Prevalence and Antimicrobial Resistance of Campylobacter jejuni and Campylobacter coli in Wild Birds from a Wildlife Rescue Centre
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Examined Birds and Collected Samples
2.2. Identification of Campylobacter
2.3. Antibiotic Susceptibility Testing
2.4. Statistical Analysis
3. Results
3.1. Detection of Campylobacter jejuni and C. coli
3.2. Relationship between the Prevalence of C. jejuni and C. coli and the Body Temperature of Birds
3.3. Antibiotic Resistance of C. jejuni and C. coli Strains
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Harley, C.D. Climate Change, Keystone Predation, and Biodiversity Loss. Science 2011, 334, 1124–1127. [Google Scholar] [CrossRef] [PubMed]
- Supple, M.A.; Shapiro, B. Conservation of biodiversity in the genomics era. Genome Biol. 2018, 19, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Bogoni, J.A.; Ferraz, K.M.; Peres, C.A. Continental-scale local extinctions in mammal assemblages are synergistically induced by habitat loss and hunting pressure. Biol. Conserv. 2022, 272, 109635. [Google Scholar] [CrossRef]
- Keane, A.; Brooke, M.L.; Mcgowan, P.J. Correlates of extinction risk and hunting pressure in gamebirds (Galliformes). Biol. Conserv. 2005, 126, 216–233. [Google Scholar] [CrossRef]
- Sell, B.; Sniegocki, T.; Giergiel, M.; Posyniak, A. White-Tailed Eagles’ (Haliaeetus albicilla) Exposure to Anticoagulant Rodenticides and Causes of Poisoning in Poland (2018–2020). Toxics 2022, 10, 63. [Google Scholar] [CrossRef]
- Janssen, R.; Krogfelt, K.A.; Cawthraw, S.A.; van Pelt, W.; Wagenaar, J.A.; Owen, R.J. Host-pathogen interactions in Campylobacter infections: The host perspective. Clin. Microbiol. Rev. 2008, 21, 505–518. [Google Scholar] [CrossRef]
- Skirrow, M.B.; Blaser, M.J. Clinical aspects of Campylobacter infection. In Campylobacter, 2nd ed.; Nachamkin, I., Blaser, M.J., Eds.; ASM Press: Washington, WA, USA, 2000; pp. 69–88. [Google Scholar]
- Moore, J.E.; Barton, M.D.; Blair, I.S.; Corcoran, D.; Dooley, J.S.; Fanning, S.; Kempf, I.; Lastovica, A.J.; Lowery, C.J.; Matsuda, M.; et al. The epidemiology of antibiotic resistance in Campylobacter. Microbes Infect. 2006, 8, 1955–1966. [Google Scholar] [CrossRef]
- Blaser, M.J.; Engberg, J. Clinical Aspects of Campylobacter jejuni and Campylobacter coli Infections. In Campylobacter, 3rd ed.; Nachamkin, I., Szymanski, C.M., Blaser, M.J., Eds.; ASM Press: Washington, WA, USA, 2014; pp. 97–121. [Google Scholar]
- Yuki, N.; Hartung, H.P. Guillain-Barré syndrome. N. Engl. J. Med. 2012, 366, 2294–2304. [Google Scholar] [CrossRef]
- Godschalk, P.C.; Kuijf, M.L.; Li, J.; St Michael, F.; Ang, C.W.; Jacobs, B.C.; Karwaski, M.F.; Brochu, D.; Moterassed, A.; Endtz, H.P.; et al. Structural Characterization of Campylobacter jejuni Lipooligosaccharide Outer Cores Associated with Guillain-Barre and Miller Fisher Syndromes. Infect. Immun. 2007, 75, 1245–1254. [Google Scholar] [CrossRef]
- Heikema, A.P.; Jacobs, B.C.; Horst-Kreft, D.; Huizinga, R.; Kuijf, M.L.; Endtz, H.P.; Samsom, J.N.; van Wamel, W.J. Siglec-7 specifically recognizes Campylobacter jejuni strains associated with oculomotor weakness in Guillain–Barré syndrome and Miller Fisher syndrome. Clin. Microbiol. Infect. 2013, 19, E106–E112. [Google Scholar] [CrossRef]
- Zachariah, O.H.; Lizzy, M.A.; Rose, K.; Angela, M.M. Multiple drug resistance of Campylobacter jejuni and Shigella isolated from diarrhoeic children at Kapsabet County referral hospital, Kenya. BMC Infect. Dis. 2021, 21, 2–8. [Google Scholar] [CrossRef] [PubMed]
- Sahin, O.; Kassem, I.I.; Shen, Z.; Lin, J.; Rajashekara, G.; Zhang, Q. Campylobacter in Poultry: Ecology and Potential Interventions. Avian Dis. 2015, 59, 185–200. [Google Scholar] [CrossRef] [PubMed]
- Dipineto, L.; Borrelli, L.; Pace, A.; Romano, V.; D’Orazio, S.; Varriale, L.; Russo, T.P.; Fioretti, A. Campylobacter coli infection in pet birds in southern Italy. Acta Vet. Scan. 2017, 59, 6. [Google Scholar] [CrossRef] [PubMed]
- Tarifa, E.; Torralbo, A.; Borge, C.; Cerdà-Cuéllar, M.; Ayats, T.; Carbonero, A.; García-Bocanegra, I. Genetic diversity and antimicrobial resistance of Campylobacter and Salmonella strains isolated from decoys and raptors. Comp. Immunol. Microbiol. Infect. Dis. 2016, 48, 14–21. [Google Scholar] [CrossRef]
- Molina-Lopez, R.A.; Valverdù, N.; Martin, M.; Mateu, E.; Obon, E.; Cerdà-Cuellàr, M.; Darwich, L. Wild raptors as carriers of antimicrobial-resistant Salmonella and Campylobacter strains. Vet. Rec. 2011, 168, 565. [Google Scholar] [CrossRef]
- Casanovas, L.; de Simón, M.; Ferrer, M.D.; Arqués, J.; Monzón, G. Intestinal carriage of Campylobacters, Salmonellas, Yersinias and Listerias in pigeons in the city of Barcelona. J. Appl. Bacteriol. 1995, 78, 11–13. [Google Scholar] [CrossRef]
- Dudzic, A.; Urban-Chmiel, R.; Stępień-Pyśniak, D.; Dec, M.; Puchalski, A.; Wernicki, A. Isolation, identification and antibiotic resistance of Campylobacter strains isolated from domestic and free-living pigeons. Br. Poult. Sci. 2016, 57, 172–178. [Google Scholar] [CrossRef]
- Mohan, V. Faeco prevalence of Campylobacter jejuni in urban wild birds and pets in New Zeland. BMC Res. Notes 2015, 8, 1–7. [Google Scholar] [CrossRef]
- Hald, B.; Skov, M.N.; Nielsen, E.M.; Rahbek, C.; Madsen, J.J.; Wainø, M.; Chriél, M.; Nordentoft, S.; Baggesen, D.L.; Madsen, M. Campylobacter jejuni and Campylobacter coli in wild birds on Danish livestock farms. Acta Vet. Scand. 2016, 58, 11. [Google Scholar] [CrossRef]
- Williams, N.J.; Jones, T.R.; Leatherbarrow, H.J.; Birtles, R.J.; Lahuerta-Marin, A.; Bennett, M.; Winstanley, C. Isolation of a Novel Campylobacter jejuni Clone Associated with the Bank Vole, Myodes glareolus. Appl. Environ. Microbiol. 2010, 76, 7318–7321. [Google Scholar] [CrossRef][Green Version]
- Lee, K.; Iwata, T.; Nakadai, A.; Kato, T.; Hayama, S.; Taniguchi, T.; Hayashidani, H. Prevalence of Salmonella, Yersinia and Campylobacter spp. in Feral Raccoons (Procyon lotor) and Masked Palm Civets (Paguma larvata) in Japan. Zoonoses Public Health 2011, 58, 424–431. [Google Scholar] [CrossRef] [PubMed]
- Lillehaug, A.; Monceyron Jonassen, C.; Bergsjø, B.; Hofshagen, M.; Tharaldsen, J.; Nesse, L.L.; Handeland, K. Screening of Feral Pigeon (Colomba livia), Mallard (Anas platyrhynchos) and Graylag Goose (Anser anser) Populations for Campylobacter spp., Salmonella spp., Avian Influenza Virus and Avian Paramyxovirus. Acta Vet. Scand. 2005, 46, 193–202. [Google Scholar] [CrossRef] [PubMed]
- Navarro-Gonzalez, N.; Ugarte-Ruiz, M.; Porrero, M.C.; Zamora, L.; Mentaberre, G.; Serrano, E.; Mateos, A.; Lavìn, S.; Domínguez, L. Campylobacter Shared Between Free-Ranging Cattle and Sympatric Wild Ungulates in a Natural Environment (NE Spain). EcoHealth 2014, 11, 333–342. [Google Scholar] [CrossRef] [PubMed]
- Dipineto, L.; Gargiulo, A.; Cuomo, A.; Santaniello, A.; Sensale, M.; Borrelli, L.; D’Angelo, L.; Menna, L.F.; Fioretti, A. Campylobacter jejuni in the red squirrel (Sciurus vulgaris) population of Southern Italy. Vet. J. 2009, 179, 149–150. [Google Scholar] [CrossRef] [PubMed]
- Goldman, C.G.; Matteo, M.J.; Loureiro, J.D.; Almuzara, M.; Barberis, C.; Vay, C.; Catalano, M.; Rodríguez Heredia, S.; Boccio, J.R.; Zubillagaa, M.B.; et al. Novel gastric helicobacters and oral campylobacters are present in captive and wild cetaceans. Vet. Microbiol. 2011, 152, 138–145. [Google Scholar] [CrossRef] [PubMed]
- García-Peña, F.J.; Llorente, M.T.; Serrano, T.; Ruano, M.J.; Belliure, J.; Benzal, J.; Herrera-Leòn, S.; Vidal, V.; D’Amico, V.; Peírez-Boto, D.; et al. Isolation of Campylobacter spp. from Three Species of Antarctic Penguins in Different Geographic Locations. EcoHealth 2017, 14, 78–87. [Google Scholar] [CrossRef] [PubMed]
- Martín-Maldonado, B.; Montoro-Dasi, L.; Pérez-Gracia, M.T.; Jordá, J.; Vega, S.; Marco-Jiménez, F.; Marin, C. Wild Bonelli’s eagles (Aquila fasciata) as carrier of antimicrobial resistant Salmonella and Campylobacter in Eastern Spain. Comp. Immunol. Microbiol. Infect. Dis. 2019, 67, 101372. [Google Scholar] [CrossRef]
- Russo, T.P.; Pace, A.; Varriale, L.; Borrelli, L.; Gargiulo, A.; Pompameo, M.; Fioretti, A.; Dipineto, L. Prevalence and Antimicrobial Resistance of Enteropathogenic Bacteria in Yellow-Legged Gulls (Larus michahellis) in Southern Italy. Animals 2021, 11, 275. [Google Scholar] [CrossRef]
- Tatner, P. The diet of urban Magpies Pica Pica. IBIS 2008, 125, 90–107. [Google Scholar] [CrossRef]
- Friedman, E. Corvids. In Hand-Rearing Birds; Wiley Online Library: Hoboken, NJ, USA, 2020; pp. 641–664. [Google Scholar] [CrossRef]
- Denis, M.; Soumet, C.; Rivoal, K.; Ermel, G.; Blivet, D.; Salvat, G.; Colin, P. Development of a m-PCR assay for simultaneous identification of Campylobacter jejuni and C. coli. Lett. Appl. Microbiol. 1999, 29, 406–410. [Google Scholar] [CrossRef]
- The European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 12.0. 2022. Available online: http://www.eucast.org (accessed on 20 December 2021).
- Clinical Laboratory and Standards Institute. VET01-S2 Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated From Animals; Second Informational Supplement; Clinical Laboratory and Standards Institute: Wayne, PA, USA, 2015. [Google Scholar]
- Dipineto, L.; Russo, T.P.; Gargiulo, A.; Borrelli, L.; De Luca Bossa, L.M.; Santaniello, A.; Buonocore, P.; Menna, L.F.; Fioretti, A. Prevalence of enteropathogenic bacteria in common quail (Coturnix coturnix). Avian Pathol. 2014, 43, 498–500. [Google Scholar] [CrossRef] [PubMed]
- Gargiulo, A.; Fioretti, A.; Russo, T.P.; Varriale, L.; Rampa, L.; Paone, S.; De Luca Bossa, L.M.; Raia, P.; Dipineto, L. Occurrence of enteropathogenic bacteria in birds of prey in Italy. Appl. Microbiol. 2018, 66, 202–206. [Google Scholar] [CrossRef] [PubMed]
- Habib, I.; Uyttendaele, M.; De Zutter, L. Evaluation of ISO 10272:2006 standard versus alternative enrichment and plating combinations for enumeration and detection of Campylobacter in chicken meat. Food Microbiol. 2011, 28, 1117–1123. [Google Scholar] [CrossRef] [PubMed]
- Gharbi, M.; Bèjaoui, A.; Hamda, C.B.; Alaya, N.; Hamrouni, S.; Bessoussa, G.; Ghram, A.; Maaroufi, A. Campylobacter spp. In eggs and laying hens in the North-East of Tunisia: Hight prevalence and multidrug-resistence phenotypes. Vet. Sci. 2022, 9, 108. [Google Scholar] [CrossRef]
- Richardson, L.J.; Cox, N.A.; Bailey, J.S.; Berrang, M.E.; Cox, J.M.; Buhr, R.J.; Fedorka-Cray, P.J.; Harrison, M.A. Evaluation of TECRA Broth, Bolton Broth, and Direct Plating for Recovery of Campylobacter spp. from Broiler Carcass Rinsates from Commercial Processing Plants. J. Food Prot. 2009, 72, 972–977. [Google Scholar] [CrossRef][Green Version]
- Šotnár, K.; Obuch, J. Feeding ecology of a nesting population of the Common Buzzard (Buteo buteo) in the Upper Nitra Region, Central Slovakia. Slovak Raptor J. 2009, 3, 13–20. [Google Scholar] [CrossRef]
- Kassinis, N.I.; Tzirkalli, E.; Miltiadou, M.; Moysi, M.; Charalambidou, I.; Roulin, A.; Vogiatzakis, I. Feeding Ecology of the Long-Legged Buzzard and Diet Overlap with Sympatric Bonelli’s Eagle On Cyprus. J. Raptor Res. 2022, 56, 336–345. [Google Scholar] [CrossRef]
- Gryz, J.; Krauze-Gryz, D. Food Niche Overlap of Avian Predators (Falconiformes, Strigiformes) in a Field and Forest Mosaic in Central Poland. Animals 2021, 11, 479. [Google Scholar] [CrossRef]
- Panzeri, M.; Menchetti, M.; Mori, E. Habitat Use and Diet of the Eurasian Scops Owl Otus scops in the Breeding and Wintering Periods in Central Italy. Ardeola 2014, 61, 393–399. [Google Scholar] [CrossRef]
- Bertolino, S.; Ghiberti, E.; Perrone, A. Feeding ecology of the long-eared owl (Asio otus) in northern Italy: Is it a dietary specialist? Can. J. Zool. 2001, 79, 2192–2198. [Google Scholar] [CrossRef]
- Kitowski, I.; Pawlega, K. Food Composition of the Little Owl Athene noctua in Farmland Areas of South East Poland. Belg. J. Zool. 2010, 140, 203–211. [Google Scholar]
- Chenchouni, H. Diet of the Little Owl (Athene noctua) during the pre-reproductive period in a semi-arid Mediterranean region. Zool. Ecol. 2014, 24, 314–323. [Google Scholar] [CrossRef]
- Meerburg, B.G.; Kijlstra, A. Role of rodents in transmission of Salmonella and Campylobacter. J. Sci. Food Agric. 2007, 87, 2774–2781. [Google Scholar] [CrossRef]
- Mori, E.; Mazzetto, F.; Menchetti, M.; Bodino, N.; Grasso, E.; Sposimo, P. Feeding ecology of the scops owl, Otus scops (Aves: Strigiformes), in the island of Pianosa (Tuscan Archipelago, Central Italy) outside the breeding period. Ital. J. Zool. 2016, 83, 417–422. [Google Scholar] [CrossRef]
- Ramos, R.; Cerda-Cuellar, M.; Ramirez, F.; Jover, L.; Ruiz, X. Influence of Refuse Sites on the Prevalence of Campylobacter spp. and Salmonella Serovars in Seagulls. Appl. Environ. Microbiol. 2010, 76, 3052–3056. [Google Scholar] [CrossRef]
- Mulder, A.C.; Franz, E.; de Rijk, S.; Versluis, M.A.; Coipan, C.; Buij, R.; Muskens, G.; Koene, M.; Pijnacker, R.; Duim, B.; et al. Tracing the animal sources of surface water contamination with Campylobacter jejuni and Campylobacter coli. Water Res. 2020, 187, 116421. [Google Scholar] [CrossRef]
- Jones, K. Campylobacters in water, sewage and the environment. J. Appl. Microbiol. 2001, 90, 68S–79S. [Google Scholar] [CrossRef]
- Park, S.F. The physiology of Campylobacter species and its relevance to their role as foodborne pathogens. Int. J. Food Microbiol. 2002, 74, 177–188. [Google Scholar] [CrossRef]
- Fitzgerald, C. Campylobacter. Clin. Lab. Med. 2015, 35, 289–298. [Google Scholar] [CrossRef]
- Troxell, B.; Petri, N.; Daron, C.; Pereira, R.; Mendoza, M.; Hassan, H.M.; Koci, M.D. Poultry Body Temperature Contributes to Invasion Control through Reduced Expression of Salmonella Pathogenicity Island 1 Genes in Salmonella enterica Serovars Typhimurium and Enteritidis. Appl. Environ. Microbiol. 2015, 81, 8192–8201. [Google Scholar] [CrossRef]
- García-Fernández, A.; Dionisi, A.M.; Arena, S.; Iglesias-Torrens, Y.; Carattoli, A.; Luzzi, I. Human Campylobacteriosis in Italy: Emergence of Multi-Drug Resistance to Ciprofloxacin, Tetracycline, and Erythromycin. Front. Microbiol. 2018, 9, 01906. [Google Scholar] [CrossRef] [PubMed]
Family | Species | N° | Age and Housing (Outd: outdoor; Ind: indoor) | ||||
---|---|---|---|---|---|---|---|
Diurnal birds of prey | Falconidae | Eurasian Hobby (Falco subbuteo) | 1 | Nestling/young: 1 | Adult: 0 | ||
Outd: 1 | Ind: 0 | Outd: 0 | Ind: 0 | ||||
Common Kestrel (Falco tinnunculus) | 23 | Nestling/young: 7 | Adult: 16 | ||||
Outd: 7 | Ind: 0 | Outd: 16 | Ind: 0 | ||||
Accipitridae | Eurasian Sparrowhawk (Accipiter nisus) | 1 | Nestling/young: 0 | Adult: 1 | |||
Outd: 0 | Ind: 0 | Outd: 1 | Ind: 0 | ||||
Peregrine Falcon (Falco peregrinus) | 3 | Nestling/young: 0 | Adult: 3 | ||||
Outd: 0 | Ind: 0 | Outd: 3 | Ind: 0 | ||||
Red Kite (Milvus milvus) | 3 | Nestling/young: 0 | Adult: 3 | ||||
Outd: 0 | Ind: 0 | Outd: 3 | Ind: 0 | ||||
Common Buzzard (Buteo buteo) | 17 | Nestling/young: 0 | Adult: 17 | ||||
Outd: 0 | Ind: 0 | Outd: 17 | Ind: 0 | ||||
Western Marsh Harrier (Circus aeruginosus) | 1 | Nestling/young: 0 | Adult: 1 | ||||
Outd: 0 | Ind: 0 | Outd: 0 | Ind: 1 | ||||
Short-toed Snake Eagle (Circaetus gallicus) | 3 | Nestling/young: 0 | Adult: 3 | ||||
Outd: 0 | Ind: 0 | Outd: 3 | Ind: 0 | ||||
Pallid Harrier (Circus macrourus) | 1 | Nestling/young: 0 | Adult: 1 | ||||
Outd: 0 | Ind: 0 | Outd: 1 | Ind: 0 | ||||
Nocturnal birds of prey | Strigidae | Little Owl (Athene noctua) | 17 | Nestling/young: 0 | Adult: 17 | ||
Outd: 0 | Ind: 0 | Outd: 17 | Ind: 0 | ||||
Long-eared Owl (Asio otus) | 31 | Nestling/young: 25 | Adult: 6 | ||||
Outd: 21 | Ind: 4 | Outd: 6 | Ind: 0 | ||||
Scops Owl (Otus scops) | 5 | Nestling/young: 0 | Adult: 5 | ||||
Outd: 0 | Ind: 0 | Outd: 3 | Ind: 2 | ||||
Titonidae | Barn Owl (Tyto alba) | 7 | Nestling/young: 0 | Adult: 7 | |||
Outd: 0 | Ind:0 | Outd: 7 | Ind: 0 | ||||
Strictly or prevalently insectivorous | Apodidae | Common Swift (Apus apus) | 18 | Nestling/young: 18 | Adult: 0 | ||
Outd: 0 | Ind: 18 | Outd: 0 | Ind: 0 | ||||
Falconidae | Lesser Kestrel (Falco naumanni) | 30 | Nestling/young: 0 | Adult: 30 | |||
Outd: 0 | Ind: 0 | Outd: 28 | Ind: 2 | ||||
Turdidae | Mistle Thrush (Turdus viscivorus) | 2 | Nestling/young: 0 | Adult: 2 | |||
Outd: 0 | Ind: 0 | Outd: 2 | Ind: 0 | ||||
Omnivorous [31,32] | Corvidae | Eurasian Magpie (Pica pica) | 10 | Nestling/young: 1 | Adult: 9 | ||
Outd: 0 | Ind: 1 | Outd: 4 | Ind: 5 | ||||
Eurasian Jay (Garrulus glandarius) | 5 | Nestling/young: 1 | Adult: 4 | ||||
Outd: 1 | Ind:0 | Outd: 4 | Ind: 0 | ||||
Western Jackdaw (Coloeus monedula) | 1 | Nestling/young: 0 | Adult: 1 | ||||
Outd: 0 | Ind: 0 | Outd: 1 | Ind: 0 | ||||
Hooded Crow (Corvus cornix) | 2 | Nestling/young: 0 | Adult: 2 | ||||
Outd: 0 | Ind: 0 | Outd: 2 | Ind: 0 | ||||
Prevalently piscivorous | Laridae | Yellow-legged Gull (Larus michahellis) | 1 | Nestling/young: 0 | Adult: 1 | ||
Outd: 0 | Ind: 0 | Outd: 1 | Ind: 0 | ||||
Common Gull (Chroicocephalus ridibundus) | 4 | Nestling/young: 0 | Adult: 4 | ||||
Outd: 0 | Ind: 0 | Outd: 3 | Ind: 1 | ||||
Mediterranean Gull (Ichthyaetus melanocephalus) | 2 | Nestling/young: 0 | Adult: 2 | ||||
Outd: 0 | Ind: 0 | Outd: 2 | Ind: 0 | ||||
Ardeidae | Grey or Purple Heron (Ardea cinerea, Ardea purpurea) | 2 | Nestling/young: 0 | Adult: 2 | |||
Outd: 0 | Ind: 0 | Outd: 2 | Ind: 0 | ||||
Little Egret (Egretta garzetta) | 1 | Nestling/young: 0 | Adult: 1 | ||||
Outd: 0 | Ind: 0 | Outd: 1 | Ind: 0 | ||||
Black-crowned Night Heron (Nycticorax nycticorax) | 1 | Nestling/young: 0 | Adult: 1 | ||||
Outd: 0 | Ind: 0 | Outd: 1 | Ind: 0 | ||||
Phoenicopteridae | Greater Flamingo (Phoenicopterus phoenicopterus) | 2 | Nestling/young: 0 | Adult: 2 | |||
Outd: 0 | Ind: 0 | Outd: 2 | Ind: 0 | ||||
Granivorous/ Frugivorous | Psittacidae | Monk Parakeet (Myiopsitta monachus) | 4 | Nestling/young: 4 | Adult: 0 | ||
Outd: 4 | Ind: 0 | Outd: 0 | Ind: 0 | ||||
Aquatic birds | Anatidae | Common Shelduck (Tadorna tadorna) | 1 | Nestling/young: 0 | Adult: 1 | ||
Outd: 0 | Ind: 0 | Outd: 1 | Ind: 0 | ||||
Brent Goose (Branta bernicla) | 2 | Nestling/young: 0 | Adult: 2 | ||||
Outd: 0 | Ind: 0 | Outd: 2 | Ind: 0 | ||||
Eurasian Teal (Anas crecca) | 3 | Nestling/young: 0 | Adult: 3 | ||||
Outd: 0 | Ind: 0 | Outd: 3 | Ind: 0 | ||||
Mute Swan (Cygnus olor) | 4 | Nestling/young: 0 | Adult: 4 | ||||
Outd: 0 | Ind: 0 | Outd: 4 | Ind: 0 | ||||
Mallard (Anas platyrhynchos) | 1 | Nestling/young: 0 | Adult: 1 | ||||
Outd: 0 | Ind: 0 | Outd: 1 | Ind: 0 |
Target Gene | Primers | Sequences | Amplicon Molecular Weight | |
---|---|---|---|---|
Genus Campylobacter | 16S rRNA | MD16 S1 MD16 S2 | 5′ATCTAATGGCTTAACCATTAAAC3′ 5′GGAGGGTAACTAGTTTAGTATT3’ | 857 bp |
C. jejuni | MapA | MD mapA1 MD mapA2 | 5′CTATTTTATTTTTGAGTGCTTGTG3′ 5′GCTTTATTTGCCATTTGTTTTATTA3′ | 598 bp |
C. coli | CeuE | COL3 MDCOL2 | 5′AATTGAAAATTGCTCCAACTATG3′ 5′TGATTTTATTATTTGTAGCAGCG3′ | 462 bp |
Family | Species | N° pos/ N° Tested | % | |
---|---|---|---|---|
Diurnal birds of prey | Falconidae | Eurasian Hobby (Falco subbuteo) | 0/1 | 0 |
Common Kestrel (Falco tinnunculus) | 6/23 | 26.09 | ||
Accipitridae | Eurasian Sparrowhawk (Accipiter nisus) | 0/1 | 0 | |
Peregrine Falcon (Falco peregrinus) | 0/3 | 0 | ||
Red Kite (Milvus milvus) | 0/3 | 0 | ||
Common Buzzard (Buteo buteo) | 0/17 | 0 | ||
Marsh Harrier (Circus aeruginosus) | 0/1 | 0 | ||
Short-toed Snake Eagle (Circaetus gallicus) | 0/3 | 0 | ||
Pallid Harrier (Circus macrourus) | 0/1 | 0 | ||
Nocturnal birds of prey | Strigidae | Little Owl (Athene noctua) | 6/17 | 35.29 |
Long-eared Owl (Asio otus) | 14/31 | 45.16 | ||
Scops Owl (Otus scops) | 2/5 | 40.00 | ||
Tytonidae | Barn Owl (Tyto alba) | 0/7 | 0 | |
Strictly or prevalently insectivorous birds | Apodidae | Common Swift (Apus apus) | 2/18 | 11.11 |
Falconidae | Lesser Kestrel (Falco naumanni) | 5/30 | 16.66 | |
Turdidae | Mistle Thrush (Turdus viscivorus) | 1/2 | 50.00 | |
Omnivorous birds | Corvidae | Eurasian Magpie (Pica pica) | 6/10 | 60.00 |
Eurasian Jay (Garrulus glandarius) | 5/5 | 100 | ||
Western Jackdaw (Coloeus monedula) | 1/1 | 100 | ||
Hooded Crow (Corvus cornix) | ½ | 50.00 | ||
Prevalently piscivorous birds | Laridae | Yellow-legged Gull (Larus michahellis) | 0/1 | 0 |
Common Gull (Chroicocephalus ridibundus) | 2/4 | 50.00 | ||
Mediterranean Gull (Ichthyaetus melanocephalus) | 0/2 | 0 | ||
Ardeidae | Grey or Purple Heron (Ardea cinerea, Ardea purpurea) | 0/2 | 0 | |
Little Egret (Egretta garzetta) | 0/1 | 0 | ||
Black-crowned Night Heron (Nycticorax nycticorax) | 0/1 | 0 | ||
Phoenicopteridae | Greater Flamingo (Phoenicopterus phoenicopterus) | 1/2 | 50.00 | |
Granivorous and frugivorous birds | Psittacidae | Monk Parakeets (Myiopsitta monachus) | 0/4 | 0 |
Aquatic birds | Anatidae | Common Shelduck (Tadorna tadorna) | 0/1 | 0 |
Brent Goose (Branta bernicla) | 0/2 | 0 | ||
Eurasian Teal (Anas crecca) | 0/3 | 0 | ||
Mute Swan (Cygnus olor) | 0/4 | 0 | ||
Mallard (Anas platyrhynchos) | 0/1 | 0 | ||
TOTAL | 52/209 | 24.88 |
Category | N° pos/ N° Tested | % | p-Value | OR | CI95% |
---|---|---|---|---|---|
Diurnal birds of prey | 6/53 | 11.32 | < 0.001 | Reference | |
Nocturnal birds of prey | 22/60 | 36.67 | 4.54 | 1.67–12.31 | |
Strictly or prevalently insectivorous birds | 8/50 | 16.00 | 1.49 | 0.48–4.65 | |
Omnivorous birds | 13/18 | 72.22 | 20.37 | 5.35–77.50 | |
Prevalently piscivorous birds | 3/13 | 23.07 | 2.35 | 0.5–11.02 | |
Granivorous and frugivorous birds | 0/4 | 0 | NA | NA | |
Aquatic birds | 0/11 | 0 | NA | NA |
Indoor Aviary | Outdoor Aviary | |||
---|---|---|---|---|
Species | N° pos/N° Tested | % | N° pos/N° Tested | % |
Long-eared Owl (Asio otus) | 3/4 | 75.00 | 11/27 | 40.74 |
Magpie (Pica pica) | 3/6 | 50.00 | 3/4 | 75.00 |
Lesser Kestrel (Falco naumanni) | 0/2 | 0 | 5/28 | 17.85 |
Common Gull (Chroicocephalus ridibundus) | 1/1 | 100 | 1/3 | 33.33 |
Mistle Thrush (Turdus viscivorus) | 1/1 | 100 | 0/1 | 0 |
TOTAL | 8/14 | 57.14 | 20/63 | 31.74 |
p-value | 0.074 | |||
OR | 2.87 | Reference | ||
CI95% | 0.88–9.37 |
Nestling/Young | Adult | |||
---|---|---|---|---|
Species | N° pos/N° Tested | % | N° pos/N° Tested | % |
Long-eared Owl (Asio otus) | 11/25 | 44.00 | 3/6 | 50.00 |
Common Kestrel (Falco tinnunculus) | 3/7 | 42.86 | 3/16 | 18.75 |
Total | 14/32 | 43.75 | 6/22 | 27.27 |
p-value | 0.218 | |||
OR | 2.07 | Reference | ||
CI95% | 0.64–6.68 |
Species | Average Body Temperature (°C)[Variance] | Average Body Temperature of Positive Birds (°C) | Average Body Temperature of Negative Birds (°C) | N° Pos/N° Tested | Positivity Mean (%) | p-Value | OR | CI95% |
---|---|---|---|---|---|---|---|---|
Little Owl (Athene noctua) | 41.5 [0.23] | 41.2 | 41.9 | 6/17 | 35.29 | 0.003 | 2.73 | 0.68–10.87 |
Long-eared Owl (Asio otus) | 41.8 [0.24] | 41.6 | 42.1 | 14/31 | 45.16 | 4.12 | 1.25–13.57 | |
Barn Owl (Tyto alba) | 39.4 [0.22] | - | 39.4 | 0/7 | 0 | NA | ||
Lesser Kestrel (Falco naumanni) | 40.7 [0.57] | 40.7 | 40.8 | 5/30 | 16.66 | Reference | ||
Common Buzzard (Buteo buteo) | 42.5 [1.26] | - | 42.5 | 0/17 | 0 | NA | ||
Other large diurnal birds of prey * | 42.2 [1.0] | - | 42.2 | 0/8 | 0 | NA | ||
Common Kestrel (Falco tinnunculus) | 41.4 [0.27] | 41.1 | 41.8 | 6/23 | 26.09 | 1.76 | 0.46–6.72 |
N° of Resistant Strains (%) | ||||
---|---|---|---|---|
Antibiotics | C. jejuni (48) | C. coli (3) | Total (51) | |
Macrolides | Azithromycin | 2 (4.2) | 1 (33.3) | 3 (5.9) |
Erythromycin | 1 (2.1) | 0 (0) | 1 (2) | |
Chloramphenicol | 0 (0) | 0 (0) | 0 (0) | |
Quinolones | Ciprofloxacin | 21 (43.7) | 2 (66.7) | 23 (45.1) |
Enrofloxacin | 15 (31.2) | 1 (33.3) | 16 (31.4) | |
Nalidixic Acid | 10 (20.8) | 2 (66.7) | 12 (23.5) | |
Tetracyclines | Tetracycline | 6 (12.5) | 3 (100) | 9 (17.6) |
Aminoglycosides | Gentamicin | 0 (0) | 0 (0) | 0 (0) |
Sulphonamides | Trimethoprim/Sulfamethoxazole | 25 (52.1) | 2 (66.7) | 27 (52.9) |
N° of Drugs | Antibiotics | C. jejuni (48) | C. coli (3) | Total (51) |
---|---|---|---|---|
2 | CIP/ENR | 1 (2.08) | 0 (0) | 1 (1.96) |
CIP/SXT | 3 (6.25) | 0 (0) | 3 (5.88) | |
NA/SXT | 1 (2.08) | 0 (0) | 1 (1.96) | |
TE/SXT | 1 (2.08) | 0 (0) | 1 (1.96) | |
Sub-total | 6 (12.5) | 0 (0) | 6 (11.76) | |
3 | CIP/ENR/NA | 2 (4.17) | 0 (0) | 2 (3.92) |
CIP/ENR/SXT | 6 (12.5) | 0 (0) | 6 (11.76) | |
CIP/NA/SXT | 2 (4.17) | 0 (0) | 2 (3.92) | |
AZM/E/TE | 1 (2.08) | 0 (0) | 1 (1.96) | |
Sub-total | 11 (22.91) | 0 | 11 (21.56) | |
4 | CIP/NA/TE/SXT | 1 (2.08) | 1 (3,33) | 2 (3.92) |
CIP/ENR/NA/SXT | 2 (4.17) | 0 (0) | 2 (3.92) | |
AZM/CIP/ENR/SXT | 1 (2.08) | 0 (0) | 1 (1.96) | |
Sub-total | 4 (8.33) | 1 (3.33) | 5 (9.8) | |
5 | CIP/ENR/NA/TE/SXT | 2 (4.17) | 0 (0) | 2 (3.92) |
6 | AZM/CIP/ENR/NA/TE/SXT | 0 (0) | 1 (3.33) | 1 (1.96) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Casalino, G.; D’Amico, F.; Dinardo, F.R.; Bozzo, G.; Napoletano, V.; Camarda, A.; Bove, A.; Lombardi, R.; D’Onghia, F.P.; Circella, E. Prevalence and Antimicrobial Resistance of Campylobacter jejuni and Campylobacter coli in Wild Birds from a Wildlife Rescue Centre. Animals 2022, 12, 2889. https://doi.org/10.3390/ani12202889
Casalino G, D’Amico F, Dinardo FR, Bozzo G, Napoletano V, Camarda A, Bove A, Lombardi R, D’Onghia FP, Circella E. Prevalence and Antimicrobial Resistance of Campylobacter jejuni and Campylobacter coli in Wild Birds from a Wildlife Rescue Centre. Animals. 2022; 12(20):2889. https://doi.org/10.3390/ani12202889
Chicago/Turabian StyleCasalino, Gaia, Francesco D’Amico, Francesca Rita Dinardo, Giancarlo Bozzo, Valeria Napoletano, Antonio Camarda, Antonella Bove, Roberto Lombardi, Francesco Paolo D’Onghia, and Elena Circella. 2022. "Prevalence and Antimicrobial Resistance of Campylobacter jejuni and Campylobacter coli in Wild Birds from a Wildlife Rescue Centre" Animals 12, no. 20: 2889. https://doi.org/10.3390/ani12202889
APA StyleCasalino, G., D’Amico, F., Dinardo, F. R., Bozzo, G., Napoletano, V., Camarda, A., Bove, A., Lombardi, R., D’Onghia, F. P., & Circella, E. (2022). Prevalence and Antimicrobial Resistance of Campylobacter jejuni and Campylobacter coli in Wild Birds from a Wildlife Rescue Centre. Animals, 12(20), 2889. https://doi.org/10.3390/ani12202889