Characteristics and Expression of circ_003628 and Its Promoted Effect on Proliferation and Differentiation of Skeletal Muscle Satellite Cells in Goats
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Isolation, Purification and Culture of SMSCs
2.3. The Authenticity Verification of circ_003628
2.4. Cellular Localization of circ_003628
2.5. The Tissue Expression of circ_003628 and Its Parent Genes
2.6. Cell Transfection, CCK-8 and EdU Assays
2.7. Induced Differentiation of SMSCs
2.8. Statistical Analysis
3. Results
3.1. Identification and Characteristics of Caprine circ_003628
3.2. The Tissue Expression of circ_003628
3.3. The Expression Levels of circ_003628 and Its Parent Genes in Goat SMSCs
3.4. Circ_003628 Promotes Viability and Proliferation of SMSCs
3.5. Circ_003628 Promotes Differentiation of SMSCs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sanger, H.L.; Klotz, G.; Riesner, D.; Gross, H.J.; Kleinschmidt, A.K. Viroids are single-stranded covalently closed circular RNA molecules existing as highly base-paired rod-like structures. Proc. Natl. Acad. Sci. USA 1976, 73, 3852–3856. [Google Scholar] [CrossRef] [PubMed]
- Wilusz, J.E. A 360° view of circular RNAs: From biogenesis to functions. Wiley Interdiscip. Rev. RNA 2018, 9, e1478. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.L. The biogenesis and emerging roles of circular RNAs. Nat. Rev. Mol. Cell Biol. 2016, 17, 205–211. [Google Scholar] [CrossRef] [PubMed]
- Prats, A.C.; David, F.; Diallo, L.H.; Roussel, E.; Tatin, F.; Garmy-Susini, B.; Lacazette, E. Circular RNA, the key for translation. Int. J. Mol. Sci. 2020, 21, 8591. [Google Scholar] [CrossRef]
- Wang, J.Q.; Zhou, H.T.; Hickford, J.G.H.; Hao, Z.Y.; Gong, H.; Hu, J.; Liu, X.; Li, S.B.; Shen, J.Y.; Ke, N.; et al. Identification and characterization of circular RNAs in mammary gland tissue from sheep at peak lactation and during the nonlactating period. J. Dairy Sci. 2021, 104, 2396–2409. [Google Scholar] [CrossRef]
- Gao, J.N.; Xu, W.H.; Wang, J.X.; Wang, K.; Li, P.F. The role and molecular mechanism of non-coding RNAs in pathological cardiac remodeling. Int. J. Mol. Sci. 2017, 18, 608. [Google Scholar] [CrossRef]
- Hansen, T.B.; Jensen, T.I.; Clausen, B.H.; Bramsen, J.B.; Finsen, B.; Damgaard, C.K.; Kjems, J. Natural RNA circles function as efficient microRNA sponges. Nature 2013, 495, 384–388. [Google Scholar] [CrossRef]
- Kristensen, L.S.; Andersen, M.S.; Stagsted, L.V.W.; Ebbesen, K.K.; Hansen, T.B.; Kjems, J. The biogenesis, biology and characterization of circular RNAs. Nat. Rev. Genet. 2019, 20, 675–691. [Google Scholar] [CrossRef]
- Hsiao, K.Y.; Sun, H.S.; Tsai, S.J. Circular RNA-new member of noncoding RNA with novel functions. Exp. Biol. Med. 2017, 242, 1136–1141. [Google Scholar] [CrossRef]
- Legnini, I.; Di-Timoteo, G.; Rossi, F.; Morlando, M.; Briganti, F.; Sthandier, O.; Fatica, A.; Santini, T.; Andronache, A.; Wade, M.; et al. Circ-ZNF609 is a circular RNA that can be translated and functions in myogenesis. Mol. Cell 2017, 66, 22–37. [Google Scholar] [CrossRef] [Green Version]
- Abdelmohsen, K.; Panda, A.C.; Munk, R.; Grammatikakis, I.; Dudekula, D.B.; De, S.; Kim, J.; Noh, J.H.; Kim, K.M.; Martindale, J.L.; et al. Identification of HuR target circular RNAs uncovers suppression of PABPN1 translation by circPABPN1. RNA Biol. 2017, 14, 361–369. [Google Scholar] [CrossRef] [PubMed]
- Yang, F.; Hu, A.P.; Li, D.; Wang, J.Q.; Guo, Y.H.; Liu, Y.; Li, H.J.; Chen, Y.J.; Wang, X.J.; Huang, K.; et al. Circ-HuR suppresses HuR expression and gastric cancer progression by inhibiting CNBP transactivation. Mol. Cancer 2019, 18, 158. [Google Scholar] [CrossRef] [PubMed]
- Shen, X.X.; Wei, Y.H.; You, G.S.; Liu, W.; Amevor, F.K.; Zhang, Y.; He, H.R.; Ma, M.G.; Zhang, Y.; Li, D.Y.; et al. Circular PPP1R13B RNA promotes chicken skeletal muscle satellite cell proliferation and differentiation via targeting miR-9-5p. Animals 2021, 11, 2396. [Google Scholar] [CrossRef] [PubMed]
- Liu, R.L.; Liu, X.X.; Bai, X.J.; Xiao, C.Z.; Dong, Y.J. Identification and characterization of circRNA in longissimus dorsi of different breeds of cattle. Front. Genet. 2020, 11, 565085. [Google Scholar] [CrossRef] [PubMed]
- Shen, J.Y.; Zhen, H.M.; Li, L.; Zhang, Y.T.; Wang, J.Q.; Hu, J.; Liu, X.; Li, S.B.; Hao, Z.Y.; Li, M.N.; et al. Identification and characterization of circular RNAs in Longissimus dorsi muscle tissue from two goat breeds using RNA-Seq. Mol. Genet. Genom. 2022, 297, 817–831. [Google Scholar] [CrossRef]
- Qi, K.L.; Liu, Y.K.; Li, C.L.; Li, X.J.; Li, X.L.; Wang, K.J.; Qiao, R.M.; Han, X.L. Construction of circRNA-related ceRNA networks in longissimus dorsi muscle of Queshan Black and Large White pigs. Mol. Genet. Genom. 2022, 297, 101–112. [Google Scholar] [CrossRef]
- Bao, G.L.; Zhao, F.F.; Wang, J.Q.; Liu, X.; Hu, J.; Shi, B.G.; Wen, Y.L.; Zhao, L.; Luo, Y.Z.; Li, S.B. Characterization of the circRNA-miRNA-mRNA network to reveal the potential functional ceRNAs associated with dynamic changes in the meat quality of the Longissimus thoracis muscle in Tibetan sheep at different growth stages. Front. Vet. Sci. 2022, 9, 803758. [Google Scholar] [CrossRef]
- Lei, Q.X.; Hu, X.; Han, H.X.; Wang, J.; Liu, W.; Zhou, Y.; Cao, D.G.; Li, F.W.; Liu, J. Integrative analysis of circRNA, miRNA, and mRNA profiles to reveal ceRNA regulation in chicken muscle development from the embryonic to post-hatching periods. BMC Genom. 2022, 23, 342. [Google Scholar] [CrossRef]
- Zhang, Z.; Fan, Y.X.; Deng, K.P.; Liang, Y.X.; Zhang, G.M.; Gao, X.X.; El-Samahy, M.A.; Zhang, Y.L.; Deng, M.T.; Wang, F. Circular RNA circUSP13 sponges miR-29c to promote differentiation and inhibit apoptosis of goat myoblasts by targeting IGF1. FASEB J. 2022, 36, e22097. [Google Scholar] [CrossRef]
- Kyei, B.; Odame, E.; Li, L.; Yang, L.; Zhan, S.Y.; Li, J.T.; Chen, Y.; Dai, D.H.; Cao, J.X.; Guo, J.Z.; et al. Knockdown of CDR1as decreases differentiation of goat skeletal muscle satellite cells via upregulating miR-27a-3p to inhibit ANGPT1. Genes 2022, 13, 663. [Google Scholar] [CrossRef]
- Ling, Y.H.; Sui, M.H.; Zheng, Q.; Wang, K.Y.; Wu, H.; Li, W.Y.; Liu, Y.; Chu, M.X.; Fang, F.G.; Xu, L.N. MiR-27b regulates myogenic proliferation and differentiation by targeting Pax3 in goat. Sci. Rep. 2018, 8, 3909. [Google Scholar] [CrossRef] [PubMed]
- Sui, M.H.; Zheng, Q.; Wu, H.; Zhu, L.; Ling, Y.H.; Wang, L.J.; Fang, F.G.; Liu, Y.; Zhang, Z.J.; Chu, M.X.; et al. The expression and regulation of miR-1 in goat skeletal muscle and satellite cell during muscle growth and development. Anim. Biotechnol. 2020, 31, 455–462. [Google Scholar] [CrossRef] [PubMed]
- Feng, X.; Naz, F.; Juan, A.H.; Dell’Orso, S.; Sartorelli, V. Identification of skeletal muscle satellite cells by immunofluorescence with Pax7 and Laminin Antibodies. J. Vis. Exp. 2018, 134, 57212. [Google Scholar] [CrossRef] [PubMed]
- Shen, X.X.; Liu, Z.H.; Cao, X.N.; He, H.R.; Han, S.S.; Chen, Y.Q.; Cui, C.; Zhao, J.; Li, D.Y.; Wang, Y.; et al. Circular RNA profiling identified an abundant circular RNA circTMTC1 that inhibits chicken skeletal muscle satellite cell differentiation by sponging miR-128-3p. Int. J. Biol. Sci. 2019, 15, 2265–2281. [Google Scholar] [CrossRef]
- Li, H.; Wei, X.F.; Yang, J.M.; Dong, D.; Hao, D.; Huang, Y.Z.; Lan, X.Y.; Plath, M.; Lei, C.Z.; Ma, Y.; et al. CircFGFR4 promotes differentiation of myoblasts via binding miR-107 to relieve its inhibition of Wnt3a. Mol. Ther. Nucleic Acids 2018, 11, 272–283. [Google Scholar]
- Chen, J.F.; Mandel, E.M.; Thomson, J.M.; Wu, Q.; Callis, T.E.; Hammond, S.M.; Conlon, F.L.; Wang, D.Z. The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. Nat. Genet. 2006, 38, 228–233. [Google Scholar] [CrossRef]
- Wang, X.G.; Cao, X.K.; Dong, D.; Shen, X.M.; Cheng, J.; Jiang, R.; Yang, Z.X.; Peng, S.J.; Huang, Y.Z.; Lan, X.Y.; et al. Circular RNA TTN acts as a miR-432 sponge to facilitate proliferation and differentiation of myoblasts via the IGF2/PI3K/AKT signaling pathway. Mol. Ther. Nucleic Acids 2019, 18, 966–980. [Google Scholar] [CrossRef]
- Wu, X.M.; Zhen, H.M.; Liu, Y.; Li, L.; Luo, Y.Z.; Liu, X.; Li, S.B.; Hao, Z.Y.; Li, M.N.; Hu, L.Y.; et al. Tissue-specific expression of circ_015343 and its inhibitory effect on mammary epithelial cells in sheep. Front. Vet. Sci. 2022, 9, 919162. [Google Scholar] [CrossRef]
- Zhang, R.M.; Pan, Y.; Zou, C.X.; An, Q.; Cheng, J.R.; Li, P.J.; Zheng, Z.H.; Pan, Y.; Feng, W.Y.; Yang, S.F.; et al. CircUBE2Q2 promotes differentiation of cattle muscle stem cells and is a potential regulatory molecule of skeletal muscle development. BMC Genom. 2022, 23, 267. [Google Scholar] [CrossRef]
- Schiaffino, S. Muscle fiber type diversity revealed by anti-myosin heavy chain antibodies. FEBS J. 2018, 285, 3688–3694. [Google Scholar] [CrossRef]
- Weiss, A.; Leinwand, L.A. The mammalian myosin heavy chain gene family. Ann. Rev. Cell Dev. Biol. 1996, 12, 417–439. [Google Scholar] [CrossRef]
- Qian, L.L.; Xie, J.Y.; Gao, T.; Cai, C.B.; Jiang, S.W.; Bi, H.F.; Xie, S.S.; Cui, W.T. Targeted myostatin loss-of-function mutation increases type II muscle fibers in Meishan pigs. J. Integr. Agric. 2022, 21, 188–198. [Google Scholar] [CrossRef]
- Brown, D.M.; Parr, T.; Brameld, J.M. Myosin heavy chain mRNA isoforms are expressed in two distinct cohorts during C2C12 myogenesis. J. Muscle Res. Cell Motil. 2012, 32, 383–390. [Google Scholar] [CrossRef]
- Wimmers, K.; Ngu, N.T.; Jennen, D.G.; Tesfaye, D.; Murani, E.; Schellander, K.; Ponsuksili, S. Relationship between myosin heavy chain isoform expression and muscling in several diverse pig breeds. J. Anim. Sci. 2008, 86, 795–803. [Google Scholar] [CrossRef] [PubMed]
- Wei, X.F.; Li, H.; Yang, J.M.; Hao, D.; Dong, D.; Huang, Y.Z.; Lan, X.Y.; Plath, M.; Lei, C.Z.; Lin, F.P.; et al. Circular RNA profiling reveals an abundant circLMO7 that regulates myoblasts differentiation and survival by sponging miR-378a-3p. Cell Death Dis. 2017, 8, e3153. [Google Scholar] [CrossRef] [PubMed]
- Blocquiaux, S.; Gorski, T.; Van Roie, E.; Ramaekers, M.; Van Thienen, R.; Nielens, H.; Delecluse, C.; De Bock, K.; Thomis, M. The effect of resistance training, detraining and retraining on muscle strength and power, myofibre size, satellite cells and myonuclei in older men. Exp. Gerontol. 2020, 133, 110860. [Google Scholar] [CrossRef]
- Li, Z.Y.; Huang, C.; Bao, C.; Chen, L.; Lin, M.; Wang, X.L.; Zhong, G.L.; Yu, B.; Hu, W.C.; Dai, L.M.; et al. Exon-intron circular RNAs regulate transcription in the nucleus. Nat. Struct. Mol. Biol. 2015, 22, 256–264. [Google Scholar] [CrossRef]
- Tedesco, F.S.; Dellavalle, A.; Diaz-Manera, J.; Messina, G.; Cossu, G. Repairing skeletal muscle: Regenerative potential of skeletal muscle stem cells. J. Clin. Investig. 2010, 120, 11–19. [Google Scholar] [CrossRef]
- Dumont, N.A.; Bentzinger, C.F.; Sincennes, M.C.; Rudnicki, M.A. Satellite cells and skeletal muscle regeneration. Compr. Physiol. 2015, 5, 1027–1059. [Google Scholar]
- Nguyen, M.T.; Min, K.H.; Lee, W. MiR-96-5p Induced by palmitic acid suppresses the myogenic differentiation of C2C12 myoblasts by targeting FHL1. Int. J. Mol. Sci. 2020, 21, 9445. [Google Scholar] [CrossRef]
- Joung, H.; Kwon, S.; Kim, K.H.; Lee, Y.G.; Shin, S.; Kwon, D.H.; Lee, Y.U.; Kook, T.; Choe, N.; Kim, J.C.; et al. Sumoylation of histone deacetylase 1 regulates MyoD signaling during myogenesis. Exp. Mol. Med. 2018, 50, e427. [Google Scholar] [CrossRef]
- Berri, C.; Le Bihan-Duval, E.; Debut, M.; Santé-Lhoutellier, V.; Baéza, E.; Gigaud, V.; Jégo, Y.; Duclos, M.J. Consequence of muscle hypertrophy on characteristics of pectoralis major muscle and breast meat quality of broiler chickens. J. Anim. Sci. 2007, 85, 2005–2011. [Google Scholar] [CrossRef] [Green Version]
- Kirby, T.J.; Patel, R.M.; McClintock, T.S.; Dupont-Versteegden, E.E.; Peterson, C.A.; McCarthy, J.J. Myonuclear transcription is responsive to mechanical load and DNA content but uncoupled from cell size during hypertrophy. Mol. Biol. Cell 2016, 27, 788–798. [Google Scholar] [CrossRef]
- Egner, I.M.; Bruusgaard, J.C.; Gundersen, K. Satellite cell depletion prevents fiber hypertrophy in skeletal muscle. Development 2016, 143, 2898–2906. [Google Scholar] [CrossRef]
- Shen, J.Y.; Hao, Z.Y.; Luo, Y.Z.; Zhen, H.M.; Liu, Y.; Wang, J.Q.; Hu, J.; Liu, X.; Li, S.B.; Zhao, Z.D.; et al. Deep small RNA sequencing reveals important miRNAs related to muscle development and intramuscular fat deposition in Longissimus dorsi muscle from different goat breeds. Front. Vet. Sci. 2022, 9, 911166. [Google Scholar] [CrossRef]
- Lyu, M.; Wang, X.; Meng, X.Y.; Qian, H.G.; Li, Q.; Ma, B.X.; Zhang, Z.Y.; Xu, K. Chi-miR-487b-3p inhibits goat myoblast proliferation and differentiation by targeting IRS1 through the IRS1/PI3K/Akt signaling pathway. Int. J. Mol. Sci. 2021, 23, 115. [Google Scholar] [CrossRef]
- Winbanks, C.E.; Wang, B.; Beyer, C.; Koh, P.; White, L.; Kantharidis, P.; Gregorevic, P. TGF-beta regulates miR-206 and miR-29 to control myogenic differentiation through regulation of HDAC4. J. Biol. Chem. 2011, 286, 13805–13814. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.; Tan, J.Y.; Qi, Q.; Yang, L.Z.; Wang, Y.H.; Zhang, C.L.; Hu, L.Y.; Chen, H.; Fang, X.T. MiR-487b-3p suppresses the proliferation and differentiation of myoblasts by targeting IRS1 in skeletal muscle myogenesis. Int. J. Biol. Sci. 2018, 14, 760–774. [Google Scholar]
Name * | Forward (5′ to 3′) | Reverse (5′ to 3′) | Amplicon Size (bp) |
---|---|---|---|
Circ_003628 | GACTGTCTCCAAAGCCAAGG | CTGGTAGATGCCCACCTGAT | 162 |
MYH1 | AAGGGACTGTCCAGAGCAGA | CACAGAAGAGGCCCGAGTAG | 225 |
MYH4 | CACCCTGGAGGACCAACTGA | TTGCCTCGGGAAAGCTGAGAAA | 165 |
GAPDH | ACACTGAGGACCAGGTTGTG | GACAAAGTGGTCGTTGAGGG | 98 |
U6 | GGAACGATACAGAGAAGATTAGC | TGGAACGCTTCACGAATTTGCG | 68 |
β-actin | AGCCTTCCTTCCTGGGCATGGA | GGACAGCACCGTGTTGGCGTAA | 113 |
Pax7 | ACGAAGGGGACAAGAAGGAG | GGTAGTGGGTCCTCTCGAAG | 213 |
CDK2 | GACCAGCTCTTCCGGATCTT | ACAAGCTCCGTCCATCTTCA | 160 |
CDK4 | ACTTTGTGGCCCTCAAGAGT | CCTGAGGTCTTGGTCCACAT | 215 |
CyclinD1 | CGTCCATGCGGAAGATCGT | ACAGGAAGCGGTCCAGGTAGT | 108 |
p27 | CGGCGGTGCCTTTACTT | GCAGGTCGCTTCCTTATCC | 127 |
β-tubulin | AGCGTATCTCAGAGCAGTTC | AATCCTCTTCCTCTTCTGCG | 171 |
MyHC | CCACATCTTCTCCATCTCTG | GGTTCCTCCTTCTTCTTCTC | 171 |
TGFβ1 | CACGTGGAGCTGTACCAGAA | GCGAAAGCCCTCTATTTCCT | 156 |
MyoD | GTGCAAACGCAAGACGACTA | GCTGGTTTGGGTTGCTAGAC | 128 |
MEF2C | ATCCTGATGCAGACGATTCAG | GGTGGAACAGCACACAATCTT | 115 |
MyoG | CGTGGGCGTGTAAGGTGT | GGCGCTCTATGTACTGGATGG | 195 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhen, H.; Shen, J.; Wang, J.; Luo, Y.; Hu, J.; Liu, X.; Li, S.; Hao, Z.; Li, M.; Shi, B.; et al. Characteristics and Expression of circ_003628 and Its Promoted Effect on Proliferation and Differentiation of Skeletal Muscle Satellite Cells in Goats. Animals 2022, 12, 2524. https://doi.org/10.3390/ani12192524
Zhen H, Shen J, Wang J, Luo Y, Hu J, Liu X, Li S, Hao Z, Li M, Shi B, et al. Characteristics and Expression of circ_003628 and Its Promoted Effect on Proliferation and Differentiation of Skeletal Muscle Satellite Cells in Goats. Animals. 2022; 12(19):2524. https://doi.org/10.3390/ani12192524
Chicago/Turabian StyleZhen, Huimin, Jiyuan Shen, Jiqing Wang, Yuzhu Luo, Jiang Hu, Xiu Liu, Shaobin Li, Zhiyun Hao, Mingna Li, Bingang Shi, and et al. 2022. "Characteristics and Expression of circ_003628 and Its Promoted Effect on Proliferation and Differentiation of Skeletal Muscle Satellite Cells in Goats" Animals 12, no. 19: 2524. https://doi.org/10.3390/ani12192524