Identification and Molecular Analysis of m6A-circRNAs from Cashmere Goat Reveal Their Integrated Regulatory Network and Putative Functions in Secondary Hair Follicle during Anagen Stage
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sequence Source and In-Silico Analysis
2.2. Skin Tissue Collection and Total RNA Isolation
2.3. Methylation Immunoprecipitation of m6A-circRNA (Me-RIP) on Skin at Anagen and Telogen
2.4. Primer Design and RT-qPCR Analysis on Skin (Anagen and Telogen) and SHFs (Anagen, Catagen and Telogen)
2.5. Regulatory Network Analysis of Putative m6A-circRNAs with Related Signaling Pathway Enrichment
2.6. Statistical Analysis
3. Results and Discussion
3.1. Discovery and Characterization of m6A-circRNAs from the Skin Tissue of Cashmere Goats with an Expression Pattern between Anagen and Telogen
3.2. Regulatory Network of the Up-Regulated m6A-circRNAs at Anagen Stage
3.3. Pathway Network of the Genes Potentially Regulated by the Anagen Up-Regulated m6A-circRNAs
3.4. Expression Patterns of m6A-circRNAs and Their Host Genes in SHFs of Cashmere Goats
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jiao, Q.; Wang, Y.R.; Zhao, J.Y.; Wang, Z.Y.; Guo, D.; Bai, W.L. Identification and molecular analysis of cashmere goat lncRNAs reveal their integrated regulatory network and potential roles in secondary hair follicle. Anim. Biotechnol. 2020, 32, 719–732. [Google Scholar] [CrossRef] [PubMed]
- Bai, W.L.; Zhao, S.J.; Wang, Z.Y.; Zhu, Y.B.; Dang, Y.L.; Cong, Y.Y.; Xue, H.L.; Wang, W.; Deng, L.; Guo, D.; et al. LncRNAs in Secondary Hair Follicle of Cashmere Goat: Identification, Expression, and Their Regulatory Network in Wnt Signaling Pathway. Anim. Biotechnol. 2018, 29, 199–211. [Google Scholar] [CrossRef] [PubMed]
- Su, R.; Gong, G.; Zhang, L.T.; Yan, X.C.; Wang, F.H.; Zhang, L.; Qiao, X.; Li, X.K.; Li, J.Q. Screening the key genes of hair follicle growth cycle in Inner Mongolian Cashmere goat based on RNA sequencing. Arch. Anim. Breed. 2020, 63, 155–164. [Google Scholar] [CrossRef] [PubMed]
- Kloren, W.R.L.; Norton, B.W.; Waters, M.J. Fleece growth in Australian cashmere goats. III. The seasonal patterns of cashmere and hair growth, and association with growth hormone, prolactin and thyroxine in blood. Aust. J. Agric. Res. 1993, 44, 1035–1050. [Google Scholar] [CrossRef]
- Wu, J.H.; Zhang, Y.J.; Zhang, J.X.; Chang, Z.L.; Li, J.Q.; Yan, Z.W.; Husile; Zhang, W.G. Hoxc13/β-catenin correlation with hair follicle activity in cashmere goat. J. Integr. Agric. 2012, 11, 1159–1166. [Google Scholar] [CrossRef]
- Geng, R.; Yuan, C.; Chen, Y. Exploring differentially expressed genes by RNA-Seq in cashmere goat (Capra hircus) skin during hair follicle development and cycling. PLoS ONE 2013, 8, e62704. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.G.; Chen, R.; Ahmad, S.; Verma, R.; Kasturi, S.P.; Amaya, L.; Broughton, J.P.; Kim, J.; Cadena, C.; Pulendran, B.; et al. N6-methyladenosine modification controls circular RNA immunity. Mol. Cell 2019, 76, 96–109. [Google Scholar] [CrossRef]
- Wu, Y.M.; Yang, X.L.; Chen, Z.J.; Tian, L.; Jiang, G.M.; Chen, F.; Li, J.X.; An, P.P.; Lu, L.L.; Luo, N.; et al. m6A-induced lncRNA RP11 triggers the dissemination of colorectal cancer cells via upregulation of Zeb1. Mol. Cancer 2019, 18, 87–102. [Google Scholar] [CrossRef]
- Chen, Z.; Ling, K.; Zhu, Y.; Deng, L.; Li, Y.; Liang, Z. circ0000069 promotes cervical cancer cell proliferation and migration by inhibiting miR-4426. Biochem. Biophys. Res. Commun. 2021, 551, 114–120. [Google Scholar] [CrossRef]
- Fischer, J.W.; Leung, A.K. CircRNAs: A regulator of cellular stress. Crit. Rev. Biochem. Mol. Biol. 2017, 52, 220–233. [Google Scholar] [CrossRef]
- Meng, X.W.; Li, X.; Zhang, P.J.; Wang, J.J.; Zhou, Y.C.; Chen, M. Circular RNA: An emerging key player in RNA world. Brief. Bioinform. 2017, 18, 547–557. [Google Scholar] [CrossRef]
- Zhou, C.; Molinie, B.; Daneshvar, K.; Pondick, J.V.; Wang, J.; Van, W.N.; Xing, Y.; Giallourakis, C.C.; Mullen, A.C. Genome-wide maps of m6A circRNAs identify widespread and cell-type-specific methylation patterns that are distinct from mRNAs. Cell Rep. 2017, 20, 2262–2276. [Google Scholar] [CrossRef] [Green Version]
- Su, H.; Wang, G.W.; Wu, L.F.; Ma, X.Q.; Ying, K.J.; Zhang, R.F. Transcriptome-wide map of m6A circRNAs identified in a rat model of hypoxia mediated pulmonary hypertension. BMC Genom. 2020, 21, 39–53. [Google Scholar] [CrossRef] [Green Version]
- Guo, M.; Yan, R.; Ji, Q.W.; Yao, H.M.; Sun, M.; Duan, L.Q.; Xue, Z.; Jia, Y.P. IFN regulatory Factor-1 induced macrophage pyroptosis by modulating m6A modification of circ_0029589 in patients with acute coronary syndrome. Int. Immunopharmacol. 2020, 86, 106800. [Google Scholar] [CrossRef]
- Xu, J.J.; Wan, Z.; Tang, M.Y.; Lin, Z.J.; Jiang, S.; Ji, L.; Gorshkov, K.; Mao, Q.J.; Xia, S.J.; Cen, D.; et al. N6-methyladenosine-modified CircRNA-SORE sustains sorafenib resistance in hepatocellular carcinoma by regulating beta-catenin signaling. Mol. Cancer 2020, 19, 163–178. [Google Scholar] [CrossRef]
- Rao, X.; Lai, L.; Li, X.; Wang, L.; Li, A.; Yang, Q. N6-methyladenosine modification of circular RNA circ-ARL3 facilitates Hepatitis B virus-associated hepatocellular carcinoma via sponging miR-1305. IUBMB Life 2021, 73, 408–417. [Google Scholar] [CrossRef]
- Yang, Y.; Fan, X.J.; Mao, M.W.; Song, X.W.; Wu, P.; Zhang, Y.; Jin, Y.F.; Yang, Y.; Chen, L.L.; Wang, Y.; et al. Extensive translation of circular RNAs driven by N6-methyladenosine. Cell Res. 2017, 27, 626–641. [Google Scholar] [CrossRef] [Green Version]
- Tang, C.; Xie, Y.M.; Yu, T.; Liu, N.; Wang, Z.Q.; Woolsey, R.J.; Tang, Y.G.; Zhang, X.Z.; Qin, W.B.; Zhang, Y.; et al. m6A-dependent biogenesis of circular RNAs in male germ cells. Cell Res. 2020, 30, 211–228. [Google Scholar] [CrossRef]
- Yin, R.; Wang, Y.; Wang, Z.; Zhu, Y.; Cong, Y.; Wang, W.; Deng, L.; Liu, H.; Guo, D.; Bai, W. Discovery and molecular analysis of conserved circRNAs from cashmere goat reveal their integrated regulatory network and potential roles in secondary hair follicle. Electron. J. Biotechnol. 2019, 41, 37–47. [Google Scholar] [CrossRef]
- Zheng, Y.Y.; Hui, T.Y.; Yue, C.; Sun, J.M.; Guo, D.; Guo, S.L.; Guo, S.P.; Li, B.J.; Wang, Z.Y.; Bai, W.L. Comprehensive analysis of circRNAs from cashmere goat skin by next generation RNA sequencing (RNA-seq). Sci. Rep. 2020, 10, 516–528. [Google Scholar] [CrossRef] [Green Version]
- Shang, F.Z.; Wang, Y.; Ma, R.; Di, Z.Y.; Wu, Z.H.; Hai, E.; Rong, Y.J.; Pan, J.F.; Liang, L.L.; Wang, Z.Y.; et al. Expression Profiling and Functional Analysis of Circular RNAs in Inner Mongolian Cashmere Goat Hair Follicles. Front. Genet. 2021, 12, 678825. [Google Scholar] [CrossRef]
- Yin, R.H.; Zhao, S.J.; Jiao, Q.; Wang, Z.Y.; Bai, M.; Fan, Y.X.; Zhu, Y.B.; Bai, W.L. CircRNA-1926 Promotes the Differentiation of Goat SHF Stem Cells into Hair Follicle Lineage by miR-148a/b-3p/CDK19 Axis. Animals 2020, 10, 1552. [Google Scholar] [CrossRef]
- Zhu, Y.B.; Wang, Y.R.; Zhao, J.Y.; Shen, J.C.; Wang, Z.Y.; Bai, M.; Fan, Y.X.; Yin, R.H.; Mao, Y.J.; Bai, W.L. CircRNA-1967 participates in the differentiation of goat SHF-SCs into hair follicle lineage by sponging miR-93-3p to enhance LEF1 expression. Anim. Biotechnol. 2021, 22, 1–13. [Google Scholar] [CrossRef]
- Memczak, S.; Jens, M.; Elefsinioti, A.; Torti, F.; Krueger, J.; Rybak, A.; Maier, L.; Mackowiak, S.D.; Gregersen, L.H.; Munschauer, M.; et al. Circular RNAs are a large class of animal RNAs with regulatory potency. Nature 2013, 495, 333–338. [Google Scholar] [CrossRef]
- Gao, Y.; Wang, J.F.; Zhao, F.Q. CIRI: An efficient and unbiased algorithm for de novo circular RNA identification. Genome Biol. 2015, 16, 4–19. [Google Scholar] [CrossRef] [Green Version]
- Dong, R.; Ma, X.K.; Chen, L.L.; Yang, L. Genome-wide annotation of circRNAs and their alternative back-splicing/splicing with CIRCexplorer pipeline. Methods Mol. Biol. 2019, 1870, 137–149. [Google Scholar] [CrossRef]
- Bai, W.L.; Dang, Y.L.; Wang, J.J.; Yin, R.H.; Wang, Z.Y.; Zhu, Y.B.; Cong, Y.Y.; Xue, H.L.; Deng, L.; Guo, D.; et al. Molecular characterization, expression and methylation status analysis of BMP4 gene in skin tissue of Liaoning cashmere goat during hair follicle cycle. Genetica 2016, 144, 457–467. [Google Scholar] [CrossRef]
- Zhu, Y.B.; Wang, Z.Y.; Yin, R.H.; Jiao, Q.; Zhao, S.J.; Cong, Y.Y.; Xue, H.L.; Guo, D.; Wang, S.Q.; Zhu, Y.X.; et al. A lncRNA-H19 transcript from secondary hair follicle of Liaoning cashmere goat: Identification, regulatory network and expression regulated potentially by its promoter methylation. Gene 2018, 641, 78–85. [Google Scholar] [CrossRef]
- Zhong, S.; Wang, J.; Zhang, Q.; Xu, H.Z.; Feng, J.F. CircPrimer: A software for annotating circRNAs and determining the specificity of circRNA primers. BMC Bioinform. 2018, 19, 292–296. [Google Scholar] [CrossRef]
- Bai, W.L.; Yin, R.H.; Yin, R.L.; Jiang, W.Q.; Wang, J.J.; Wang, Z.Y.; Zhu, Y.B.; Zhao, Z.H.; Yang, R.J.; Luo, G.B.; et al. Selection and validation of suitable reference genes in skin tissue of Liaoning Cashmere goat during hair follicle cycle. Livest. Sci. 2014, 161, 28–35. [Google Scholar] [CrossRef]
- Chen, J.B.; Tian, Y.H.; Zhang, Q.; Ren, D.P.; Zhang, Q.; Yan, X.; Wang, L.Z.; He, Z.J.; Zhang, W.; Zhang, T.Z.; et al. Novel Insights into the Role of N6-Methyladenosine RNA Modification in Bone Pathophysiology. Stem Cells Dev. 2021, 30, 17–28. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.F.; Zhao, X.H.; Wang, Y.B.; Ren, F.H.; Sun, D.W.; Yan, Y.B.; Kong, X.L.; Bu, J.L.; Liu, M.F.; Xu, S.D. circRNA-002178 act as a ceRNA to promote PDL1/PD1 expression in lung adenocarcinoma. Cell Death Dis. 2020, 11, 32–42. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.H.; Wang, X.W. miRDB: An online database for prediction of functional microRNA targets. Nucleic Acids Res. 2020, 48, D127–D131. [Google Scholar] [CrossRef] [Green Version]
- Smoot, M.E.; Ono, K.; Ruscheinski, J.; Wang, P.L.; Ideker, T. Cytoscape 2.8: New features for data integration and network visualization. Bioinformatics 2011, 27, 431–432. [Google Scholar] [CrossRef] [Green Version]
- Bindea, G.; Galon, J.; Mlecnik, B. CluePedia Cytoscape plugin: Pathway insights using integrated experimental and in silico data. Bioinformatics 2013, 29, 661–663. [Google Scholar] [CrossRef]
- Wang, S.Y.; Chai, P.W.; Jia, R.B.; Jia, R.B. Novel insights on m6A RNA methylation in tumorigenesis: A double-edged sword. Mol. Cancer 2018, 17, 101–110. [Google Scholar] [CrossRef] [Green Version]
- Yang, D.D.; Qiao, J.; Wang, G.Y.; Lan, Y.Y.; Li, G.P.; Guo, X.D.; Xi, J.J.; Ye, D.; Zhu, S.C.; Chen, W.; et al. N6-Methyladenosine modification of lincRNA 1281 is critically required for mESC differentiation potential. Nucleic Acids Res. 2018, 46, 3906–3920. [Google Scholar] [CrossRef] [Green Version]
- Zheng, Y.Y.; Nie, P.; Peng, D.; He, Z.H.; Liu, M.N.; Xie, Y.B.; Miao, Y.Y.; Zuo, Z.X.; Ren, J. m6AVar: A database of functional variants involved in m6A modification. Nucleic Acids Res. 2018, 46, D139–D145. [Google Scholar] [CrossRef]
- Zhou, G.; Kang, D.; Ma, S.; Wang, X.; Gao, Y.; Yang, Y.; Wang, X.; Chen, Y. Integrative analysis reveals ncRNA-mediated molecular regulatory network driving secondary hair follicle regression in cashmere goats. BMC Genom. 2018, 19, 222–237. [Google Scholar] [CrossRef] [Green Version]
- Vanhoutteghem, A.; Delhomme, B.; Herve, F.; Nondier, I.; Petit, J.M.; Araki, M.; Araki, K.; Djian, P. The importance of basonuclin 2 in adult mice and its relation to basonuclin 1. Mech. Dev. 2016, 140, 53–73. [Google Scholar] [CrossRef]
- Schlake, T. Segmental Igfbp5 expression is specifically associated with the bent structure of zigzag hairs. Mech. Dev. 2005, 122, 988–997. [Google Scholar] [CrossRef]
- Su, R.; Fan, Y.X.; Qiao, X.; Li, X.K.; Zhang, L.; Li, C.; Li, J.Q. Transcriptomic analysis reveals critical genes for the hair follicle of Inner Mongolia cashmere goat from catagen to telogen. PLoS ONE 2018, 13, e0204404. [Google Scholar] [CrossRef] [Green Version]
- Oshimori, N.; Fuchs, E. Paracrine TGF-β signaling counterbalances BMP-mediated repression in hair follicle stem cell activation. Cell Stem Cell 2012, 10, 63–75. [Google Scholar] [CrossRef] [Green Version]
- Deng, Z.; Lei, X.; Zhang, X.; Zhang, H.; Liu, S.; Chen, Q.; Hu, H.; Wang, X.; Ning, L.; Cao, Y.; et al. mTOR signaling promotes stem cell activation via counterbalancing BMP-mediated suppression during hair regeneration. J. Mol. Cell Biol. 2015, 7, 62–72. [Google Scholar] [CrossRef] [Green Version]
- Sardiña, L.A.; Rubin, B.; Jour, G.; Piliang, M.; Elston, C.; Bergfeld, W.F. Differential expression of phospho-S6 in hair follicle tumors: Evidence of mammalian target of rapamycin pathway activation. J. Cutan. Pathol. 2019, 4, 256–260. [Google Scholar] [CrossRef]
- Sennett, R.; Wang, Z.; Rezza, A.; Grisanti, L.; Roitershtein, N.; Sicchio, C.; Mok, K.W.; Heitman, N.J.; Clavel, C.; Ma’ayan, A.; et al. An Integrated Transcriptome Atlas of Embryonic Hair Follicle Progenitors, Their Niche, and the Developing Skin. Dev. Cell 2015, 34, 577–591. [Google Scholar] [CrossRef] [Green Version]
- Amoh, Y.; Hoffman, R.M. Hair follicle-associated-pluripotent (HAP) stem cells. Cell Cycle 2017, 16, 2169–2175. [Google Scholar] [CrossRef] [Green Version]
- Salzman, J.; Chen, R.E.; Olsen, M.N.; Wang, P.L.; Brown, P.O.; Moran, J.V. Cell-type specific features of circular RNA expression. PLoS Genet. 2013, 9, e1003777. [Google Scholar] [CrossRef]
- Rybak-Wolf, A.; Stottmeister, C.; Glažar, P.; Jens, M.; Pino, N.; Giusti, S.; Hanan, M.; Behm, M.; Bartok, O.; Ashwal-Fluss, R.; et al. Circular RNAs in the mammalian brain are highly abundant, conserved, and dynamically expressed. Mol. Cell 2015, 58, 870–885. [Google Scholar] [CrossRef] [Green Version]
- Mukhopadhyay, S.; Jackson, P.K. The tubby family proteins. Genome Biol. 2011, 12, 225–233. [Google Scholar] [CrossRef] [Green Version]
- Meng, E.; Shevde, L.A.; Samant, R.S. Emerging roles and underlying molecular mechanisms of DNAJB6 in cancer. Oncotarget 2016, 7, 53984–53996. [Google Scholar] [CrossRef] [Green Version]
- Menezes, M.E.; Mitra, A.; Shevde, L.A.; Samant, R.S. DNAJB6 governs a novel regulatory loop determining Wnt/β-catenin signalling activity. Biochem. J. 2012, 444, 573–580. [Google Scholar] [CrossRef] [Green Version]
- Rishikaysh, P.; Dev, K.; Diaz, D.; Qureshi, W.M.; Filip, S.; Mokry, J. Signaling involved in hair follicle morphogenesis and development. Int. J. Mol. Sci. 2014, 15, 1647–1670. [Google Scholar] [CrossRef] [Green Version]
- Reddy, S.; Andl, T.; Bagasra, A.; Lu, M.M.; Epstein, D.J.; Morrisey, E.E.; Millar, S.E. Characterization of Wnt gene expression in developing and postnatal hair follicles and identification of Wnt5a as a target of Sonic hedgehog in hair follicle morphogenesis. Mech. Dev. 2001, 107, 69–82. [Google Scholar] [CrossRef]
- Lowry, W.E.; Blanpain, C.; Nowak, J.A.; Guasch, G.; Lewis, L.; Fuchs, E. Defining the impact of beta-catenin/Tcf transactivation on epithelial stem cells. Genes Dev. 2005, 19, 1596–1611. [Google Scholar] [CrossRef] [Green Version]
- Lin, C.M.; Liu, Y.; Huang, K.; Chen, X.C.; Cai, B.Z.; Li, H.H.; Yuan, Y.P.; Zhang, H.; Li, Y. Long noncoding RNA expression in dermal papilla cells contributes to hairy gene regulation. Biochem. Biophys. Res. Commun. 2014, 453, 508–514. [Google Scholar] [CrossRef]
- Takeuchi, A.; Miyamoto, T.; Yamaji, K.; Masuho, Y.; Hayashi, M.; Hayashi, H.; Onozaki, K. A human erythrocyte-derived growth-promoting factor with a wide target cell spectrum: Identification as catalase. Cancer Res. 1995, 55, 1586–1589. [Google Scholar]
- Yang, Y.; Zhang, Q.; Liang, J.; Yang, M.; Wang, Z.; Tang, D.; Wang, D. STAM2 knockdown inhibits proliferation, migration, and invasion by affecting the JAK2/STAT3 signaling pathway in gastric cancer. Acta Biochim. Biophys. Sin. 2021, 53, 697–706. [Google Scholar] [CrossRef]
- Aslam, M.A.; Alemdehy, M.F.; Pritchard, C.E.J.; Song, J.Y.; Muhaimin, F.I.; Wijdeven, R.H.; Huijbers, I.J.; Neefjes, J.; Jacobs, H. Towards an understanding of C9orf82 protein/CAAP1 function. PLoS ONE 2019, 14, e0210526. [Google Scholar] [CrossRef]
- Su, J.H.; Lu, H.J.; Wang, Y.T.; Kong, Y.X.; Liu, Y.T.; Wang, M.M.; Xiong, Y.N.; Zhang, G.L. Effects of CAAP1 on Proliferation, Migration and Invasion of Hepatoma Cell Line SMMC-7721. Sichuan Da Xue Xue Bao Yi Xue Ban 2021, 52, 445–451. [Google Scholar] [CrossRef] [PubMed]
- Bai, W.L.; Dang, Y.L.; Yin, R.H.; Jiang, W.Q.; Wang, Z.Y.; Zhu, Y.B.; Wang, S.Q.; Zhao, Y.Y.; Deng, L.; Luo, G.B.; et al. Differential expression of microRNAs and their regulatory networks in skin tissue of Liaoning Cashmere goat during hair follicle cycles. Anim. Biotechnol. 2016, 27, 104–112. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Type/Reference in GenBank or Publication | Sequence (5′–3′) a | Amplicon Size (bp) | Ta b (°C) |
---|---|---|---|---|
circRNA-SCRN1 | Divergent primer/this study | F: ATGCACTTTGGAAGCTGTGG, R: TGCTCAGAGTCAAGGTTGGT | 246 | 53 |
circRNA-ZNF638 | Divergent primer/this study | F: TTTGCAATGCCCAGGTTCAA, R: CTGACATCCCCATTCGGTCT | 250 | 53 |
circRNA-AFTPH | Divergent primer/this study | F: TGCACAGTGTCTCCTTAGCA, R: ATTGTCTAGTGGTGGTGGGG | 162 | 54 |
circRNA-DNAJB6 | Divergent primer/this study | F: ATGAAAGAAGCCTGCACTGG, R: GGAAGTTGAAGAAGACGGCC | 235 | 53 |
circRNA-TULP4 | Divergent primer/this study | F: GGGACAGAAACACTCCACAG, R: CACACTCTTCAAACGGCACA | 151 | 54 |
circRNA-F13A1 | Divergent primer/this study | F: AACCCCGATGTCATTCAGGA, R: ACTTGCCTGTACGTGATGGA | 151 | 55 |
circRNA-HYDIN | Divergent primer/this study | F: TCATCCAGCTCTCCACCAAG, R: CCCGTTTCCTCTTGCTCAAC | 159 | 54 |
circRNA-PPP3R1 | Divergent primer/this study | F: TCTCCATTCCCATCGGTGTC, R: CAGATAAGGATGGGGATGGA | 210 | 54 |
circRNA-SLC12A2 | Divergent primer/this study | F: AGGCTCAGATTGTTCTTTTGGT, R: CAAAAGCGAAGATCAGGCCA | 185 | 53 |
circRNA-TNFRSF21 | Divergent primer/this study | F: TGGTGATAGTGGTGTGCAGT, R: GGTCGACGTGGTGGTATTTG | 234 | 53 |
circRNA-LOC102188506 | Divergent primer/this study | F: GGATGAAAAGCAGAGTGGCC, R: CTGAGTTATGCCTTGGCGTC | 226 | 54 |
circRNA-LRRFIP1 | Divergent primer/this study | F: GAAACCACACACGGCTAAGG, R: CAGGCTGCTGAAAATGCTGA | 236 | 54 |
circRNA-CAT | Divergent primer/this study | F: TCTCTCCCGGTCAAAGTGAG, R: TCGTGGCTTTGCAGTGAAAT | 231 | 54 |
circRNA-CAAP1 | Divergent primer/this study | F: AGGTGACAATGGTATGGACTCT, R: GCCACAGTCAGGTCTAATCC | 169 | 53 |
circRNA-STAM2 | Divergent primer/this study | F: TGGGTAATGTGCTGGATGGT, R: GACAACACAGCCTGCTCAAA | 159 | 54 |
ZNF638 | Convergent primer/XM_005686375.3 | F: TTCAAGTCAAGCAGAATCCAC, R: AGACAACTCTCCCTCAACCAC | 131 | 55 |
DNAJB6 | Convergent primer/XM_018046635.1 | F: GTTCAGTTCCTTCGGTTCGCT, R: CCTGCCGTTCACCACTTTTGT | 127 | 57 |
TULP4 | Convergent primer/XM_018053415.1 | F: CCGACTCTTGCCTATGTTCCA, R: TCACTCCTCCCCTTTCTGCTC | 165 | 53 |
CAT | Convergent primer/XM_005690077.3 | F: GAGCATATTGGAAAGAGGACG, R: AAGGACGGAAACAGTAGAGCA | 191 | 53 |
CAAP1 | Convergent primer/XM_018051896.1 | F: AACTCTACAGCCAACCTCCGC, R: ATCCCACTCCAGCAACCATCC | 199 | 58 |
STAM2 | Convergent primer/XM_005676127.3 | F: GATGGGGATGTCTGTGGATA, R: AAAGGAGAGGCTGCTGTTGA | 140 | 53 |
UBC c | Convergent primer/[30] | F: GCATTGTTGGGTTCCTGTGT, R: TTTGCATTTTGACCTGTGAG | 90 | 52 |
YWHAZ c | Convergent primer/[30] | F: TGTAGGAGCCCGTAGGTCATCT, R: TCTCTCTGTATTCTCGAGCCATCT | 102 | 56 |
SDHA c | Convergent primer/[30] | F: AGCACTGGAGGAAGCACAC, R: CACAGTCGGTCTCGTTCAA | 105 | 53 |
circRNA Name | Spliced Length (nt) | Number of Chromosome | Sequence ID in Goat Genome | Location on Chromosome | Host Gene |
---|---|---|---|---|---|
circRNA-SCRN1 | 1304 | chromosome 4 | NC_030811.1 | 53829779 to 53831082 | SCRN1 |
circRNA-ZNF638 | 1515 | chromosome 11 | NC_030818.1 | 13101422 to 13102936 | ZNF638 |
circRNA-AFTPH | 1963 | chromosome 11 | NC_030818.1 | 62684628 to 62686590 | AFTPH |
circRNA-DNAJB6 | 2059 | chromosome 4 | NC_030811.1 | 1238643 to 1240701 | DNAJB6 |
circRNA-TULP4 | 2204 | chromosome 9 | NC_030816.1 | 82114863 to 82117066 | TULP4 |
circRNA-F13A1 | 2409 | chromosome 23 | NC_030830.1 | 16784531 to 16786939 | F13A1 |
circRNA-HYDIN | 2538 | chromosome 18 | NC_030825.1 | 41207111 to 41209648 | HYDIN |
circRNA-PPP3R1 | 2540 | chromosome 11 | NC_030818.1 | 66320976 to 66323515 | PPP3R1 |
circRNA-SLC12A2 | 2630 | chromosome 7 | NC_030814.1 | 84793912 to 84796541 | SLC12A2 |
circRNA-TNFRSF21 | 2669 | chromosome 23 | NC_030830.1 | 28430416 to 28433084 | TNFRSF21 |
circRNA-LOC102188506 | 2683 | chromosome 10 | NC_030817.1 | 16319392 to 16322074 | LOC102188506 |
circRNA-LRRFIP1 | 2842 | chromosome 3 | NC_030810.1 | 3505854 to 3508695 | LRRFIP1 |
circRNA-CAT | 2885 | chromosome 15 | NC_030822.1 | 17940546 to 17943430 | CAT |
circRNA-CAAP1 | 2899 | chromosome 8 | NC_030815.1 | 17288789 to 17291687 | CAAP1 |
circRNA-STAM2 | 2998 | chromosome 2 | NC_030809.1 | 92139671 to 92142668 | STAM2 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hui, T.; Zhu, Y.; Shen, J.; Bai, M.; Fan, Y.; Feng, S.; Wang, Z.; Zhao, J.; Zhang, Q.; Liu, X.; et al. Identification and Molecular Analysis of m6A-circRNAs from Cashmere Goat Reveal Their Integrated Regulatory Network and Putative Functions in Secondary Hair Follicle during Anagen Stage. Animals 2022, 12, 694. https://doi.org/10.3390/ani12060694
Hui T, Zhu Y, Shen J, Bai M, Fan Y, Feng S, Wang Z, Zhao J, Zhang Q, Liu X, et al. Identification and Molecular Analysis of m6A-circRNAs from Cashmere Goat Reveal Their Integrated Regulatory Network and Putative Functions in Secondary Hair Follicle during Anagen Stage. Animals. 2022; 12(6):694. https://doi.org/10.3390/ani12060694
Chicago/Turabian StyleHui, Taiyu, Yubo Zhu, Jincheng Shen, Man Bai, Yixing Fan, Siyu Feng, Zeying Wang, Junyin Zhao, Qi Zhang, Xingwang Liu, and et al. 2022. "Identification and Molecular Analysis of m6A-circRNAs from Cashmere Goat Reveal Their Integrated Regulatory Network and Putative Functions in Secondary Hair Follicle during Anagen Stage" Animals 12, no. 6: 694. https://doi.org/10.3390/ani12060694
APA StyleHui, T., Zhu, Y., Shen, J., Bai, M., Fan, Y., Feng, S., Wang, Z., Zhao, J., Zhang, Q., Liu, X., Gong, T., & Bai, W. (2022). Identification and Molecular Analysis of m6A-circRNAs from Cashmere Goat Reveal Their Integrated Regulatory Network and Putative Functions in Secondary Hair Follicle during Anagen Stage. Animals, 12(6), 694. https://doi.org/10.3390/ani12060694