Next Article in Journal
Effect of Lactobacillus reuteri S5 Intervention on Intestinal Microbiota Composition of Chickens Challenged with Salmonella enteritidis
Previous Article in Journal
Metabolomic Profiles in Starved Light Breed Horses during the Refeeding Process
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 12
Issue 19
10.3390/ani12192517
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Improvement in the Immunity- and Vitamin D3-Activity-Related Gene Expression of Coccidiosis-Challenged Ross 708 Broilers in Response to the In Ovo Injection of 25-Hydroxyvitamin D3  †

by
Seyed Abolghasem Fatemi
1,*,
Kenneth S. Macklin
2,
Li Zhang
1,
Ayoub Mousstaaid
1,
Sabin Poudel
1,
Ishab Poudel
1 and
Edgar David Peebles
1
1
Department of Poultry Science, Mississippi State University, Mississippi State, MS 39762, USA
2
Department of Poultry Science, College of Agriculture, Auburn University, Auburn, AL 36849, USA
*
Author to whom correspondence should be addressed.
†
This publication is a contribution of the Mississippi Agriculture and Forestry Experiment Station. This material is based upon work that is supported by the National Institute of Food and Agriculture, U.S. Department of Agriculture, Hatch project under accession number 1011797. Use of trade names in this publication does not imply endorsement by Mississippi Agricultural and Forestry Experiment Station of these products, nor similar ones not mentioned.
Animals 2022, 12(19), 2517; https://doi.org/10.3390/ani12192517
Submission received: 30 July 2022 / Revised: 30 August 2022 / Accepted: 16 September 2022 / Published: 22 September 2022
(This article belongs to the Section Poultry)
Review Reports Versions Notes

Abstract

:

Simple Summary

Coccidiosis is still considered one of the main diseases affecting the performance and health of poultry reared under intensive production systems. Vitamin D3 sources have been shown to reduce the negative effects of a coccidiosis infection with a subsequent improvement in live performance and intestinal immunity. Therefore, the aim of the current research was to explore molecular mechanisms that may play role in an improvement in immunity and vitamin D activity in response to the in ovo injection of vitamin D3 (D3) and 25-hydroxyvitamin D3 (25OHD3) alone or in combination in broilers subjected to a coccidiosis infection. In this study, it was shown that the expression of genes linked to an anti-inflammatory response increased and a pro-inflammatory response decreased in the jejunum of 28-day-old broilers (2 weeks after coccidiosis infection) after an in ovo injection of 2.4 μg of 25OHD3. Additionally, the in ovo administration of 2.4 μg of 25OHD3 increased the expression of genes linked to D3 function. In conclusion, the in ovo administration of 2.4 μg of 25OHD3 at 18 days of incubation can improve the immunity as well as the D3 activity of broilers challenged with coccidiosis.

Abstract

Effects of the in ovo administration of two vitamin D3 sources (vitamin D3 (D3) and 25-hydroxyvitamin D3 (25OHD3)) on the expression of D3 activity- and immunity-related genes in broilers subjected to a coccidiosis infection were investigated. At 18 d of incubation (doi), five in ovo injection treatments were administrated to live embryonated Ross 708 broiler hatching eggs: non-injected (1) and diluent-injected (2) controls, or diluent injection containing 2.4 μg of D3 (3) or 2.4 μg of 25OHD3 (4), or their combination (5). Birds in the in ovo-injected treatments were challenged at 14 d of age (doa) with a 20× dosage of a live coccidial vaccine. At 14 and 28 doa, the expression of eight immunity-related genes (IL-2, IL-6, IL-10, TLR-4, TLR-15, MyD88, TGF-β4, and IFN-γ) and four D3 activity-related genes (1α-hydroxylase, 25-hydroxylase, 24-hydroxylase, and VDR) in the jejunum of one bird in each treatment–replicate group were evaluated. No significant treatment effects were observed for any of the genes before challenge. However, at 2 weeks post-challenge, the expression of 1α-hydroxylase, TGF-β4, and IL-10 increased in birds that received 25OHD3 alone in comparison to all the other in ovo-injected treatment groups. Additionally, the expression of 24-hydroxylase and IL-6 decreased in birds that received 25OHD3 in comparison to those injected with diluent or D3 alone. It was concluded that the in ovo injection of 2.4 μg of 25OHD3 may improve the intestinal immunity as well as the activity of D3 in Ross 708 broilers subjected to a coccidiosis challenge.

1. Introduction

Cholecalciferol or vitamin D3 (D3) is a common supplemental source of vitamin D in poultry diets. Vitamin D3 is hydroxylated twice to become the functionally active form of vitamin D. Vitamin D3 is converted to 25-hydroxycholecalciferol (25OHD3) by the action of 25-hydroxylase in the liver and is then hydroxylated by renal cells to 1,25-dihydroxylcholecalciferol [1,25-(OH)2D3] by 1 α-hydroxylase [1,2]. In the chicken, the conversion of 25OHD3 to active form (1,25-(OH)2D3) is tightly regulated by several factors including vitamin D receptor (VDR) activity, 1,25-(OH)2D3 concentration, and calcium serum levels [3,4]. In comparison to D3 at the same level of inclusion, dietary supplementation of 25OHD3 more strongly enhances broiler breast meat yield [5,6], protein synthesis rate [6,7], and the density of satellite cells in breast muscle [7]. Additionally, 25OHD3 has been shown to more effectively reduce the inflammatory response and increase the humoral immunity of broiler chickens that were challenged with pathogens [8,9]. The expression of 1 α-hydroxylase in the livers of lipopolysaccharide-injected birds increased when they were fed 25OHD3, but not when they were fed D3 [10]. This may result in increased 1,25-(OH)2D3 levels in the liver and the suppression of the inflammatory response in 25OHD3-fed birds [11]. The expression of 1 α-hydroxylase and VDR occurs in the macrophages and in the livers of chickens [12,13]. Therefore, increased biosynthesis of 1,25-(OH)2D3 from 25OHD3 can increase the expression of 1 α-hydroxylase and subsequently increase the expression of VDR [13].
In ovo injection techniques in broilers have emerged to allow for the direct administration of particular nutrients or vaccines to embryos, which provides an early stimulation of their immune responses [14]. Additionally, in ovo injection provides a cost-effective and uniform delivery of vaccines with limited contamination issues [15]. Improvements in chicken embryonic and post-hatch development and immune status in response to the in ovo injection of various injected materials, including vitamins, have been observed in previous studies. These observed improvements have been particularly evident in poultry reared under intensive production conditions [16,17]. It is well documented that the in ovo injection of 0.6 to 2.4 μg of 25OHD3 can increase broiler breast meat yield [18,19,20] and live performance [18,19,20]. It can also improve the characteristics of hatchling [21], bone quality [22,23], immunity [18,24,25], and small intestine morphology [25] of broilers not challenged with pathogens. Furthermore, the in ovo injection of 2.4 μg of 25OHD3 has been shown to increase BWG and breast meat yield [26], and to improve the small intestine morphology and immunity [27] of broilers subjected to a coccidiosis infection. However, the molecular mechanisms by which the in ovo injection of vitamin D3 sources affect chicken intestinal histomorphology, muscle formation, or immunity have not been previously investigated. Therefore, the objective of this study was to investigate the impacts of the in ovo injection of D3 and 25OHD3, alone or in combination on the expression of genes linked to immunity and D3 activity in Ross 708 broilers subjected to a coccidiosis infection.

2. Materials and Methods

2.1. Experimental Design, Egg Incubation, and Coccidial Infection

Fifty Ross 708 broiler hatching eggs were randomly set in each of 5 treatment groups in each of 6 replicate trays (1500 total eggs) in a Chick Master Incubator (Chick Master Incubator Company, Medina, OH, USA). The conditions and arrangement of the treatment-replicate groups of eggs in the incubator were as described by Fatemi et al. [26]. In a previous companion study [26] in which the same incubation regimens were used, no significant treatment effects were found for percentage egg weight loss from 0 to 18 day (d) of incubation (doi), indicating uniform incubational conditions for all prespecified in ovo injection treatment groups. At 18 doi, a Zoetis Inovoject m (Zoetis Animal Health, Research Triangle Park, NC, USA) multi-egg in ovo injection machine was used to deliver a 50 μL solution volume into each egg. The in ovo injection treatments were: non-injected (1) and diluent injected (2) controls, or diluent injection containing 2.4 μg D3 (3) or 2.4 μg 25OHD3 (4), or their combination (5). All in ovo injection solutions were freshly prepared in accordance to the procedure described by Fatemi et al. [21,22]. At hatch, chicks belonging to the same treatment group across replicate hatching baskets were pooled prior to placement. A total of 20 birds from each pooled treatment group were randomly placed in each of 2 separate isolation rooms containing wire-floored battery cages (0.76 m × 0.46 m (0.35 m2). Four birds were placed in each of 8 replicate cages in each of 5 in ovo injection treatment groups (4 birds × 8 replicates × 5 treatments = 160 total birds in each room). The replicate cages for each of the in ovo injection treatment groups were randomly arranged within each isolation room and room was considered as a blocking factor. A Mississippi State University basal corn-soybean diet as described by Fatemi et al. [18,19,26] was used throughout the 41 d of age (doa) study period (Fatemi et al., 2021 [18,19,26]. A coccidial challenge infection was performed at 14 doa according to the method described by Fatemi et al. [26] and Poudel et al. [28,29]. Chicks were left unchallenged in the non-injected treatment group.

2.2. Tissue Collection, Total RNA Isolation, Reverse Transcription, and Quantitative Real-Time PCR

At 14 and 18 d of age (doa), one bird in each room from each treatment-replicate cage was randomly selected for sampling. Approximately 10 to 20 g of the medial side of each jejunum sample was immediately frozen in liquid nitrogen and stored at −80 °C. Total RNA was isolated using the TRIzol® procedure (Invitrogen, Carlsbad, CA, USA) using 1 mL TRIzol® to every 30 mg of tissue according to the manufacturer’s recommendations. RNA quantification was performed using A NanoDrop 2000 spectrophotometer (Thermo Scientific, Wilmington, NC, USA) and agarose electrophoresis. RNA samples were stored at −80 °C until cDNA synthesis. cDNA synthesis was performed using 200 ng of each total RNA sample according to High Capacity cDNA Reverse Transcription Kit protocol (Applied Biosystems, Foster City, CA, USA) [30]. The resulting cDNA was stored at −20 °C. RT-qPCRreactions were conducted in a 20 μL reaction system containing 10 μL of SYBR Green premix, 1.2 μL of forward primer (10 μM), 1.2 μL of reverse primer (10 μM), 2.0 μL of 5× diluted cDNA, and 5.6 μL of RNase-free water. The program was set at 95 °C for 60 s, followed by 40 cycles of 95 °C for 10 s, and 60 °C for 30 s. Melting curve analysis was performed to analyze the specificity of the primers according to protocol described by Poudel et al. [31]. In total, two endogenous or “housekeeping” genes, plus 20 target genes associated with immune response and D3-related activity were identified for RT-qPCR (Table 1). The forward and reverse primers of house-keeping genes (glyceraldehyde-3-phosphate dehydrogenase [GAPDH] and 18S ribosomal RNA [18S]); genes related to immunity including interleukin (IL)-2, IL-6, IL-10, interferon gamma (IFN-γ), myeloid differentiation factor 88 (MyD88), transforming growth factor beta 4 (TGF-β4), Toll-like receptor (TLR)-4, and TLR-15; and genes linked to vitamin D activity including 1α-hydroxylase, 24-hydroxylase, 25-hydroxylase, and VDR were designed according to the procedure described by Fatemi [31] and Poudel et al. [32]. NormFinder software version 20 was used to normalize the target gene data [33], and the normalization suitability of the expression of GAPDH and 18S genes were tested. The GAPDH was an endogenous gene that was most suitable for normalization of the data for the target genes. The fold-change differences were calculated according to the method described by Livak and Schmittgen [34].

2.3. Statistical Analysis

Each wire-floored battery cage served as an experimental unit, with all 5 treatments randomly represented in each of 8 replicate cages. A completely randomized experimental design was employed within each room and room served as a blocking factor. A non-injected treatment group was kept in a separate part of the battery cages to eliminate its exposure to coccidial oocysts. Furthermore, a treatment group of birds that have received an in ovo injection solution as well as a coccidial challenge were included. However, in the analysis of effects of coccidial challenge on 28 doa, the non-injected treatment was not included. All house-keeping and target genes were tested for normality using PROC UNIVARIATE and were determined as being normally distributed. Prior to (14 doa) and 2 wk after (28 doa) coccidiosis infection, all gene expression data between and across in ovo injection treatment were analyzed by one-way ANOVA using the procedure for linear mixed models (PROC GLIMMIX) of SAS©, version 9.4 (SAS Institute Inc., Cary, NC, USA). Differences were deemed significant at p ≤ 0.05, and Tukey’s least square means comparison was used for means separation [37].

3. Results

No significant treatment differences were observed for the immunity- and vitamin D3 activity-related genes at 14 doa (Table 2 and Table 3). However, there were significant treatment effects for both genes involved in the immunity and vitamin D3 functions of the broilers at 28 doa (Table 2 and Table 3). The in ovo injection of D3 significantly increased the expression of IL-6 at 28 doa in comparison to the diluent and 25OHD3 injection treatment group. Conversely, the expression of IL-10 was increased in the 25OHD3 alone injection treatment group in comparison to that of all other injection treatment groups, and the expression of IL-10 was higher in the D3 + 25OHD3 treatment as compared to the diluent-injected and D3 alone treatment groups. The expression of TGF-β4 was also higher in the 25OHD3 alone injection treatment when compared to all other injection treatment groups (Table 2). Moreover, the in ovo injection of 25OHD3 resulted in a higher expression of 1α-hydroxylase as compared to all other in ovo treatments and resulted in a numerically (p = 0.072) lower expression of 24-hydroxylase as compared to the D3 + 25OHD3 and D3 alone treatment groups at 2 wk post infection (Table 3). Across in ovo treatment (Table 4), the expressions of IL-2, IL-6, IL-10, TGF-β4, TLR-4, 1α-hydroxylase, and VDR were significantly higher at 2 wk post-infection (28 doa) in comparison to their expression levels before coccidiosis infection (14 doa).

4. Discussion

The objective of this study was to determine the effects of in ovo administration of D3 and 25OHD3 on the gene expression of broilers subjected to a coccidiosis infection. It is well documented that a coccidial infection generates a chronic intestinal infection as a result of a robust up-regulation of pro-inflammatory cytokines linked to the innate [30,38] or adaptive [8,10,39] immune systems. Among genes that have been reported to be expressed in association with innate immunity responses in chickens infected by coccidiosis are TLR-4, TLR-15, MyD88, and nuclear factor kappa B (NF-κB). Zhou et al. [30] reported that broilers subjected to an E. tenella infection had a higher level of expression of the TLR-4 and TLR15 genes. In addition, layers challenged with E. tenella have been shown to exhibit a 2 fold increase in the up-regulation of TLR15, NF-κB, and MyD88 gene expression in their ceca between 4 and 24 h post infection [38]. Receptors such as TLR are capable of recognizing conserved pathogen-associated molecular patterns [40]. These TLR are present in all the developmental stages of the life cycle of various Eimeria species [41]. The MyD88 protein is a downstream adaptor for TLR and is curial for many of the functions of TLRs. Intrinsic to those functions, LR-MyD88 signaling has been shown to trigger inflammatory responses to interior pathogens [42]. In the current study, none of the genes associated with innate immunity were differentially expressed, while the expression of those genes linked to adaptive immunity were altered by in ovo injection treatment. The findings in the current study showed that the in ovo injection of D3 alone or in combination with 25OHD3 did not alter the expression of genes that were linked to either an immune response or to vitamin D activity. However, in ovo administration of 2.4 μg of 25OHD3 alone increased the expression of anti-inflammatory response genes (IL-10 and TGF-β4), and deceased the expression of a pro-inflammatory response gene (IL-6) during the coccidiosis infection. In comparison to D3 at the same level of supplemental dietary inclusion, it has likewise been shown that the expression of IL-10 increased and IL-1β decreased in response to 2760 IU/kg of 25OHD3 in broilers challenged with coccidiosis [8]. Additionally, dietary 25OHD3 at 100 μg/kg increased CD4+CD25+ cells and deceased CD8+CD25+ cells in coccidiosis-infected broilers [10] and turkeys [39]. It is well documented that the CD4+CD25+ cells [37,41], IL-10 [43,44] and TGF-β [45] are associated with regulatory T cell (Tregs) formation that is facilitated by an up-regulation of the expression of the aforementioned genes. The Tregs are immunity suppression cells that act to inhibit T cell proliferation and cytokine production [46]. Thus, these results indicate that dietary 25OHD3 induces an adaptive immune response, and more specifically the activation of an anti-inflammatory response during systemic and chronic infections including coccidiosis. The down-regulation of an inflammatory response in the 25OHD3 alone in ovo-injected treatment group could be due to the up-regulation of genes linked to vitamin D3 activity. When compared to the diluent and D3 alone injected treatment groups in their study, the expression of 1α-hydroxylase increased, and 24-hydroxylase decreased in response to the 25OHD3 alone treatment. The conversion of 25OHD3 to the active form of vitamin D (1,25-(OH)2D3) is facilitated by 1α-hydroxylase in the kidney [12], intestine [12], breast and thigh muscles [12], and immune cells including macrophages and T-cells [10]. Moreover, by the action of 24-hydroxylase, 25OHD3 can also be converted to the inactive form of vitamin D (24,25-(OH)2D3) in many cells in which there are vitamin D receptors. Therefore, an increase in the expression of 1α-hydroxylase or a decrease in the expression of 24-hydroxylase may directly affect vitamin D3 activity. In previous companion studies, these current treatments employed were also investigated. In comparison the injection of diluent or D3 alone, the in ovo administration of 2.4 μg of 25OHD3 improved BW gain from 0 to 28 doa [26], meat yield [26], small intestine morphology [27], and the inflammatory response [27] of broilers subjected to a coccidial infection. Therefore, these morphological and serological improvements observed in previous studies may be due to the stimulation of genes linked to vitamin D activity as well as those eliciting an anti-inflammatory response during a coccidiosis challenge.
Across in ovo treatment, the expression of major vitamin D activity genes including VDR and 1α-hydroxylase, that converts 25OHD3 to 1,25-(OH)2D3, was significantly increased in the birds subjected to a coccidial infection. The 25OHD3 interacts with VDR in various organs and tissues such as the intestines [4,47], muscle cells, bone, kidney, parathyroid gland, pancreas, pituitary, chorioallantoic membrane, and the egg shell gland [48,49]. However, its efficacy is associated with VDR and 1α-hydroxylase, that converts 25OHD3 to 1,25-(OH)2D3 [4]. It is well-documented that hydroxylation in the liver is reduced when chickens are subjected to stressful conditions [50], mycotoxicosis [51], and E-coli infections [52]. Additionally, hydroxylation in the liver is decreased during severe coccidiosis infections [53]. Thus, these results indicate that the intestinal absorption of D3 and its functionality may be reduced during a coccidiosis infection, which may subsequently lead to the additional use of supplemental dietary D3 or other D3 sources, such as 25OHD3 to support of vitamin D function. Furthermore, the expression of IL-2, IL-6, and TLR-4 involved in pro-inflammatory responses significantly increased during the coccidiosis infection in this study. Several studies have reported the elevation in the expression of IL-2 and IL-6 during various avian Emeria infections [54,55,56]. Likewise, TLR-4 categorized as a pathogenic infection indicator, has been shown to be up-regulated during an E. tenella infection [30]. Therefore, the broilers in the current study that experienced a successful Emeria infection exhibited a measurable immune reaction.

5. Conclusions

In conclusion, the aim in the current research was to identify the genes that are linked to an immune response and to vitamin D activity in the jejunum of the small intestine of broilers subjected to an Emeria infection after having received individual or combinational in ovo injection of 2 vitamin D3 sources. Beside upon the findings in this study, it is suggested that the coccidiosis infection had significant effects on the expression of genes involved in vitamin D, function (1α-hydroxylase and VDR), and a pro-inflammatory response (IL-2, IL-6 and TLR-4). Furthermore, the in ovo administration of 2.4 μL of 25OHD3 resulted in the up-regulation of genes linked to an anti-inflammatory response (IL-10 and TGF-β4). Moreover, the expression of 1α-hydroxylase increased and 24-hydroxylase deceased in response to the in ovo injection of 2.4 μL of 25OHD3. However, the other in ovo-injection treatments investigated in this study did not display significant effects on the expression of genes associated with either an inflammatory reaction or to vitamin D function. These results, therefore, demonstrate that the amniotic in ovo administration of 25OHD3 at 18 doi may more quickly ameliorate the negative effects of a coccidiosis infection by means of its effects on intestinal vitamin D activity or an inflammatory reaction. Further research is required to determine the regulatory effects of the in ovo administration of different vitamin D3 sources on the immune response and intestinal development of broilers subjected a coccidiosis infection.

Author Contributions

Conceptualization, S.A.F.; methodology, S.A.F., A.M. and K.S.M.; software, S.A.F.; validation, S.A.F., A.M., L.Z. and E.D.P.; formal analysis, S.A.F.; investigation, S.A.F.; resources, E.D.P.; data curation, S.A.F., I.P., S.P., A.M. and E.D.P.; writing—original draft preparation, S.A.F.; writing—review and editing, S.A.F., L.Z., S.P., K.S.M. and E.D.P.; visualization, S.A.F.; supervision, E.D.P.; project administration, S.A.F.; funding acquisition, E.D.P. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the DSM Nutritional Products Inc., Zoetis Animal Health Co., United States Department of Agriculture (USDA agreement no. 58-6406-4-016) and Merial Select Inc.

Institutional Review Board Statement

The experimental procedure was accepted by the Institutional Animal Care and Use Committee of Mississippi State University (Protocol #IACUC-20-248).

Informed Consent Statement

Not applicable.

Data Availability Statement

None of the data were deposited in an official repository.

Acknowledgments

The authors express their appreciation for the assistance of the graduate and undergraduate students of the Poultry Science Department of Mississippi State University. Our special thanks are also extended to April Levy for her invaluable assistance.

Conflicts of Interest

The authors indicate that they have no conflict of interest. The authors alone are responsible for the content and writing of this article.

References

  1. Henry, H.L. Measurement of the chicken kidney 25-hydroxyvitamin D3 1-hydroxylase and 25-hydroxyvitamin D3 24-hydroxylase. Methods Enzymol. 1980, 67, 445–449. [Google Scholar] [PubMed]
  2. Booth, B.E.; Tsai, H.C.; Morris, R.C., Jr. Vitamin D status regulates 25-hydroxyvitamin D3-1 alpha-hydroxylase and its responsiveness to parathyroid hormone in the chick. J. Clin. Investig. 1985, 75, 155–161. [Google Scholar] [CrossRef] [PubMed]
  3. Russell, J.; Bar, A.; Sherwood, L.M.; Hurwitz, S. Interaction between calcium and 1,25-dihydroxyvitamin D3 in the regulation of preproparathyroid hormone and vitamin D receptor messenger ribonucleic acid in avian parathyroids. Endocrinology 1993, 132, 2639–2644. [Google Scholar] [CrossRef] [PubMed]
  4. De Matos, R. Calcium metabolism in birds. Vet. Clin. N. Am. Exot. Anim. Pract. 2008, 11, 59–82. [Google Scholar] [CrossRef]
  5. Yarger, J.G.; Quarles, C.L.; Hollis, B.W.; Gray, R.W. Safety of 25-hydroxycholecalciferol as a source of cholecalciferol in poultry rations. Poult. Sci. 1995, 74, 1437–1446. [Google Scholar] [CrossRef]
  6. Vignale, K.; Greene, E.S.; Caldas, J.V.; England, J.; Boonsinchai, N.; Sodsee, P.; Pollock, E.D.; Dridi, S.; Coon, C.N. 25-Hydroxycholecalciferol enhances male broiler breast meat yield through the mTOR pathway. J. Nutr. 2015, 145, 855–863. [Google Scholar] [CrossRef]
  7. Hutton, K.C.; Vaughn, M.A.; Litta, G.; Turner, B.J.; Starkey, J.D. Effect of vitamin D status improvement with 25-hydroxycholecalciferol on skeletal muscle growth characteristics and satellite cell activity in broiler chickens. J. Anim. Sci. 2014, 92, 3291–3299. [Google Scholar] [CrossRef]
  8. Morris, A.; Shanmugasundaram, R.; Lilburn, M.S.; Selvaraj, R.K. 25-Hydroxycholecalciferol supplementation improves growth performance and decreases inflammation during an experimental lipopolysaccharide injection. Poult. Sci. 2014, 93, 1951–1956. [Google Scholar] [CrossRef]
  9. Chou, S.H.; Chung, T.K.; Yu, B. Effects of supplemental 25-hydroxycholecalciferol on growth performance, small intestinal morphology, and immune response of broiler chickens. Poult. Sci. 2009, 88, 2333–2341. [Google Scholar] [CrossRef]
  10. Morris, A.; Shanmugasundaram, R.; McDonald, J.; Selvaraj, R.K. Effect of in vitro and in vivo 25-hydroxyvitamin D treatment on macrophages, T cells, and layer chickens. J. Anim. Sci. 2015, 93, 2894–2903. [Google Scholar] [CrossRef] [Green Version]
  11. Christakos, S.; Ajibade, D.V.; Dhawan, P.; Fechner, A.J.; Mady, L.J. Vitamin D: Metabolism. Endocrinol. Metab. Clin. N. Am. 2010, 39, 243–253. [Google Scholar] [CrossRef] [PubMed]
  12. Shanmugasundaram, R.; Selvaraj, R.K. Vitamin D-1alpha-hydroxylase and vitamin D-24-hydroxylase mRNA studies in chickens. Poult. Sci. 2012, 91, 1819–1824. [Google Scholar] [CrossRef] [PubMed]
  13. Shojadoost, B.; Behboudi, S.; Villanueva, A.I.; Brisbin, J.T.; Ashkar, A.A.; Sharif, S. Vitamin D3 modulates the function of chicken macrophages. Res. Vet. Sci. 2015, 100, 45–51. [Google Scholar] [CrossRef] [PubMed]
  14. Williams, C.J. In ovo vaccination and chick quality. Int. Hatch. Prac. 2011, 19, 7–13. [Google Scholar]
  15. Williams, C.J. In ovo vaccination for disease prevention. Int. Poult. Prod. 2007, 15, 7–9. [Google Scholar]
  16. Peebles, E.D. In ovo applications in poultry: A review. Poul. Sci. 2018, 97, 2322–2338. [Google Scholar] [CrossRef]
  17. Mousstaaid, A.; Fatemi, S.A.; Elliott, K.E.C.; Alqhtani, A.H.; Peebles, E.D. Effects of the in ovo injection of L-ascorbic acid on broiler hatching performance. Animals 2022, 12, 1020. [Google Scholar] [CrossRef]
  18. Fatemi, S.A.; Alqhtani, A.H.; Elliott, K.E.C.; Bello, A.; Zhang, H.; Levy, A.W.; Peebles, E.D. Improvement in the performance and inflammatory reaction of Ross 708 broilers in response to the in ovo injection of 25-hydroxyvitamin D3. Poult. Sci. 2021, 100, 138–146. [Google Scholar] [CrossRef]
  19. Fatemi, S.A.; Elliott, K.E.C.; Bello, A.; Zhang, H.; Alqhtani, A.H.; Peebles, E.D. Effects of the in ovo injection of vitamin D3 and 25-hydroxyvitamin D3 in Ross 708 broilers subsequently fed commercial or calcium and phosphorous-restricted diets: I. performance, carcass characteristics, and incidence of woody breast myopathy. Poult. Sci. 2021, 100, 10122. [Google Scholar] [CrossRef]
  20. Fatemi, S.A.; Elliott, K.E.C.; Bello, A.; Durojaye, O.; Zhang, H.; Turner, B.; Peebles, E.D. The effects of in ovo-injected vitamin D3 sources on the eggshell temperature and early post-hatch performance of Ross 708 broilers. Poult. Sci. 2020, 99, 1357–1362. [Google Scholar] [CrossRef]
  21. Fatemi, S.A.; Elliott, K.E.C.; Bello, A.; Durojaye, O.; Zhang, H.; Turner, B.; Peebles, E.D. Effects of source and level of in ovo-injected vitamin D3 on the hatchability and serum 25-hydroxycholecalciferol concentrations of Ross 708 broilers. Poult. Sci. 2020, 99, 3877–3884. [Google Scholar] [CrossRef] [PubMed]
  22. Bello, A.; Hester, P.Y.; Gerard, P.D.; Zhai, W.; Peebles, E.D. Effects of commercial in ovo injection of 25-hydroxycholecalciferol on bone development and mineralization in male and female broilers. Poult. Sci. 2014, 93, 2734–2739. [Google Scholar] [CrossRef] [PubMed]
  23. Yair, R.; Shahar, R.; Uni, Z. In ovo feeding with minerals and vitamin D3 improves bone properties in hatchlings and mature broilers. Poult. Sci. 2015, 94, 2695–2707. [Google Scholar] [CrossRef] [PubMed]
  24. Abbasi, T.; Shakeri, M.; Zaghari, M.; Kohram, H. Growth performance parameters, bone calcification and immune response of in ovo injection of 25-hydroxycholecalciferol and vitamin K3 in male Ross 308 broilers. Theriogenology 2017, 90, 260–265. [Google Scholar] [CrossRef]
  25. Fatemi, S.A.; Elliott, K.E.C.; Bello, A.; Zhang, H.; Peebles, E.D. Effects of the in ovo injection of vitamin D3 and 25-hydroxyvitamin D3 in Ross 708 broilers subsequently fed commercial or calcium and phosphorous-restricted diets: II. Immunity and small intestine morphology. Poult. Sci. 2021, 100, 101240. [Google Scholar] [CrossRef] [PubMed]
  26. Fatemi, S.A.; Elliott, K.E.C.; Bello, A.; Peebles, E.D. Effects of the in ovo injection of vitamin D3 and 25-hydroxyvitamin D3 in Ross 708 broilers subsequently challenged with coccidiosis. I. performance, meat yield and intestinal lesion. Poult. Sci. 2021, 100, 101382. [Google Scholar] [CrossRef]
  27. Fatemi, S.A.; Elliott, K.E.C.; Bello, A.; Macklin, K.S.; Peebles, E.D. Effects of the in ovo injection of vitamin D3 and 25-hydroxyvitamin D3 in Ross 708 broilers subsequently challenged with coccidiosis: II. Immunological and inflammatory responses and small intestine histomorphology. Animals 2022, 12, 1027. [Google Scholar] [CrossRef]
  28. Poudel, S.; Zhang, L.; Tabler, G.T.; Lin, J.; Zhai, W. Effects of riboflavin and Bacillus subtills on internal organ development and intestinal health of Ross 708 male broilers with or without coccidial challenge. Poult. Sci. 2021, 100, 100973. [Google Scholar] [CrossRef]
  29. Poudel, S.; Tabler, G.T.; Lin, J.; Zhai, W.; Zhang, L. Riboflavin and Bacillus subtilis effects on growth performance and woody-breast of Ross 708 broilers with or without Eimeria spp. challenge. J. Anim. Sci. Technol. 2022, 64, 443. [Google Scholar] [CrossRef]
  30. Zhou, Z.; Wanga, Z.; Cao, L.; Hua, S.; Zhang, Z.; Qin, B.; Guo, Z.; Nie, K. Upregulation of chicken TLR4, TLR15 and MyD88 in heterophils and monocyte-derived macrophages stimulated with Eimeria tenella in vitro. Exp. Parasitol. 2013, 133, 427–433. [Google Scholar] [CrossRef]
  31. Fatemi, S.A. Effects of dietary 25-hydroxycholecalciferol and vitamin D3 on performance, meat yield, bone characteristics, innate immune response and gene expression of Ross 308 broilers grown on reused or fresh litter. Master’s Dissertation, University of Alberta, Edmonton, AB, Canada, 2016. [Google Scholar]
  32. Poudel, S.; Li, T.; Chen, S.; Zhang, X.; Cheng, W.-H.; Sukumaran, A.T.; Kiess, A.S.; Zhang, L. Prevalence, antimicrobial resistance, and molecular characterization of Campylobacter isolated from broilers and broiler meat raised without antibiotics. Microbiol. Spectr. 2022, 10, e0025122. [Google Scholar] [CrossRef] [PubMed]
  33. Andersen, C.L.; Jensen, J.L.; Ørntoft, T.F. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer. Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  35. Al-Zghoul, M.B.; Saleh, K.M.; Ababneh, M.M.K. Effects of pre-hatch thermal manipulation and post-hatch acute heat stress on the mRNA expression of interleukin-6 and genes involved in its induction pathways in 2 broiler chicken breeds. Poult. Sci. 2019, 98, 1805–1819. [Google Scholar] [CrossRef] [PubMed]
  36. Brisbin, J.T.; Gong, J.; Parvizi, P.; Sharif, S. Effects of lactobacilli on cytokine expression by chicken spleen and cecal tonsil cells. Clin. Vaccine Immunol. 2010, 17, 1337–1343. [Google Scholar] [CrossRef]
  37. Steel, R.G.D.; Torrie, J.H. Principles and Procedures of Statistics: A biometrical Approach, 2nd ed.; McGraw-Hill: New York, NY, USA, 1980. [Google Scholar]
  38. Li, J.; Yang, X.; Jia, Z.; Ma, C.; Pan, X.; Ma, D. Activation of ChTLR15/ChNF-κB-ChNLRP3/ChIL-1β signaling transduction pathway mediated inflammatory responses to E. tenella infection. Vet. Res. 2021, 52, 15. [Google Scholar] [CrossRef]
  39. Shanmugasundaram, R.; Morris, A.; Selvaraj, R.K. Effect of 25-hydroxycholecalciferol supplementation on turkey performance and immune cell parameters in a coccidial infection model. Poult. Sci. 2019, 98, 1127–1133. [Google Scholar] [CrossRef]
  40. Kumar, H.; Kawai, T.; Akira, S. Pathogen recognition by the innate immune system. Int. Rev. Immunol. 2011, 30, 16–34. [Google Scholar] [CrossRef]
  41. Fetterer, R.H.; Miska, K.B.; Jenkins, M.C.; Barfield, R.C. A conserved 19-kDa Eimeria tenella antigen is a profilin-like protein. J. Parasitol. 2004, 90, 1321–1328. [Google Scholar] [CrossRef]
  42. Zheng, C.; Chen, J.; Chu, F.; Zhu, J.; Jin, T. Inflammatory Role of TLR-MyD88 Signaling in Multiple Sclerosis. Front. Mol. Neurosci. 2020, 12, 314. [Google Scholar] [CrossRef]
  43. Shanmugasundaram, R.; Selvaraj, R.K. Regulatory T cell properties of chicken CD4+ CD25+ Cells. J. Immunol. 2011, 186, 1997–2002. [Google Scholar] [CrossRef] [PubMed]
  44. Morris, A.; Selvaraj, R.K. In vitro 25-hydroxycholecalciferol treatment of lipopolysaccharide-stimulated chicken macrophages increases nitric oxide production and mRNA of interleukin-1 beta and 10 during a coccidia challenge. J. Anim. Sci. 2014, 93, 2894–2903. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Wan, Y.Y.; Richard, A.F. ‘Yin-Yang’ functions of transforming growth factor-beta and T regulatory cells in immune regulation. Immunol. Rev. 2007, 220, 199–213. [Google Scholar] [CrossRef]
  46. Sojka, D.K.; Huang, Y.H.; Fowell, D.J. Mechanisms of regulatory T-cell suppression—A diverse arsenal for a moving target. Immunology. 2008, 124, 13–22. [Google Scholar] [CrossRef]
  47. Nemere, I.; Dormanen, M.C.; Hammond, M.W.; Okamura, W.H.; Norman, A.W. Identification of a specific binding protein for 1 alpha, 25-dihydroxyvitamin D3 in basal-lateral membranes of chick intestinal epithelium and relationship to transcaltachia. J. Biol. Chem. 1994, 269, 23750–23756. [Google Scholar] [CrossRef]
  48. Norman, A.W. Studies on the vitamin D endocrine system. Avian. J. Nutr. 1987, 117, 797–807. [Google Scholar] [CrossRef]
  49. Elaroussi, M.A.; Prahl, J.M.; DeLuca, H.F. The avian vitamin D receptors: Primary structures and their origins. Proc. Natl. Acad. Sci. USA 1994, 91, 11596–11600. [Google Scholar] [CrossRef]
  50. Thaxton, J.P.; Puvadolpirod, S. Model of physiological stress in chickens. 5. Qualitative evaluation. Poult. Sci. 2000, 79, 391–395. [Google Scholar] [CrossRef] [PubMed]
  51. Yarru, L.P.; Settivari, R.S.; Antoniou, E.; Ledoux, D.R.; Rottinghaus, G.E. Toxicological and gene expression analysis of the impact of aflatoxin B1 on hepatic function of male broiler chicks. Poult. Sci. 2009, 88, 360–371. [Google Scholar] [CrossRef] [PubMed]
  52. Peighambari, S.M.; Julian, R.J.; Gyles, C.L. Experimental Escherichia coli respiratory infection in broilers. Avian. Dis. 2000, 44, 759–769. [Google Scholar] [CrossRef] [PubMed]
  53. Ali, B.H. The hepatic and duodenal activities of some drug metabolizing enzymes in chickens: Influence of infection with Escherichia coli endotoxin and coccidiosis. Eur. J. Drug Metab. Pharm. 1997, 22, 223–227. [Google Scholar] [CrossRef] [PubMed]
  54. Lynagh, G.R.; Bailey, M.; Kaiser, P. Interleukin-6 is produced during both murine and avian Eimeria infections. Vet. Immunol. Immunopathol. 2000, 76, 89–102. [Google Scholar] [CrossRef]
  55. Hong, Y.H.; Lillehoj, H.S.; Lillehoj, E.P.; Lee, S.H. Changes in immune-related gene expression and intestinal lymphocyte subpopulations following Eimeria maxima infection of chickens. Vet. Immunol. Immunopathol. 2006, 114, 259–272. [Google Scholar] [CrossRef] [PubMed]
  56. Yu, H.; Zou, W.; Wang, X.; Dai, G.; Zhang, T.; Zhang, G.; Xie, K.; Wang, J.; Shi, H. Research Note: Correlation analysis of interleukin-6, interleukin-8, and C-C motif chemokine ligand 2 gene expression in chicken spleen and cecal tissues after Eimeria tenella infection in vivo. Poult. Sci. 2020, 99, 1326–1331. [Google Scholar] [CrossRef]
Table
Table 1. Real-time PCR primers and GenBank accession numbers of chicken housekeeping genes, and target genes associated with immunity and vitamin D-related activity.
Table 1. Real-time PCR primers and GenBank accession numbers of chicken housekeeping genes, and target genes associated with immunity and vitamin D-related activity.
Gene SymbolAccession NoTypeOrientationSequence (5′ to 3′)Length (nt)Amplicon Size (bp)Reference
RNA 18SM59389.1HousekeepingForwardGCCAACAGAGAGAAGATGACAC22140-
ReverseGTAACACCATCACCAGAGTCCA22
GAPDHNM204305HousekeepingForwardGTAAACCATGTAGTTCAGATCGATGA2672-
ReverseGCCGTCCTCTCTGGCAAAG19
IL-2AY386204Immunity-relatedForwardAGTCTTACAGGTCTAAATCACACC24102-
ReverseCACAAAGTTGGTCAGTTCATGG22
IL-6AB559572Immunity-relatedForwardGCGAGAACAGCATGGAGATG20143Al-Zghoul et al. [35]
ReverseGTAGGTCTGAAAGGCGAACAG21
IL-10AJ621614Immunity-relatedForwardAGCAGATCAAGGAGACGTTC20103-
ReverseATCAGCAGGTACTCCTCGAT20
IFN-γAJ001678Immunity-relatedForwardGTGAAGAAGGTGAAAGATATCATGGA2671-
ReverseGCTTTGCGCTGGATTCTCA19
TGF-β4M31160.1Immunity-relatedForwardGGGGTCTTCAAGCTGAGCGT20119Brisbin et al. [36]
ReverseTTGGCAATGCTCTGCATGTC20
TLR-4AY064697Immunity-relatedForwardAGTCTGAAATTGCTGAGCTCAAAT24190-
ReverseGCGACGTTAAGCCATGGAAG20
TLR-15NM_001037835Immunity-relatedForwardGGCTGTGGTATGTGAGAATG20113-
ReverseATCGTGCTCGCTGTATGA18
MyD88NM_001030962Immunity-relatedForwardATGGGCATGGAACAGAGATG20138-
ReverseGCAAGACATCCCGATCAAAC20
1α-hydroxylaseXM_422077Vitamin D activity-relatedForwardTCGTGGCAGGAATACAGAGA20125-
ReverseACTGCCACATCTTTGGGTTT20
25-hydroxylaseNM_001277354Vitamin D activity-relatedForwardGCTGTCACTGGGATTCTTTGC21160Shanmugasundaram and selvaraj [12]
ReverseCCAACCGAAAGGCACAAGTC20
24-hydroxylaseAF019142.1Vitamin D activity-relatedForwardAAACCCTGGAAAGCCTATCG20133Shanmugasundaram and selvaraj [12]
ReverseCCAGTTTCACCACCTCCTTG20
VDRAF011356.1Vitamin D activity-relatedForwardCGTGAGAAGCAAATTCAGCA20157-
ReverseGAGGTCCAGGTTGGAAAACA20
Table
Table 2. Effects of in ovo injection treatment (non-injected, diluent-injected (50 μL), and 50 μL of diluent containing 2.4 μg of vitamin D3 (D3), 2.4 μg of 25-hydroxycholecalciferol (25OHD3), or 2.4 μg of D3 and 2.4 μg of 25OHD3 (D3 + 25OHD3) on the fold change expression of immune-related genes at 14 and 28 d of age (doa).
Table 2. Effects of in ovo injection treatment (non-injected, diluent-injected (50 μL), and 50 μL of diluent containing 2.4 μg of vitamin D3 (D3), 2.4 μg of 25-hydroxycholecalciferol (25OHD3), or 2.4 μg of D3 and 2.4 μg of 25OHD3 (D3 + 25OHD3) on the fold change expression of immune-related genes at 14 and 28 d of age (doa).
TreatmentnIL-2IL-6IL10IFN-γTGF-β4TLR4TLR-15MyD88
14 doa
Non-injected 180.901.531.140.870.910.931.531.10
Diluent 281.041.071.041.061.061.011.121.03
D3 381.121.691.271.491.031.201.381.31
25OHD3 481.051.061.330.912.160.920.951.17
D3 + 25OHD3 581.001.031.110.801.141.111.011.11
SEM 0.1950.4350.3090.1960.5220.1780.2770.153
p-value 0.7580.4890.8690.1030.2740.5220.5560.763
28 doa
Diluent81.051.06 b1.18 c1.101.03 b1.171.061.04
D381.254.41 a1.70 c0.891.53 b1.340.961.31
25OHD381.410.93 b9.00 a0.464.70 a1.560.971.34
D3 + 25OHD381.502.52 ab3.40 b1.032.29 b1.471.501.40
SEM 0.2120.8320.5530.2230.5050.2790.2230.218
p-value 0.4710.0120.0010.198<0.0010.7770.2940.660
a–c Treatment means within the same column within effect with no common superscripts are significantly different (p ≤ 0.05). 1 Eggs that were not injected with any solution and also were not challenged with coccidiosis vaccine at 14 doa. 2 Eggs injected with 50 μL of commercial diluent at d 18 of incubation and that were not challenged with coccidiosis vaccine at 14 doa. 3 Eggs injected with 50 μL of commercial diluent containing vitamin 2.4 μg of D3 at d 18 of incubation and that were also challenged with coccidiosis vaccine at 14 doa. 4 Eggs injected with 50 μL of commercial diluent containing 2.4 μg of 25OHD3 at d 18 of incubation and that were also challenged with coccidiosis vaccine at 14 doa. 5 Eggs injected with 50 μL of commercial diluent containing 2.4 μg of D3 and 2.4 μg of 25OHD3 at d 18 of incubation and also were challenged with coccidiosis vaccine at 14 doa.
Table
Table 3. Effects of in ovo injection treatment (non-injected, diluent-injected (50 μL), and 50 μL of diluent containing 2.4 μg of vitamin D3 (D3), 2.4 μg of 25-hydroxycholecalciferol (25OHD3), or 2.4 μg of D3 and 2.4 μg of 25OHD3 (D3 + 25OHD3) on the fold change expression of vitamin D activity-related genes at 14 and 28 d of age (doa).
Table 3. Effects of in ovo injection treatment (non-injected, diluent-injected (50 μL), and 50 μL of diluent containing 2.4 μg of vitamin D3 (D3), 2.4 μg of 25-hydroxycholecalciferol (25OHD3), or 2.4 μg of D3 and 2.4 μg of 25OHD3 (D3 + 25OHD3) on the fold change expression of vitamin D activity-related genes at 14 and 28 d of age (doa).
Treatmentn1α-hydroxylase25-hydroxylase24-hydroxylaseVDR 1
14 doa
Non-injected 281.010.892.020.91
Diluent 381.021.021.141.01
D3 481.341.172.641.32
25OHD3 581.341.071.491.19
D3 + 25OHD3 681.161.031.891.15
SEM 0.2460.1600.6060.195
p-value 0.5490.5800.2990.381
28 doa
Diluent81.04 b1.021.031.25
D381.16 b1.132.081.82
25OHD383.43 a1.250.471.56
D3 + 25OHD381.80 b1.912.081.70
SEM 0.3830.3290.4370.274
p-value 0.0010.2430.0720.512
a, b Treatment means within the same column within effect with no common superscripts are significantly different (p ≤ 0.05). 1 Vitamin D receptor. 2 Eggs that were not injected with any solution and also were not challenged with coccidiosis vaccine at 14 doa. 3 Eggs injected with 50 μL of commercial diluent at d 18 of incubation and that were not challenged with coccidiosis vaccine at 14 doa. 4 Eggs injected with 50 μL of commercial diluent containing vitamin 2.4 μg of D3 at d 18 of incubation and that were also challenged with coccidiosis vaccine at 14 doa. 5 Eggs injected with 50 μL of commercial diluent containing 2.4 μg of 25OHD3 at d 18 of incubation and that were also challenged with coccidiosis vaccine at 14 doa. 6 Eggs injected with 50 μL of commercial diluent containing 2.4 μg of D3 and 2.4 μg of 25OHD3 at d 18 of incubation and also were challenged with coccidiosis vaccine at 14 doa.
Table
Table 4. Effects of coccidiosis infection on the fold change expression of genes linked to immunity and vitamin D activity before and after coccidiosis infection.
Table 4. Effects of coccidiosis infection on the fold change expression of genes linked to immunity and vitamin D activity before and after coccidiosis infection.
Genesn14 doa 128 doa 2SEMp-Value
IL-2161.017 b1.30 a0.1300.031
IL-6161.34 b2.48 a0.5080.028
IL10161.21 b3.82 a0.5810.002
IFN-γ161.080.880.1390.135
TGF-β4161.29 b2.39 a0.4100.010
TLR4161.02 b1.39 a0.1560.021
TLR-15161.251.120.1850.509
MyD88161.151.270.1240.380
1α-hydroxylase161.18 b1.86 a0.2600.011
25-hydroxylase161.041.330.1770.110
24-hydroxylase161.821.420.3770.285
VDR161.11 b1.58 a0.1530.003
a, b Treatment means within the same column within effect with no common superscripts are significantly different (p ≤ 0.05). 1 14 d of age, when all birds were unchallenged. 2 28 d of age (14 days post-infection), when birds were challenged with coccidiosis vaccine.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Fatemi, S.A.; Macklin, K.S.; Zhang, L.; Mousstaaid, A.; Poudel, S.; Poudel, I.; Peebles, E.D. Improvement in the Immunity- and Vitamin D3-Activity-Related Gene Expression of Coccidiosis-Challenged Ross 708 Broilers in Response to the In Ovo Injection of 25-Hydroxyvitamin D3 . Animals 2022, 12, 2517. https://doi.org/10.3390/ani12192517

AMA Style

Fatemi SA, Macklin KS, Zhang L, Mousstaaid A, Poudel S, Poudel I, Peebles ED. Improvement in the Immunity- and Vitamin D3-Activity-Related Gene Expression of Coccidiosis-Challenged Ross 708 Broilers in Response to the In Ovo Injection of 25-Hydroxyvitamin D3 . Animals. 2022; 12(19):2517. https://doi.org/10.3390/ani12192517

Chicago/Turabian Style

Fatemi, Seyed Abolghasem, Kenneth S. Macklin, Li Zhang, Ayoub Mousstaaid, Sabin Poudel, Ishab Poudel, and Edgar David Peebles. 2022. "Improvement in the Immunity- and Vitamin D3-Activity-Related Gene Expression of Coccidiosis-Challenged Ross 708 Broilers in Response to the In Ovo Injection of 25-Hydroxyvitamin D3 " Animals 12, no. 19: 2517. https://doi.org/10.3390/ani12192517

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop