Active Dry Yeast and Thiamine in Synergistic Mode Can Mitigate Adverse Effects of In Vitro Ruminal Acidosis Model of Goats
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Donor Animals
2.2. Experimental Design and Sampling
2.3. Analysis of Fermentation Parameters
2.4. Extraction of DNA and RT_PCR
2.5. Statistical Analysis
3. Results
3.1. Fermentation Parameters
3.2. Rumen Microbial Community
4. Discussion
4.1. Fermentation
4.2. Bacterial Community
4.3. Protozoa
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Morgante, M.; Stelletta, C.; Berzaghi, P.; Gianesella, M.; Andrighetto, I. Subacute rumen acidosis in lactating cows: An investigation in intensive Italian dairy herds. J. Anim. Physiol. Anim. Nutr. 2007, 91, 226–234. [Google Scholar] [CrossRef] [PubMed]
- Aschenbach, J.R.; Gäbel, G. Effect and absorption of histamine in sheep rumen: Significance of acidotic epithelial damage. J. Anim. Sci. 2000, 78, 464–470. [Google Scholar] [CrossRef] [PubMed]
- Gozho, G.N.; Plaizier, J.C.; Krause, D.O.; Kennedy, A.D.; Wittenberg, K.M. Subacute Ruminal Acidosis Induces Ruminal Lipopolysaccharide Endotoxin Release and Triggers an Inflammatory Response. J. Dairy Sci. 2005, 88, 1399–1403. [Google Scholar] [CrossRef]
- Hua, C.; Tian, J.; Tian, P.; Cong, R.; Luo, Y.; Geng, Y.; Tao, S.; Ni, Y.; Zhao, R. Feeding a High Concentration Diet Induces Unhealthy Alterations in the Composition and Metabolism of Ruminal Microbiota and Host Response in a Goat Model. Front. Microbiol. 2017, 8, 138. [Google Scholar] [CrossRef]
- Jaramillo-López, E.; Itza-Ortiz, M.F.; Peraza-Mercado, G.; Carrera-Chávez, J.M. Ruminal acidosis: Strategies for its control. Austral. J. Vet. Sci. 2017, 49, 139–148. [Google Scholar] [CrossRef]
- AlZahal, O.; Dionissopoulos, L.; Laarman, A.; Walker, N.; McBride, B. Active dry Saccharomyces cerevisiae can alleviate the effect of subacute ruminal acidosis in lactating dairy cows. J. Dairy Sci. 2014, 97, 7751–7763. [Google Scholar] [CrossRef]
- Pan, X.; Yang, L.; Beckers, Y.; Xue, F.; Tang, Z.; Jiang, L.; Xiong, B. Thiamine supplementation facilitates thiamine transporter expression in the rumen epithelium and attenuates high-grain-induced inflammation in low-yielding dairy cows. J. Dairy Sci. 2017, 100, 5329–5342. [Google Scholar] [CrossRef]
- Zhang, H.; Peng, A.L.; Zhao, F.F.; Yu, L.H.; Wang, M.Z.; Osorio, J.S.; Wang, H.R. Thiamine ameliorates inflammation of the ruminal epithelium of Saanen goats suffering from subacute ruminal acidosis. J. Dairy Sci. 2020, 103, 1931–1943. [Google Scholar] [CrossRef]
- Theodorou, M.K.; Williams, B.A.; Dhanoa, M.S.; McAllan, A.B.; France, J. A simple gas production method using a pressure transducer to determine the fermentation kinetics of ruminant feeds. Anim. Feed Sci. Technol. 1994, 48, 185–197. [Google Scholar] [CrossRef]
- Wang, D.; Zhang, R.; Zhu, W.; Mao, S. Effects of subacute ruminal acidosis challenges on fermentation and biogenic amines in the rumen of dairy cows. Livest. Sci. 2013, 155, 262–272. [Google Scholar] [CrossRef]
- Barker, S.B.; Summerson, W.H. The colorimetric determination of lactic acid in biological material. J. Biol. Chem. 1941, 138, 535–554. [Google Scholar] [CrossRef]
- Wang, M.-Z.; Wang, H.-R.; Cao, H.-C.; Li, G.-X.; Zhang, J. Effects of Limiting Amino Acids on Rumen Fermentation and Microbial Community In vitro. Agric. Sci. China 2008, 7, 1524–1531. [Google Scholar] [CrossRef]
- Bremner, J.; Keeney, D. Steam distillation methods for determination of ammonium, nitrate and nitrite. Anal. Chim. Acta 1965, 32, 485–495. [Google Scholar] [CrossRef]
- Liu, J.-H.; Xu, T.-T.; Liu, Y.-J.; Zhu, W.-Y.; Mao, S.-Y. A high-grain diet causes massive disruption of ruminal epithelial tight junctions in goats. Am. J. Physiol. Integr. Comp. Physiol. 2013, 305, R232–R241. [Google Scholar] [CrossRef] [PubMed]
- Ruiz, M.E.; Pando, M.A. Load Transfer Mechanisms of Tip Post-Grouted Drilled Shafts in Sand. In Proceedings of the International Foundation Congress and Equipment Expo 2009, Orlando, FL, USA, 15–19 May 2009; pp. 23–30. [Google Scholar] [CrossRef]
- Valizadeh, R.; Behgar, M.; Mirzaee, M.; Naserian, A.A.; Vakili, A.R.; Ghovvati, S. The effect of physically effective fiber and soy hull on the ruminal cellulolytic bacteria population and milk production of dairy cows. Asian-Australas. J. Anim. Sci. 2010, 23, 1325–1332. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Denman, S.E.; McSweeney, C. Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen. FEMS Microbiol. Ecol. 2006, 58, 572–582. [Google Scholar] [CrossRef]
- Maeda, H.; Fujimoto, C.; Haruki, Y.; Maeda, T.; Kokeguchi, S.; Petelin, M.; Arai, H.; Tanimoto, I.; Nishimura, F.; Takashiba, S. Quantitative real-time PCR using TaqMan and SYBR Green for Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, tetQ gene and total bacteria. FEMS Immunol. Med. Microbiol. 2003, 39, 81–86. [Google Scholar] [CrossRef]
- Stevenson, D.M.; Weimer, P.J. Dominance of Prevotella and low abundance of classical ruminal bacterial species in the bovine rumen revealed by relative quantification real-time PCR. Appl. Microbiol. Biotechnol. 2007, 75, 165–174. [Google Scholar] [CrossRef]
- Khafipour, E.; Krause, D.O.; Plaizier, J.C. A grain-based subacute ruminal acidosis challenge causes translocation of lipopolysaccharide and triggers inflammation. J. Dairy Sci. 2009, 92, 1060–1070. [Google Scholar] [CrossRef]
- Zhang, C.; Guo, Y.; Yuan, Z.; Wu, Y.; Wang, J.; Liu, J.; Zhu, W. Effect of octadeca carbon fatty acids on microbial fermentation, methanogenesis and microbial flora in vitro. Anim. Feed Sci. Technol. 2008, 146, 259–269. [Google Scholar] [CrossRef]
- Wang, H.; Pan, X.; Wang, C.; Wang, M.; Yu, L. Effects of different dietary concentrate to forage ratio and thiamine supplementation on the rumen fermentation and ruminal bacterial community in dairy cows. Anim. Prod. Sci. 2015, 55, 189–193. [Google Scholar] [CrossRef]
- Rivera-Chacon, R.; Castillo-Lopez, E.; Ricci, S.; Petri, R.M.; Reisinger, N.; Zebeli, Q. Supplementing a Phytogenic Feed Additive Modulates the Risk of Subacute Rumen Acidosis, Rumen Fermentation and Systemic Inflammation in Cattle Fed Acidogenic Diets. Animals 2022, 12, 1201. [Google Scholar] [CrossRef] [PubMed]
- Owens, F.N.; Secrist, D.S.; Hill, W.J.; Gill, D.R. Acidosis in cattle: A review. J. Anim. Sci. 1998, 76, 275–286. [Google Scholar] [CrossRef] [PubMed]
- Shen, Y.Z.; Ding, L.Y.; Chen, L.M.; Xu, J.H.; Zhao, R.; Yang, W.Z.; Wang, H.R.; Wang, M.Z. Feeding corn grain steeped in citric acid modulates rumen fermentation and inflammatory responses in dairy goats. Animal 2019, 13, 301–308. [Google Scholar] [CrossRef]
- Plaizier, J.C.; Krause, D.O.; Gozho, G.N.; McBride, B.W. Subacute ruminal acidosis in dairy cows: The physiological causes, incidence and consequences. Vet. J. 2008, 176, 21–31. [Google Scholar] [CrossRef]
- Chaucheyras-Durand, F.; Walker, N.; Bach, A. Effects of active dry yeasts on the rumen microbial ecosystem: Past, present and future. Anim. Feed Sci. Technol. 2008, 145, 5–26. [Google Scholar] [CrossRef]
- Malekkhahi, M.; Tahmasbi, A.; Naserian, A.A.; Mesgaran, M.D.; Kleen, J.; AlZahal, O.; Ghaffari, M. Effects of supplementation of active dried yeast and malate during sub-acute ruminal acidosis on rumen fermentation, microbial population, selected blood metabolites, and milk production in dairy cows. Anim. Feed Sci. Technol. 2016, 213, 29–43. [Google Scholar] [CrossRef]
- Pan, X.; Yang, L.; Xue, F.; Xin, H.; Jiang, L.; Xiong, B.; Beckers, Y. Relationship between thiamine and subacute ruminal acidosis induced by a high-grain diet in dairy cows. J. Dairy Sci. 2016, 99, 8790–8801. [Google Scholar] [CrossRef]
- Lila, Z.A.; Mohammed, N.; Yasui, T.; Kurokawa, Y.; Kanda, S.; Itabashi, H. Effects of a twin strain of Saccharomyces cerevisiae live cells on mixed ruminal microorganism fermentation in vitro. J. Anim. Sci. 2004, 82, 1847–1854. [Google Scholar] [CrossRef]
- Yin, Y.-Y.; Liu, Y.-J.; Zhu, W.-Y.; Mao, S.-Y. Effects of Acarbose Addition on Ruminal Bacterial Microbiota, Lipopolysaccharide Levels and Fermentation Characteristics In vitro. Asian-Australas. J. Anim. Sci. 2014, 27, 1726–1735. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Li, S.; Khafipour, E.; Krause, D.; Kroeker, A.; Rodriguez-Lecompte, J.; Gozho, G.; Plaizier, J. Effects of subacute ruminal acidosis challenges on fermentation and endotoxins in the rumen and hindgut of dairy cows. J. Dairy Sci. 2012, 95, 294–303. [Google Scholar] [CrossRef] [PubMed]
- Garcia Diaz, T.; Ferriani Branco, A.; Jacovaci, F.A.; Cabreira Jobim, C.; Bolson, D.C.; Pratti Daniel, J.L. Inclusion of live yeast and mannan-oligosaccharides in high grain-based diets for sheep: Ruminal parameters, inflammatory response and rumen morphology. PLoS ONE 2018, 13, e0193313. [Google Scholar]
- Chaucheyras-Durand, F.; Durand, H. Probiotics in animal nutrition and health. Benef. Microbes 2010, 1, 3–9. [Google Scholar] [CrossRef] [PubMed]
- Khafipour, E.; Li, S.; Plaizier, J.C.; Krause, D.O. Rumen microbiome composition determined using two nutritional models of subacute ruminal acidosis. Appl. Environ. Microbiol. 2009, 75, 7115–7124. [Google Scholar] [CrossRef]
- Pinloche, E.; McEwan, N.; Marden, J.-P.; Bayourthe, C.; Auclair, E.; Newbold, C.J. The Effects of a Probiotic Yeast on the Bacterial Diversity and Population Structure in the Rumen of Cattle. PLoS ONE 2013, 8, e67824. [Google Scholar] [CrossRef]
- Pan, X.; Xue, F.; Nan, X.; Tang, Z.; Wang, K.; Beckers, Y.; Jiang, L.; Xiong, B. Illumina Sequencing Approach to Characterize Thiamine Metabolism Related Bacteria and the Impacts of Thiamine Supplementation on Ruminal Microbiota in Dairy Cows Fed High-Grain Diets. Front. Microbiol. 2017, 8, 1818. [Google Scholar] [CrossRef]
- Schlegel, G.; Ringseis, R.; Windisch, W.; Schwarz, F.; Eder, K. Effects of a rumen-protected mixture of conjugated linoleic acids on hepatic expression of genes involved in lipid metabolism in dairy cows. J. Dairy Sci. 2012, 95, 3905–3918. [Google Scholar] [CrossRef]
- El Hassan, S.M.; Newbold, C.J.; Edwards, I.E.; Topps, J.H.; Wallace, R.J. Effect of yeast culture on rumen fermentation, microbial protein flow from the rumen and live-weight gain in bulls given high cereal diets. Anim. Sci. 1996, 62, 43–48. [Google Scholar] [CrossRef]
- Krause, K.M.; Oetzel, G.R. Understanding and preventing subacute ruminal acidosis in dairy herds: A review. Anim. Feed. Sci. Technol. 2015, 126, 215–236. [Google Scholar] [CrossRef]
- Nocek, J.E. Bovine Acidosis: Implications on Laminitis. J. Dairy Sci. 1997, 80, 1005–1028. [Google Scholar] [CrossRef]
- Khafipour, E.; Krause, D.O.; Plaizier, J.C. Alfalfa pellet-induced subacute ruminal acidosis in dairy cows increases bacterial endotoxin in the rumen without causing inflammation. J. Dairy Sci. 2009, 92, 1712–1724. [Google Scholar] [CrossRef] [PubMed]
- Sylvester, J.T.; Karnati, S.K.R.; Yu, Z.; Morrison, M.; Firkins, J.L. Development of an Assay to Quantify Rumen Ciliate Protozoal Biomass in Cows Using Real-Time PCR. J. Nutr. 2004, 134, 3378–3384. [Google Scholar] [CrossRef] [PubMed]
Target Organism | Forward/Reverse | Primer Sequence | Product Size | References |
---|---|---|---|---|
General bacteria | F R | GTGSTGCAYGGYTGTCGTCA ACGTCRTCCMCACCTTC | 146 | [19] |
S. bovis | F R | TTCCTAGAGATAGGAAGTTTCTTCGG ATGATGGCAACTAACAATAGGGGT | 127 | [20] |
Prevotella albensis | F R | GCGCCACTGACGCTGAAG CCCCAAATCCAAAAGGACTCAG | 110 | [21] |
F. succinogenes | F R | F GTTCGGAATTACTGGGCGTAAA CGCCTGCCCCTGAACTATC | 121 | [22] |
M. elsdenii | F R | AGATGGGGACAACAGCTGGA CGAAAGCTCCGAAGAGCCT | 79 | [20] |
S. ruminantium | F R | CAATAAGCATTCCGCCTGGG TTCACTCAATGTCAAGCCCTGG | 71 | [15] |
Lactobacillus | F R | AGCGAACAGGATTAGATACCC GATGGCACTAGATGTCAAGACC | 233 | [23] |
Anaerovibrio lipolytica | F R | TGGGTGTTAGAAATGGATTCTAGTG GCACGTCATTCGGTATTAGCAT | 109 | [21] |
Ruminococcus albus | F R | CCCTAAAAGCAGTCTTAGTTCG CCTCCTTGCGGTTAGAACA | 176 | [6] |
Protozoa | F R | GCTTTCGWTGGTAGTGTATT CTTGCCCTCYAATCGTWCT | 223 | [18] |
pH Noted at Hours of Incubation | SARA/Control | ADY | ADYT | SEM | p-Value |
---|---|---|---|---|---|
0 h | 6.58 | 6.56 | 6.56 | 0.001 | 0.23 |
3 h | 6.43 | 6.44 | 6.46 | 0.014 | 0.17 |
6 h | 6.25 b | 6.27 b | 6.37 a | 0.021 | 0.004 |
9 h | 5.95 c | 6.05 b | 6.22 a | 0.021 | 0.00 |
12 h | 5.68 c | 5.81 b | 6.04 a | 0.027 | 0.00 |
24 h | 5.56 c | 5.70 b | 5.92 a | 0.021 | 0.00 |
Lactic Acid (mmol/L) at Various Time Points Incubation | SARA/Control | ADY | ADYT | SEM | p-Value |
---|---|---|---|---|---|
3 h | 0.28 | 0.27 | 0.27 | 0.01 | 0.85 |
6 h | 0.34 | 0.33 | 0.33 | 0.00 | 0.35 |
9 h | 0.39 | 0.38 | 0.36 | 0.011 | 1.60 |
12 h | 0.54 a | 0.44 b | 0.41 b | 0.024 | 0.003 |
24 h | 0.76 a | 0.53 b | 0.45 c | 0.028 | 0.00 |
NH3-N (mg/dL) at Different Hours of Incubation | SARA/Control | ADY | ADYT | SEM | p-Value |
---|---|---|---|---|---|
3 h | 18.16 | 18.30 | 18.54 | 1.005 | 0.932 |
6 h | 22.22 | 22.43 | 21.88 | 1.45 | 0.930 |
9 h | 25.61 | 23.44 | 24.47 | 1.25 | 0.297 |
12 h | 33.79 a | 30.33 b | 29.28 b | 1.34 | 0.035 |
24 h | 27.99 a | 22.52 b | 21.23 b | 1.37 | 0.06 |
MCP (mg/mL) at Different Hours of Incubation | SARA/Control | ADY | ADYT | SEM | p-Value |
---|---|---|---|---|---|
3 h | 5.41 | 18.30 | 18.54 | 0.71 | 0.849 |
6 h | 5.59 | 22.43 | 21.88 | 0.070 | 0.697 |
9 h | 5.69 | 23.44 | 24.47 | 0.089 | 0.56 |
12 h | 5.88 | 30.33 | 29.28 | 0.073 | 0.508 |
24 h | 6.25 b | 6.35 ab | 6.43 a | 0.050 | 0.30 |
Items | SARA/Control | ADY | ADYT | SEM | p-Value |
---|---|---|---|---|---|
TVFA (mmol/L) | 113.03 b | 124.27 ab | 132.91 a | 6.40 | 0.056 |
Acetic Acid (%) | 51.91 c | 56.15 b | 61.16 a | 1.41 | 0.002 |
Propionic Acid (%) | 28.65 a | 23.34 b | 21.23 b | 1.003 | 0.001 |
Butyric Acid (%) | 15.85 | 16.51 | 13.50 | 1.57 | 0.216 |
Isobutyric Acid (%) | 0.68 c | 0.88 b | 1.43 a | 0.035 | 0.000 |
Isovaleric Acid (%) | 1.52 a | 1.35 b | 1.54 a | 0.068 | 0.061 |
Valeric Acid% | 1.39 b | 1.77 a | 1.25 c | 0.039 | 0.001 |
A/P | 1.81 c | 2.40 b | 2.89 a | 0.085 | 0.002 |
LPS (EU/mL) | 17,857.81 a | 13,051.27 b | 9875.32 c | 1211.23 | 0.002 |
Items | SARA/Control | ADY | ADYT | SEM | p-Value |
---|---|---|---|---|---|
S. bovis | 1.00 a | 0.833 a | 0.59 b | 0.07 | 0.003 |
P. albensis | 1.00 a | 0.72 b | 0.53 c | 0.058 | 0.001 |
Lactobaciilli | 1.00 a | 0.78 b | 0.44 c | 0.082 | 0.001 |
Anaerobic lyplitica | 1.00 b | 1.23 b | 1.62 a | 0.096 | 0.002 |
M. elsdenii | 1.00 b | 1.20 b | 1.65 a | 0.132 | 0.007 |
R. albus | 1.00 b | 1.43 b | 1.76 a | 0.142 | 0.005 |
S. ruminantium | 1.00 b | 1.17 b | 1.61 a | 0.084 | 0.001 |
F. succinogenes | 1.00 c | 1.24 b | 1.76 a | 0.1150 | 0.002 |
Protozoa | 1.00 b | 1.12 b | 1.77 a | 0.098 | 0.007 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ahmed, G.; Wang, H. Active Dry Yeast and Thiamine in Synergistic Mode Can Mitigate Adverse Effects of In Vitro Ruminal Acidosis Model of Goats. Animals 2022, 12, 2333. https://doi.org/10.3390/ani12182333
Ahmed G, Wang H. Active Dry Yeast and Thiamine in Synergistic Mode Can Mitigate Adverse Effects of In Vitro Ruminal Acidosis Model of Goats. Animals. 2022; 12(18):2333. https://doi.org/10.3390/ani12182333
Chicago/Turabian StyleAhmed, Gulzar, and Hongrong Wang. 2022. "Active Dry Yeast and Thiamine in Synergistic Mode Can Mitigate Adverse Effects of In Vitro Ruminal Acidosis Model of Goats" Animals 12, no. 18: 2333. https://doi.org/10.3390/ani12182333
APA StyleAhmed, G., & Wang, H. (2022). Active Dry Yeast and Thiamine in Synergistic Mode Can Mitigate Adverse Effects of In Vitro Ruminal Acidosis Model of Goats. Animals, 12(18), 2333. https://doi.org/10.3390/ani12182333