesis that the genomes of evolutionarily distant species share CNV regions [50]. In conclusion, CNVs have an impact on animal traits, and CNVs may reflect the evolutionary trend of a population.
From bacteria and archaea to plants and animals, CNVs with DNA sequence amplification and deletion exist in the genome of organisms [51]. Many studies have shown that this technique plays an important role in screening candidate genes and other aspects. In this study, CNV of the PLAG1 gene will enrich the function of this gene and provides theoretical guidance for goat breeding. In the future, CNV will be a simple, efficient, and widely applicable molecular marker.

5. Conclusions

In this study, the PLAG1 gene had a large number of conserved motifs, and mRNA expression of the PLAG1 gene was higher in fetal tissue than in adult goats. The three CNVs were significantly associated with the growth traits of goats (p < 0.05). CNV1 was significantly associated with body weight, body height, height at hip cross, body length, hip width, heart girth, and cannon circumference. CNV2 was significantly associated with body weight, height at hip cross, hip width, heart girth, and chest depth. CNV3 was significantly associated with body weight, height at hip cross, body length, hip width, heart girth and cannon circumference. Meanwhile, the loss genotype of CNV1 was the dominant genotype, and the median genotype and gain genotype of CNV2 and CNV3 were the superior genotypes. These findings confirm that the PLAG1 gene can be an essential functional candidate gene for growth traits, allowing more extensive use of MAS in goat breeding.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani13122023/s1.

Author Contributions

Sample collection: H.Z., C.P., X.S. and X.L.; experimental operation: Q.W. and Z.W.; data collation and analysis: Q.W. and Z.W.; article writing: Q.W.; paper revision and editing: Q.W., Z.A. and X.L.; project management: X.S. and X.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Key R&D Program of China (2022YFF1000100).

Institutional Review Board Statement

The collection of samples was conducted in accordance with China’s national standard of Guidelines on Welfare and Ethical Review for Laboratory Animals (GB/T 35892-2018), and our experiments were approved by the Regulations on the Administration of Experimental Animals in Northwest A&F University (NWAFU-314020038).

Informed Consent Statement

Not applicable.

Data Availability Statement

There is no new data were created.

Acknowledgments

We sincerely thank the Shaanxi Yulin goat farm for providing us with samples. We also would like to thank Lei Qu, Hailong Yan, and Jinwang Liu from Yulin University for their help in sample collection.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Corva, P.M.; Medrano, J.F. Quantitative trait loci (QTLs) mapping for growth traits in the mouse: A review. Genet. Sel. Evol. 2001, 33, 105–132. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Pös, O.; Radvanszky, J.; Buglyó, G.; Pös, Z.; Rusnakova, D.; Nagy, B.; Szemes, T. DNA copy number variation: Main characteristics, evolutionary significance, and pathological aspects. Biomed. J. 2021, 44, 548–559. [Google Scholar] [CrossRef] [PubMed]
  3. Takasuga, A. PLAG1 and NCAPG-LCORL in livestock. Anim. Sci. J. 2016, 87, 159–167. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Juma, A.R.; Damdimopoulou, P.E.; Grommen, S.V.; Van de Ven, W.J.; De Groef, B. Emerging role of PLAG1 as a regulator of growth and reproduction. J. Endocrinol. 2016, 228, R45–R56. [Google Scholar] [CrossRef]
  5. Wang, J.; Huang, Y.; Xu, J.; Yue, B.; Wen, Y.; Wang, X.; Lei, C.; Chen, H. Pleomorphic adenoma gene 1 (PLAG1) promotes proliferation and inhibits apoptosis of bovine primary myoblasts through the PI3K-Akt signaling pathway. J. Anim. Sci. 2022, 100, skac098. [Google Scholar] [CrossRef]
  6. Dadousis, C.; Somavilla, A.; Ilska, J.J.; Johnsson, M.; Batista, L.; Mellanby, R.J.; Headon, D.; Gottardo, P.; Whalen, A.; Wilson, D.; et al. A genome-wide association analysis for body weight at 35 days measured on 137,343 broiler chickens. Genet. Sel. Evol. 2021, 53, 70. [Google Scholar] [CrossRef]
  7. Song, Y.; Xu, L.; Chen, Y.; Zhang, L.; Gao, H.; Zhu, B.; Niu, H.; Zhang, W.; Xia, J.; Gao, X.; et al. Genome-wide association study reveals the PLAG1 gene for knuckle, biceps and shank weight in Simmental beef cattle. PLoS ONE 2016, 11, e0168316. [Google Scholar] [CrossRef] [Green Version]
  8. Hoshiba, H.; Setoguchi, K.; Watanabe, T.; Kinoshita, A.; Mizoshita, K.; Sugimoto, Y.; Takasuga, A. Comparison of the effects explained by variations in the bovine PLAG1 and NCAPG genes on daily body weight gain, linear skeletal measurements and carcass traits in Japanese Black steers from a progeny testing program. Anim. Sci. J. 2013, 84, 529–534. [Google Scholar] [CrossRef]
  9. Pan, Y.; Wang, M.; Wu, H.; Akhatayeva, Z.; Lan, X.; Fei, P.; Mao, C.; Jiang, F. Indel mutations of sheep PLAG1 gene and their associations with growth traits. Anim. Biotechnol. 2022, 33, 1459–1465. [Google Scholar] [CrossRef]
  10. Zhou, Z.; Huang, B.; Lai, Z.; Li, S.; Wu, F.; Qu, K.; Jia, Y.; Hou, J.; Liu, J.; Lei, C.; et al. The distribution characteristics of a 19-bp Indel of the PLAG1 gene in Chinese cattle. Animals 2019, 9, 1082. [Google Scholar] [CrossRef] [Green Version]
  11. Xu, W.; He, H.; Zheng, L.; Xu, J.W.; Lei, C.Z.; Zhang, G.M.; Dang, R.H.; Niu, H.; Qi, X.L.; Chen, H.; et al. Detection of 19-bp deletion within PLAG1 gene and its effect on growth traits in cattle. Gene 2018, 675, 144–149. [Google Scholar] [CrossRef]
  12. Zhong, J.L.; Xu, J.W.; Wang, J.; Wen, Y.F.; Niu, H.; Zheng, L.; He, H.; Peng, K.; He, P.; Shi, S.Y.; et al. A novel SNP of PLAG1 gene and its association with growth traits in Chinese cattle. Gene 2019, 689, 166–171. [Google Scholar] [CrossRef]
  13. Zhang, R.; Miao, J.; Song, Y.; Zhang, W.; Xu, L.; Chen, Y.; Zhang, L.; Gao, H.; Zhu, B.; Li, J.; et al. Genome-wide association study identifies the PLAG1-OXR1 region on BTA14 for carcass meat yield in cattle. Physiol. Genom. 2019, 51, 137–144. [Google Scholar] [CrossRef]
  14. Zhang, Y.; Wang, M.; Yuan, J.; Zhou, X.; Xu, S.; Liu, B. Association of polymorphisms in NR6A1, PLAG1 and VRTN with the number of vertebrae in Chinese Tongcheng × Large White crossbred pigs. Anim. Genet. 2018, 49, 353–354. [Google Scholar] [CrossRef]
  15. Jin, L.; Chun, J.; Pan, C.; Kumar, A.; Zhang, G.; Ha, Y.; Li, D.; Alesi, G.N.; Kang, Y.; Zhou, L.; et al. The PLAG1-GDH1 axis promotes anoikis resistance and tumor metastasis through CamKK2-AMPK signaling in LKB1-Deficient lung cancer. Mol. Cell 2018, 69, 87–99. [Google Scholar] [CrossRef] [Green Version]
  16. Chiang, S. Recent advances in smooth muscle tumors with PGR and PLAG1 gene fusions and myofibroblastic uterine neoplasms. Genes Chromosom. Cancer 2021, 60, 138–146. [Google Scholar] [CrossRef]
  17. Thiryayi, S.A.; Turashvili, G.; Latta, E.K.; Swanson, D.; Zhang, L.; Antonescu, C.R.; Dickson, B.C. PLAG1-rearrangment in a uterine leiomyosarcoma with myxoid stroma and heterologous differentiation. Genes Chromosom. Cancer 2021, 60, 713–717. [Google Scholar] [CrossRef]
  18. Huang, W.; Li, B.R.; Feng, H. PLAG1 silencing promotes cell chemosensitivity in ovarian cancer via the IGF2 signaling pathway. Int. J. Mol. Med. 2020, 45, 703–714. [Google Scholar] [CrossRef] [Green Version]
  19. Zheng, Y.; Xu, L.; Hassan, M.; Zhou, X.; Zhou, Q.; Rakheja, D.; Skapek, S.X. Bayesian modeling identifies PLAG1 as a key regulator of proliferation and survival in rhabdomyosarcoma cells. Mol. Cancer Res. 2020, 18, 364–374. [Google Scholar] [CrossRef]
  20. Rajender, S.; Avery, K.; Agarwal, A. Epigenetics, spermatogenesis and male infertility. Mutat. Res. 2011, 727, 62–71. [Google Scholar] [CrossRef]
  21. Wong, J.; Juma, A.R.; Tran, S.C.; Gasperoni, J.G.; Grommen, S.V.H.; De Groef, B. Deficiency of the transcription factor PLAG1 results in aberrant coiling and morphology of the epididymis. Asian J. Androl. 2020, 22, 342–347. [Google Scholar] [PubMed]
  22. Juma, A.R.; Grommen, S.V.H.; O’Bryan, M.K.; O’Connor, A.E.; Merriner, D.J.; Hall, N.E.; Doyle, S.R.; Damdimopoulou, P.E.; Barriga, D.; Hart, A.H.; et al. PLAG1 deficiency impairs spermatogenesis and sperm motility in mice. Sci. Rep. 2017, 7, 5317. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Juma, A.R.; Hall, N.E.; Wong, J.; Gasperoni, J.G.; Watanabe, Y.; Sahota, A.; Damdimopoulou, P.E.; Grommen, S.V.H.; De Groef, B. PLAG1 expression and target genes in the hypothalamo-pituitary system in male mice. Mol. Cell. Endocrinol. 2018, 478, 77–83. [Google Scholar] [CrossRef] [PubMed]
  24. Sakai, H.; Fujii, Y.; Kuwayama, N.; Kawaji, K.; Gotoh, Y.; Kishi, Y. Plag1 regulates neuronal gene expression and neuronal differentiation of neocortical neural progenitor cells. Genes Cells 2019, 24, 650–666. [Google Scholar] [CrossRef] [PubMed]
  25. Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2019, 20, 1160–1166. [Google Scholar] [CrossRef] [Green Version]
  26. Minh, B.Q.; Schmidt, H.A.; Chernomor, O.; Schrempf, D.; Woodhams, M.D.; von Haeseler, A.; Lanfear, R. IQ-TREE 2: New models and efficient methods for phylogenetic inference in the genomic era. Mol. Biol. Evol. 2020, 37, 1530–1534. [Google Scholar] [CrossRef] [Green Version]
  27. Kang, Z.; Jiang, E.; Wang, K.; Pan, C.; Chen, H.; Yan, H.; Zhu, H.; Liu, J.; Qu, L.; Lan, X. Goat membrane associated ring-CH-type finger 1 (MARCH1) mRNA expression and association with litter size. Theriogenology 2019, 128, 8–16. [Google Scholar] [CrossRef]
  28. Aljanabi, S.M.; Martinez, I. Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques. Nucleic Acids Res. 1997, 25, 4692–4693. [Google Scholar] [CrossRef]
  29. Fu, W.; Wang, R.; Yu, J.; Hu, D.; Cai, Y.; Shao, J.; Jiang, Y. GGVD: A goat genome variation database for tracking the dynamic evolutionary process of selective signatures and ancient introgressions. J. Genet. Genom. 2021, 48, 248–256. [Google Scholar] [CrossRef]
  30. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  31. Zhang, X.; Zhang, S.; Tang, Q.; Jiang, E.; Wang, K.; Lan, X.; Pan, C. Goat sperm associated antigen 17 protein gene (SPAG17): Small and large fragment genetic variation detection, association analysis, and mRNA expression in gonads. Genomics 2020, 112, 5115–5121. [Google Scholar] [CrossRef]
  32. Hui, Y.; Zhang, Y.; Wang, K.; Pan, C.; Chen, H.; Qu, L.; Song, X.; Lan, X. Goat DNMT3B: An indel mutation detection, association analysis with litter size and mRNA expression in gonads. Theriogenology 2020, 147, 108–115. [Google Scholar] [CrossRef]
  33. Pei, S.W.; Qin, F.; Li, W.H.; Li, F.D.; Yue, X.P. Copy number variation of ZNF280AY across 21 cattle breeds and its association with the reproductive traits of Holstein and Simmental bulls. J. Dairy Sci. 2019, 102, 7226–7236. [Google Scholar] [CrossRef]
  34. Yang, Q.; Zhang, S.; Li, J.; Wang, X.; Peng, K.; Lan, X.; Pan, C. Development of a touch-down multiplex PCR method for simultaneously rapidly detecting three novel insertion/deletions (indels) within one gene: An example for goat GHR gene. Anim. Biotechnol. 2019, 30, 366–371. [Google Scholar] [CrossRef]
  35. Declercq, J.; Van Dyck, F.; Braem, C.V.; Van Valckenborgh, I.C.; Voz, M.; Wassef, M.; Schoonjans, L.; Van Damme, B.; Fiette, L.; Van de Ven, W.J. Salivary gland tumors in transgenic mice with targeted PLAG1 proto-oncogene overexpression. Cancer Res. 2005, 65, 4544–4553. [Google Scholar] [CrossRef] [Green Version]
  36. Li, Z.; Wu, M.; Zhao, H.; Fan, L.; Zhang, Y.; Yuan, T.; He, S.; Wang, P.; Zhang, Y.; Sun, X.; et al. The PLAG1 mRNA expression analysis among genetic variants and relevance to growth traits in Chinese cattle. Anim. Biotechnol. 2020, 31, 504–511. [Google Scholar] [CrossRef]
  37. Hensen, K.; Braem, C.; Declercq, J.; Van Dyck, F.; Dewerchin, M.; Fiette, L.; Denef, C.; Van de Ven, W.J. Targeted disruption of the murine Plag1 proto-oncogene causes growth retardation and reduced fertility. Dev. Growth Differ. 2004, 46, 459–470. [Google Scholar] [CrossRef]
  38. Madissoon, E.; Damdimopoulos, A.; Katayama, S.; Krjutškov, K.; Einarsdottir, E.; Mamia, K.; De Groef, B.; Hovatta, O.; Kere, J.; Damdimopoulou, P. Pleomorphic adenoma gene 1 is needed for timely zygotic genome activation and early embryo development. Sci. Rep. 2019, 9, 8411. [Google Scholar] [CrossRef] [Green Version]
  39. Fink, T.; Tiplady, K.; Lopdell, T.; Johnson, T.; Snell, R.G.; Spelman, R.J.; Davis, S.R.; Littlejohn, M.D. Functional confirmation of PLAG1 as the candidate causative gene underlying major pleiotropic effects on body weight and milk characteristics. Sci. Rep. 2017, 7, 44793. [Google Scholar] [CrossRef] [Green Version]
  40. Nishimura, S.; Watanabe, T.; Mizoshita, K.; Tatsuda, K.; Fujita, T.; Watanabe, N.; Sugimoto, Y.; Takasuga, A. Genome-wide association study identified three major QTL for carcass weight including the PLAG1-CHCHD7 QTN for stature in Japanese Black cattle. BMC Genet. 2012, 13, 40. [Google Scholar] [CrossRef] [Green Version]
  41. Michael, A.K.; Thomä, N.H. Reading the chromatinized genome. Cell 2021, 184, 3599–3611. [Google Scholar] [CrossRef]
  42. Li, M.; Yin, C.; Zhao, F.; Liu, Y. Copy number variation association studies for sheep tail-relevant traits in Hulunbuir sheep. Anim. Genet. 2022, 53, 897–900. [Google Scholar] [CrossRef] [PubMed]
  43. Jiang, R.; Cheng, J.; Cao, X.K.; Ma, Y.L.; Chaogetu, B.; Huang, Y.Z.; Lan, X.Y.; Lei, C.Z.; Hu, L.Y.; Chen, H. Copy number variation of the SHE gene in sheep and its association with economic traits. Animals 2019, 9, 531. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Yang, Z.; Cao, X.; Ma, Y.; Cheng, J.; Song, C.; Jiang, R.; Wang, X.; Huang, Y.; Buren, C.; Lan, X.; et al. Novel copy number variation of the BAG4 gene is associated with growth traits in three Chinese sheep populations. Anim. Biotechnol. 2021, 32, 461–469. [Google Scholar] [CrossRef] [PubMed]
  45. Liu, M.; Zhou, Y.; Rosen, B.D.; Van Tassell, C.P.; Stella, A.; Tosser-Klopp, G.; Rupp, R.; Palhière, I.; Colli, L.; Sayre, B.; et al. Diversity of copy number variation in the worldwide goat population. Heredity 2019, 122, 636–646. [Google Scholar] [CrossRef]
  46. Shi, S.Y.; Li, L.J.; Zhang, Z.J.; Wang, E.Y.; Wang, J.; Xu, J.W.; Liu, H.B.; Wen, Y.F.; He, H.; Lei, C.Z.; et al. Copy number variation of MYLK4 gene and its growth traits of capra hircus (goat). Anim. Biotechnol. 2020, 31, 532–537. [Google Scholar] [CrossRef]
  47. Zhang, Z.; Peng, M.; Wen, Y.; Chai, Y.; Liang, J.; Yang, P.; Liu, X.; Li, J.; Huang, Y.; Li, L.; et al. Copy number variation of EIF4A2 loci related to phenotypic traits in Chinese cattle. Vet. Med. Sci. 2022, 8, 2147–2156. [Google Scholar] [CrossRef]
  48. Liang, J.; Liu, X.; Yang, P.; Yao, Z.; Qu, K.; Wang, H.; Zhang, Z.; Liang, H.; Cheng, B.; Li, Z.; et al. Copy number variation of GAL3ST1 gene is associated with growth traits of Chinese cattle. Anim. Biotechnol. 2022, 8, 672–678. [Google Scholar] [CrossRef]
  49. Li, X.; Ding, X.; Liu, L.; Yang, P.; Yao, Z.; Lei, C.; Chen, H.; Huang, Y.; Liu, W. Copy number variation of bovine DYNC1I2 gene is associated with body conformation traits in chinese beef cattle. Gene 2022, 810, 146060. [Google Scholar] [CrossRef]
  50. Skinner, B.M.; Robertson, L.B.; Tempest, H.G.; Langley, E.J.; Ioannou, D.; Fowler, K.E.; Crooijmans, R.P.; Hall, A.D.; Griffin, D.K.; Völker, M. Comparative genomics in chicken and Pekin duck using FISH mapping and microarray analysis. BMC Genom. 2009, 10, 357. [Google Scholar] [CrossRef] [Green Version]
  51. Lauer, S.; Gresham, D. An evolving view of copy number variants. Curr. Genet. 2019, 65, 1287–1295. [Google Scholar] [CrossRef]
Animals 13 02023 g001 550
Figure 1. Identification and bioinformatics analysis of the PLAG1 gene. Note: (a): Schematically displaying Motif1 and Motif2 of the PLAG1; (b): gene evolution tree analysis of PLAG1 in different species.
Figure 1. Identification and bioinformatics analysis of the PLAG1 gene. Note: (a): Schematically displaying Motif1 and Motif2 of the PLAG1; (b): gene evolution tree analysis of PLAG1 in different species.
Animals 13 02023 g001
Animals 13 02023 g002 550
Figure 2. PLAG1 mRNA expression levels in different tissues of fetal and adult goats.
Figure 2. PLAG1 mRNA expression levels in different tissues of fetal and adult goats.
Animals 13 02023 g002
Animals 13 02023 g003 550
Figure 3. Schematic diagram of the PLAG1 gene CNV loci on the genome. Note: Chr. 14 means Chromosome 14.
Figure 3. Schematic diagram of the PLAG1 gene CNV loci on the genome. Note: Chr. 14 means Chromosome 14.
Animals 13 02023 g003
Animals 13 02023 g004 550
Figure 4. Frequency distribution of different genotypes of three CNV polymorphisms of the PLAG1 gene in SBWC goats. Note: (a): CNV1; (b) CNV2; (c) CNV3. The total number of CNV1 was 219, CNV2 was 218, and CNV3 was 208.
Figure 4. Frequency distribution of different genotypes of three CNV polymorphisms of the PLAG1 gene in SBWC goats. Note: (a): CNV1; (b) CNV2; (c) CNV3. The total number of CNV1 was 219, CNV2 was 218, and CNV3 was 208.
Animals 13 02023 g004
Table
Table 1. The primer information of mRNA expression and CNVs.
Table 1. The primer information of mRNA expression and CNVs.
Primer NamesPrimer Pairs (5′-3′)Tm (°C)Length (bp)
PLAG1-mRNAF: ATTCCGCGGGCGGTGTAAA62.61298
R: TCACCAGGAATGACAGTGGC59.96
GAPDHF: AAAGTGGACATCGTTGCCAT60.04116
R: CCGTTCTCTGCCTTGACTGT59.97
CNV1F: CTTTCGACGGCACCCAAGAA60.88199
R: TTGCCGTTGCGCTTCCT60.26
CNV2F: CTCAAACATGAATTTGCTCCCC58.15250
R: AGACTGCTTCCACCACTCATA58.46
CNV3F: CGTATAGGGGAAGCTCAG50.20192
R: GTTTGGATGTCTTCTATTTCTT50.10
MC1RF: GGCCTGAGAGGGGAATCACA61.27126
R: AGTGGGTCTCTGGATGGAGG60.33
Table
Table 2. Association analyses between growth traits and the CNV1 in SBWC goats.
Table 2. Association analyses between growth traits and the CNV1 in SBWC goats.
Trait-TypesTypic Frequencies (AVG ± SE)p-Values
LossMedianGain
body weight (kg)52.42 ± 1.58 A (n = 70)43.35 ± 3.38 AB (n = 17)40.68 ± 1.05 B (n = 65)2.701 × 10−8
body height (cm)57.51 ± 0.50 A (n = 93)56.89 ± 0.81 AB (n = 33)55.15 ± 0.42 B (n = 92)0.002
height at hip cross (cm)61.17 ± 0.54 A (n = 92)59.83 ± 0.95 AB (n = 33)57.95 ± 0.38 B (n = 91)8.000 × 10−6
body length (cm)67.75 ± 0.51 A (n = 93)64.77 ± 0.99 B (n = 33)67.73 ± 0.51 A (n = 91)0.008
hip width (cm)17.37 ± 0.33 A (n = 87)16.98 ± 0.61 A (n = 26)15.11 ± 0.19 B (n = 77)8.252 × 10−8
heart girth (cm)90.00 ± 1.09 A (n= 93)86.10 ± 1.60 B (n = 31)84.70 ± 0.88 B (n = 92)0.001
cannon circumference (cm)8.45 ± 0.08 A (n = 93)8.34 ± 0.11 A (n = 32)8.03 ± 0.07 B (n = 93)4.660 × 10−4
chest width (cm)20.66 ± 0.34 (n = 93)20.00 ± 0.50 (n = 33)19.71 ± 0.41 (n = 92)0.183
chest depth (cm)28.78 ± 0.28 (n = 93)27.98 ± 0.53 (n = 32)28.66 ± 0.30 (n = 92)0.381
Note: Values with different letters (A, B) within the same row differ significantly at p < 0.01. AVG means average, and SE means standard error.
Table
Table 3. Association analyses between growth traits and the CNV2 in SBWC goats.
Table 3. Association analyses between growth traits and the CNV2 in SBWC goats.
Trait-TypesTypic Frequencies (AVG ± SE)p-Values
LossMedianGain
body weight (kg)35.91 ± 3.68 b (n = 8)48.50 ± 1.29 A (n = 105)41.61 ± 1.62 B (n = 38)4.023 × 10−3
body height (cm)56.07 ± 1.08 (n = 15)56.86 ± 0.39 (n = 153)55.65 ± 0.54 (n = 50)0.254
height at hip cross (cm)56.93 ± 0.99 B (n = 15)60.382 ± 0.42 A (n = 152)58.12 ± 0.49 B (n = 49)0.002
body length (cm)64.04 ± 1.71 (n = 14)67.21 ± 0.38 (n = 153)67.68 ± 0.75 (n = 50)0.510
hip width (cm)13.94 ± 0.61 b (n = 9)16.97 ± 2.98 A (n = 136)15.16 ± 0.23 B (n = 44)2.000 × 10−6
heart girth (cm)82.40 ± 2.51 B (n = 15)88.72 ± 0.79 A (n = 151)83.18 ± 1.24 B (n = 50)3.270 × 10−4
cannon circumference (cm)8.13 ± 0.14 (n = 15)8.34 ± 0.06 (n = 153)8.06 ± 0.10 (n = 50)0.059
chest width (cm)19.18 ± 0.90 (n = 15)20.20 ± 0.26 (n = 153)19.83 ± 0.53 (n = 50)0.481
chest depth (cm)26.63 ± 0.57 c (n = 15)28.61 ± 0.20 b (n = 152)29.05 ± 0.51 a (n = 50)0.013
Note: Values with different letters (A, B, C/a, b, c) within the same row differ significantly at p < 0.01/p < 0.05. AVG means average, and SE means standard error.
Table
Table 4. Association analyses between growth traits and the CNV3 in SBWC goats.
Table 4. Association analyses between growth traits and the CNV3 in SBWC goats.
Trait-TypesTypic Frequencies (AVG ± SE)p-Values
LossMedianGain
body weight (kg)35.37 ± 4.22 b (n = 6)48.09 ± 1.31 a (n =104)42.34 ± 1.60 b (n = 38)0.020
body height (cm)55.60 ± 1.41 (n = 10)56.67 ± 0.40 (n = 154)55.99 ± 0.56 (n = 43)0.685
height at hip cross (cm)57.55 ± 0.65 B (n = 10)60.23 ± 0.43 A (n = 152)58.04 ± 0.47 B (n = 43)0.003
body length (cm)63.65 ± 1.45 B (n = 10)67.26 ± 0.39 ab (n = 153)68.45 ± 0.81 a (n = 43)0.022
hip width (cm)14.50 ± 0.73 B (n = 6)16.82 ± 0.26 A (n = 138)15.25 ± 0.27 B (n = 42)1.540 × 10−4
heart girth (cm)82.70 ± 2.70 AB (n = 10)88.36 ± 0.74 A (n = 154)82.26 ± 1.47 B (n = 43)3.480 × 10−4
cannon circumference (cm)7.75 ± 0.25 b (n = 10)8.35 ± 0.06 A (n = 155)8.13 ± 0.10 Ab (n = 43)0.020
chest width (cm)17.67 ± 1.03 (n = 10)20.24 ± 0.24 (n = 154)20.29 ± 0.69 (n = 43)0.098
chest depth (cm)27.25 ± 0.67 (n = 10)28.44 ± 0.19 (n = 153)29.48 ± 0.61 (n = 43)0.062
Note: Values with different letters (A, B/a, b) within the same row differ significantly at p < 0.01/p < 0.05. AVG means average, and SE means standard error.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, Q.; Wei, Z.; Zhu, H.; Pan, C.; Akhatayeva, Z.; Song, X.; Lan, X. Goat Pleomorphic Adenoma Gene 1 (PLAG1): mRNA Expression, CNV Detection and Associations with Growth Traits. Animals 2023, 13, 2023. https://doi.org/10.3390/ani13122023

AMA Style

Wang Q, Wei Z, Zhu H, Pan C, Akhatayeva Z, Song X, Lan X. Goat Pleomorphic Adenoma Gene 1 (PLAG1): mRNA Expression, CNV Detection and Associations with Growth Traits. Animals. 2023; 13(12):2023. https://doi.org/10.3390/ani13122023

Chicago/Turabian Style

Wang, Qian, Zhenyu Wei, Haijing Zhu, Chuanying Pan, Zhanerke Akhatayeva, Xiaoyue Song, and Xianyong Lan. 2023. "Goat Pleomorphic Adenoma Gene 1 (PLAG1): mRNA Expression, CNV Detection and Associations with Growth Traits" Animals 13, no. 12: 2023. https://doi.org/10.3390/ani13122023

APA Style

Wang, Q., Wei, Z., Zhu, H., Pan, C., Akhatayeva, Z., Song, X., & Lan, X. (2023). Goat Pleomorphic Adenoma Gene 1 (PLAG1): mRNA Expression, CNV Detection and Associations with Growth Traits. Animals, 13(12), 2023. https://doi.org/10.3390/ani13122023

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop