The Aqueous Leaf Extract of M. oleifera Inhibits PEDV Replication through Suppressing Oxidative Stress-Mediated Apoptosis
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Lines, Virus, and Reagents
2.2. Cell Cytotoxicity Assay
2.3. Quantitative Real-Time PCR
2.4. Western Blot Analysis
2.5. Indirect Immunofluorescence Assay
2.6. Flow Cytometry Assay
2.7. The Plaque-Forming Assay
2.8. Measurement of Anti-Oxidative Stress Activity
2.9. Cellular Apoptosis Assay
2.10. Statistical Analysis
3. Results
3.1. Cytotoxicity of the Aqueous Leaf Extract of M. oleifera on Vero Cells
3.2. Antiviral Activity of the Aqueous Leaf Extract of M. oleifera on Vero cells
3.3. Aqueous Leaf Extract of M. oleifera Impaired PEDV Replication Instead of Attachment or Internalization
3.4. Aqueous Leaf Extract of M. oleifera Impaired PEDV Replication by Inhibiting Apoptosis
3.5. Aqueous Leaf Extract of M. oleifera Alleviated the Inflammatory Cytokines Induced by PEDV Infection
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Li, B.X.; Ge, J.W.; Li, Y.J. Porcine aminopeptidase N is a functional receptor for the PEDV coronavirus. Virology 2007, 365, 166–172. [Google Scholar] [CrossRef] [Green Version]
- Wrapp, D.; McLellan, J.S. The 3.1-angstrom cryo-electron microscopy structure of the porcine epidemic diarrhea virus spike protein in the prefusion conformation. J. Virol. 2019, 93, e00923. [Google Scholar] [CrossRef] [Green Version]
- Zhang, S.; Cao, Y.; Yang, Q. Transferrin receptor 1 levels at the cell surface influence the susceptibility of newborn piglets to PEDV infection. PLoS Pathog. 2020, 16, e1008682. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Kong, N.; Jiao, Y.; Dong, S.; Sun, D.; Chen, X.; Zheng, H.; Tong, W.; Yu, H.; Yu, L.; et al. EGR1 Suppresses Porcine Epidemic Diarrhea Virus Replication by Regulating IRAV To Degrade Viral Nucleocapsid Protein. J. Virol. 2021, 95, e00645-21. [Google Scholar] [CrossRef]
- Li, Y.; Wu, Q.; Jin, Y.; Yang, Q. Antiviral activity of interleukin-11 as a response to porcine epidemic diarrhea virus infection. Veterinary research 2019, 50, 1–13. [Google Scholar] [CrossRef] [Green Version]
- Li, L.; Fu, F.; Xue, M.; Chen, W.; Liu, J.; Shi, H.; Chen, J.; Bu, Z.; Feng, L.; Liu, P. IFN-lambda preferably inhibits PEDV infection of porcine intestinal epithelial cells compared with IFN-alpha. Antivir. Res. 2017, 140, 76–82. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.M.; Saif, L.J.; Marthaler, D.; Wang, Q. Evolution, antigenicity and pathogenicity of global porcine epidemic diarrhea virus strains. Virus Res. 2016, 20–39. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, W.; van Kuppeveld, F.J.; He, Q.; Rottier, P.J.; Bosch, B.-J. Cellular entry of the porcine epidemic diarrhea virus. Virus Res. 2016, 226, 117–127. [Google Scholar] [CrossRef] [Green Version]
- Wang, R.; Yu, R.; Chen, B.; Si, F.; Wang, J.; Xie, C.; Men, C.; Dong, S.; Li, Z. Identification of host cell proteins that interact with the M protein of porcine epidemic diarrhea virus. Vet. Microbiol. 2020, 246, 108729. [Google Scholar] [CrossRef]
- Zheng, L.; Wang, X.; Guo, D.; Cao, J.; Cheng, L.; Li, X.; Zou, D.; Zhang, Y.; Xu, J.; Wu, X. Porcine epidemic diarrhea virus E protein suppresses RIG-I signaling-mediated interferon-β production. Vet. Microbiol. 2021, 254, 108994. [Google Scholar] [CrossRef]
- Ding, Z.; Fang, L.; Jing, H.; Zeng, S.; Wang, D.; Liu, L.; Zhang, H.; Luo, R.; Chen, H.; Xiao, S. Porcine epidemic diarrhea virus nucleocapsid protein antagonizes beta interferon production by sequestering the interaction between IRF3 and TBK1. J. Virol. 2014, 88, 8936–8945. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Y.; Grunewald, M.; Perlman, S. Coronaviruses: An Updated Overview of Their Replication and Pathogenesis. Methods Mol. Biol. 2020, 2203, 1–29. [Google Scholar] [CrossRef]
- Sen, T.; Samanta, S.K. Medicinal Plants, Human Health and Biodiversity: A Broad Review. Adv. Biochem. Eng. Biotechnol. 2014, 59–110. [Google Scholar]
- Amber, R.; Adnan, M.; Tariq, A.; Khan, S.N.; Mussarat, S.; Hashem, A.; Al-huqail, A.A.; Al-Arjani, A.-B.F. Antibacterial activity of selected medicinal plants of northwest Pakistan traditionally used against mastitis in livestock. Saudi J. Biol. Sci. 2018, 25, 154–161. [Google Scholar] [CrossRef] [PubMed]
- Kou, X.; Li, B.; Olayanju, J.B.; Drake, J.M.; Chen, N. Nutraceutical or pharmacological potential of Moringa oleifera Lam. Nutrients 2018, 10, 343. [Google Scholar] [CrossRef] [Green Version]
- Onunkwo, D.N. Effects of Moringa Oleifera Leaf Meal on the Growth Performance and Carcass Characteristics of Broiler Birds. IOSR-JAVS 2015, 8, 63–66. [Google Scholar]
- Dany, D.; Jorge, O.; Ángel, S.; Enrique, S.; Valentín, P.; Víctor, M.; Luis, S. Effect of Moringa oleifera meal inclusion on meat quality from the Mexican hairless pig. ARPN J. Agric. Biol. Sci. 2016, 11, 131–141. [Google Scholar]
- Waiyaput, W.; Payungporn, S.; Issara-Amphorn, J.; Panjaworayan, T.T. Inhibitory effects of crude extracts from some edible Thai plants against replication of hepatitis B virus and human liver cancer cells. Bmc. Complementary Altern. Med. 2012, 12, 246. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, X.; Xu, Y.; Zhang, Q.; Yang, F.; Yin, Z.; Wang, L.; Li, Q. Porcine epidemic diarrhea virus infections induce apoptosis in Vero cells via a reactive oxygen species (ROS)/p53, but not p38 MAPK and SAPK/JNK signalling pathways. Vet. Microbiol. 2019, 232, 1–12. [Google Scholar] [CrossRef]
- Sun, P.; Jin, J.; Wang, L.; Wang, J.; Zhou, H.; Zhang, Q.; Xu, X. Porcine epidemic diarrhea virus infections induce autophagy in Vero cells via ROS-dependent endoplasmic reticulum stress through PERK and IRE1 pathways. Vet. Microbiol. 2021, 253, 108959. [Google Scholar] [CrossRef] [PubMed]
- Clarke, P.; Tyler, K.L. Apoptosis in animal models of virus-induced disease. Nat. Rev. Microbiol. 2009, 7, 144–155. [Google Scholar] [CrossRef] [Green Version]
- Won, H.; Lim, J.; Yun, H.N.; Yoon, I.; Han, S.Y. Efficacy of Porcine Epidemic Diarrhea Vaccines: A Systematic Review and Meta-Analysis. Vaccines 2020, 8, 642. [Google Scholar] [CrossRef]
- Pensaert, M.B.; Bouck, P.D. A new coronavirus-like particle associated with diarrhea in swine. Arch. Virol. 1978, 58, 243–247. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xwwa, B.; Mi, W.A.; Jing, Z.A.; Qyl, A.; Llf, A.; Cyz, A.; Ping, J.; Yfla, B.; Jba, B. Pathogenicity and immunogenicity of a new strain of porcine epidemic diarrhea virus containing a novel deletion in the N gene. Vet. Microbiol. 2020, 240, 108511. [Google Scholar]
- Ren, J.L.; Zhang, A.H.; Wang, X.J. Traditional Chinese medicine for COVID-19 treatment. Pharmacol. Res. 2020, 155, 104743. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Wang, X.H.; Luo, Z.; Liu, L.F.; Yan, C.; Yan, C.Y.; Chen, G.D.; Gao, H.; Duan, W.J.; Kurihara, H. Traditional Chinese Medicine as a Potential Source for HSV-1 Therapy by Acting on Virus or the Susceptibility of Host. Int. J. Mol. Ences 2018, 19, 3266. [Google Scholar] [CrossRef] [Green Version]
- Zhou, Z.; Li, X.; Liu, J.; Dong, L.; Chen, Q.; Liu, J.; Kong, H.; Zhang, Q.; Qi, X.; Hou, D. Honeysuckle-encoded atypical microRNA2911 directly targets influenza A viruses. Cell Res. 2015, 25, 39–49. [Google Scholar] [CrossRef]
- Lee, Y.-R.; Yeh, S.-F.; Ruan, X.-M.; Zhang, H.; Hsu, S.-D.; Huang, H.-D.; Hsieh, C.-C.; Lin, Y.-S.; Yeh, T.-M.; Liu, H.-S. Honeysuckle aqueous extract and induced let-7a suppress dengue virus type 2 replication and pathogenesis. J. Ethnopharmacol. 2017, 198, 109–121. [Google Scholar] [CrossRef]
- Wang, P.; Bai, J.; Liu, X.; Wang, M.; Jiang, P. Tomatidine inhibits porcine epidemic diarrhea virus replication by targeting 3CL protease. Vet. Res. 2020, 51, 136. [Google Scholar] [CrossRef]
- Bagheri, G.; Martorell, M.; Ramírez-Alarcón, K.; Salehi, B.; Sharifi-Rad, J. Phytochemical screening of Moringa oleifera leaf extracts and their antimicrobial activities. Cell. Mol. Biol. 2020, 66, 1. [Google Scholar] [CrossRef]
- Feustel, S.; Ayón-Pérez, F.; Sandoval-Rodriguez, A.; Rodríguez-Echevarría, R.; Sánchez-Orozco, L. Protective Effects of Moringa oleifera on HBV Genotypes C and H Transiently Transfected Huh7 Cells. J. Immunol. Res. 2017, 2017, 6063850. [Google Scholar] [CrossRef] [Green Version]
- Li, C.; Li, W.; Lucio de Esesarte, E.; Guo, H.; van den Elzen, P.; Aarts, E.; van den Born, E.; Rottier, P.J.; Bosch, B.-J. Cell attachment domains of the porcine epidemic diarrhea virus spike protein are key targets of neutralizing antibodies. J. Virol. 2017, 91, e00273-17. [Google Scholar] [CrossRef] [Green Version]
- Muhammad, A.A.; Pauzi, N.A.S.; Arulselvan, P.; Abas, F.; Fakurazi, S. In vitro wound healing potential and identification of bioactive compounds from Moringa oleifera Lam. BioMed Res. Int. 2013, 2013, 974580. [Google Scholar] [CrossRef] [Green Version]
- Oldoni, T.L.C.; Merlin, N.; Karling, M.; Carpes, S.T.; de Alencar, S.M.; Morales, R.G.F.; da Silva, E.A.; Pilau, E.J. Bioguided extraction of phenolic compounds and UHPLC-ESI-Q-TOF-MS/MS characterization of extracts of Moringa oleifera leaves collected in Brazil. Food Res. Int. 2019, 125, 108647. [Google Scholar] [CrossRef] [PubMed]
- Andres, S.; Pevny, S.; Ziegenhagen, R.; Bakhiya, N.; Schäfer, B.; Hirsch-Ernst, K.I.; Lampen, A. Safety aspects of the use of quercetin as a dietary supplement. Mol. Nutr. Food Res. 2018, 62, 1700447. [Google Scholar] [CrossRef] [PubMed]
- Huynh, T.; Wang, H.; Luan, B. Structure-based lead optimization of herbal medicine rutin for inhibiting SARS-CoV-2’s main protease. Phys. Chem. Chem. Phys. 2020, 22, 25335–25343. [Google Scholar] [CrossRef] [PubMed]
- Wu, W.; Li, R.; Li, X.; He, J.; Jiang, S.; Liu, S.; Yang, J. Quercetin as an antiviral agent inhibits influenza A virus (IAV) entry. Viruses 2016, 8, 6. [Google Scholar] [CrossRef] [PubMed]
- Ling, L.J.; Lu, Y.; Zhang, Y.Y.; Zhu, H.Y.; Tu, P.; Li, H.; Chen, D.F. Flavonoids from Houttuynia cordata attenuate H1N1-induced acute lung injury in mice via inhibition of influenza virus and Toll-like receptor signalling. Phytomedicine Int. J. Phytother. Phytopharm. 2020, 67, 153150. [Google Scholar] [CrossRef] [PubMed]
- Fanunza, E.; Iampietro, M.; Distinto, S.; Corona, A.; Quartu, M.; Maccioni, E.; Horvat, B. Quercetin Blocks Ebola Virus Infection by Counteracting the VP24 Interferon-Inhibitory Function. Antimicrob. Agents Chemother. 2020, 64, e00530-20. [Google Scholar] [CrossRef]
- Li, Z.; Cao, H.; Cheng, Y.; Zhang, X.; Zeng, W.; Sun, Y.; Chen, S.; He, Q.; Han, H. Inhibition of Porcine Epidemic Diarrhea Virus Replication and Viral 3C-Like Protease by Quercetin. Int. J. Mol. Sci. 2020, 21, 8095. [Google Scholar] [CrossRef]
- Moloney, J.N.; Cotter, T.G. ROS signalling in the biology of cancer. In Proceedings of the Seminars in Cell & Developmental Biology; 2018; pp. 50–64. [Google Scholar]
- Zhang, J.; Wang, X.; Vikash, V.; Ye, Q.; Wu, D.; Liu, Y.; Dong, W. ROS and ROS-mediated cellular signaling. Oxidative Med. Cell. Longev. 2016, 2016, 4350965. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reshi, M.L.; Su, Y.-C.; Hong, J.-R. RNA viruses: ROS-mediated cell death. Int. J. Cell Biol. 2014, 2014, 467452. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.; Zhang, Z.; Li, J.; Gao, Y.; Zhou, L.; Ge, X.; Han, J.; Guo, X.; Yang, H. Porcine epidemic diarrhea virus S1 protein is the critical inducer of apoptosis. Virol. J. 2018, 15, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mita, A.C.; Mita, M.M.; Nawrocki, S.T.; Giles, F.J. Survivin: Key Regulator of Mitosis and Apoptosis and Novel Target for Cancer Therapeutics. Clin. Cancer Res. 2008, 14, 5000–5005. [Google Scholar] [CrossRef] [Green Version]
- Adams, J.M.; Cory, S. The Bcl-2 apoptotic switch in cancer development and therapy. Oncogene 2007, 26, 1324–1337. [Google Scholar] [CrossRef] [PubMed] [Green Version]





| Primers | Sequences | Product Length |
|---|---|---|
| IL-6 | F: AACCAACCACAAATGCCAG | 77 bp |
| R:GAGATGCGTCGTCATGTCCT | ||
| TNF-α | F:GAAAGCATGATCCGGGACG | 158 bp |
| R:ATCACTCCAAAGTGCAGCAGA | ||
| MCP-1 | F:GCTTAATGGCACCCCATCCT | 84 bp |
| R:GAAGCAGTGGGTCAGGACAA | ||
| GAPDH | F:ACATCATCCCTGCTTCTACTGG | 188 bp |
| R:CTCGGACGCCTGCTTCAC | ||
| PEDV-M | F:AGGTCTGCATTCCAGTGCTT | 216 bp |
| R:GGACATAGAAAGCCCAACCA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cao, Y.; Zhang, S.; Huang, Y.; Zhang, S.; Wang, H.; Bao, W. The Aqueous Leaf Extract of M. oleifera Inhibits PEDV Replication through Suppressing Oxidative Stress-Mediated Apoptosis. Animals 2022, 12, 458. https://doi.org/10.3390/ani12040458
Cao Y, Zhang S, Huang Y, Zhang S, Wang H, Bao W. The Aqueous Leaf Extract of M. oleifera Inhibits PEDV Replication through Suppressing Oxidative Stress-Mediated Apoptosis. Animals. 2022; 12(4):458. https://doi.org/10.3390/ani12040458
Chicago/Turabian StyleCao, Yanan, Shuoshuo Zhang, Yanjie Huang, Shuai Zhang, Haifei Wang, and Wenbin Bao. 2022. "The Aqueous Leaf Extract of M. oleifera Inhibits PEDV Replication through Suppressing Oxidative Stress-Mediated Apoptosis" Animals 12, no. 4: 458. https://doi.org/10.3390/ani12040458
APA StyleCao, Y., Zhang, S., Huang, Y., Zhang, S., Wang, H., & Bao, W. (2022). The Aqueous Leaf Extract of M. oleifera Inhibits PEDV Replication through Suppressing Oxidative Stress-Mediated Apoptosis. Animals, 12(4), 458. https://doi.org/10.3390/ani12040458

