Next Article in Journal
Effects of Essential Oil Blends on In Vitro Apparent and Truly Degradable Dry Matter, Efficiency of Microbial Production, Total Short-Chain Fatty Acids and Greenhouse Gas Emissions of Two Dairy Cow Diets
Next Article in Special Issue
Porcine Epidemic Diarrhea Virus: Etiology, Epidemiology, Antigenicity, and Control Strategies in China
Previous Article in Journal
Phenol-Rich Botanicals Modulate Oxidative Stress and Epithelial Integrity in Intestinal Epithelial Cells
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Brief Report

Molecular Characterization and Phylogenetic Analysis of a Variant Recombinant Porcine Epidemic Diarrhea Virus Strain in China

1
Faculty of Agriculture, Forestry and Food Engineering, Yibin Key Laboratory of Zoological Diversity and Ecological Conservation, Yibin Animal and Plant Inspection and Quarantine Engineering Technology Research Center, Yibin University, Yibin 644000, China
2
Guangdong Laboratory Animals Monitoring Institute, Guangdong Provincial Key Laboratory of Laboratory Animals, Guangzhou 510633, China
3
Beijing Senkang Biotech Development Co., Ltd., Beijing 100000, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Animals 2022, 12(17), 2189; https://doi.org/10.3390/ani12172189
Submission received: 29 July 2022 / Revised: 21 August 2022 / Accepted: 23 August 2022 / Published: 25 August 2022
(This article belongs to the Special Issue New Perspectives in Porcine Epidemic Diarrhea Virus (PEDV))

Abstract

Simple Summary

We successfully isolated and identified PEDV strain SC-YB73. The sequence analysis of the SC-YB73 genome identified a six-nucleotide insertion in the E gene, which has not previously been detected in PEDV strains. The phylogenetic analysis based on the complete genome showed that SC-YB73 was clustered in variant subgroup GII-a, which is widely prevalent in the Chinese pig population. The recombination analysis suggested that SC-YB73 originated from the recombination of GDS47, US PEDV prototype-like strains TW/Yunlin550/2018, and COL/Cundinamarca/2014. In future research, we aim to evaluate the function of E-gene insertions using in vitro cellular culture and in vivo animal experiments.

Abstract

Since 2010, a variant of porcine epidemic diarrhea virus (PEDV) has re-emerged in several provinces of China, resulting in severe economic losses for the pork industry. Here, we isolated and identified a variant PEDV strain, SC-YB73, in Guangdong Province, China. The pathological observations of jejunum showed atrophy of villi and edema in the lamina propria. The sequence analysis of the viral genome identified a six-nucleotide insertion in the E gene, which has not previously been detected in PEDV strains. Furthermore, 50 nucleotide sites were unique in SC-YB73 compared with 27 other PEDV strains. The phylogenetic analysis based on the complete genome showed that SC-YB73 was clustered in variant subgroup GII-a, which is widely prevalent in the Chinese pig population. The recombination analysis suggested that SC-YB73 originated from the recombination of GDS47, US PEDV prototype-like strains TW/Yunlin550/2018, and COL/Cundinamarca/2014. In the present study, we isolated and genetically characterized a variant PEDV strain, thus providing essential information for the control of PED outbreaks in China.

1. Introduction

Porcine epidemic diarrhea virus (PEDV) is the etiological agent of porcine epidemic diarrhea (PED). First identified in 1978, the virus can cause severe diarrhea with high morbidity in neonatal piglets [1]. PEDV is an enveloped, single-stranded, positive-sense RNA virus belonging to genus Alphacoronavirus and possessing a large (28 kb) genome. Two-thirds of the RNA genome is comprised of open reading frames (ORFs) 1a and 1b, encoding RNA replicase, while the 3′ one-third of the genome is comprised of genes encoding structural and non-structural proteins [2,3,4,5].
From 1984 to 2010, no large-scale PED outbreaks were recorded in China, with only sporadic occurrences in the pig population [6]. At the end of 2010, however, an outbreak involving variant PEDV strains rapidly spread across southern China, resulting in considerable economic losses for the pig industry [7,8]. Based on their complete genome sequences, PEDV can be classified into genotype I and II (GI and GII) groups [9,10]. The GI group contains classical strains and includes the GI-a, GI-b, and GI-c subgroups. The GII group comprises so-called variant strains and includes the GII-a and GII-b subgroups. In China, GII group variants are highly virulent and dominant pandemic strains in the pig population [10,11,12], whereas classical strains in the GI group, including GI-a, GI-b, and GI-c, are uncommon [13,14,15].
In this study, we isolated PEDV strain SC-YB73 from the intestinal contents of piglets in Guangdong Province, China. To better understand the molecular characteristics of this isolate, we obtained its complete genome sequence. This study provides molecular and phylogenetic information on a Chinese isolate of PEDV, which may help elucidate the genetic evolution of PEDV in China.

2. Methods

2.1. Ethics Statement

Fecal and small-intestine tissues were collected by a farmer and given to us for pathogen diagnosis. In this process, we did not come into direct contact with the animal samples.

2.2. Viral Isolation and Identification

The study site was a sow farm in Guangdong, China. The farm contained 200 pigs, which were not immunized with any PEDV vaccine prior to conception. In 2019, 20 out of 100 piglets on the farm developed yellow watery diarrhea, vomiting, and rapid weight loss, with death occurring within two days. Two samples were obtained from each dead piglet, and two samples were collected from dead piglets without apparent clinical signs. Previously established polymerase chain reaction (PCR) protocols were performed to detect four major diarrhea-associated viruses, i.e., PEDV [16], porcine deltacoronavirus (PDCoV) [17], transmissible gastroenteritis virus (TGEV) [16], and porcine rotavirus (PoRV) [18].
Small-intestine tissues were suspended in 20% (w/v) Dulbecco’s modified Eagle medium (DMEM; Gibco, Grand Island, NY, USA); then, they were vortexed and centrifuged at 5000× g for 5 min to harvest the supernatant. The supernatant was filtered through a 0.22-μm filter (Millipore, Billerica, MA, USA) and inoculated with the VERO-E6 cell line (ATCC; CCL-81). After three rounds of purification using a plaque assay [19], the virus was purified and harvested through one cycle of freezing and thawing. Virus titer was measured using the Reed–Muench method [20].

2.3. Extraction of Viral RNA, Reverse Transcription PCR (RT-PCR), and Complete Genome Sequencing

Viral RNA extraction and RT-PCR analysis were performed as previously described [16]. The 15 pairs of primers used are listed in Table 1. Two primers (5′ RACE and 3′ RACE) were employed to confirm the 5′ and 3′ ends of the viral genome via rapid amplification of cDNA ends (RACE) using a RACE cDNA Amplification kit (Invitrogen, Carlsbad, CA, USA) (Table 1). The PCR products were run on agarose gels, and correctly sized amplicons were observed. The PCR products were then purified using an Axygen Gel Extraction kit (Axygen, Union City, CA, USA) and cloned into the pMD18-T vector (TaKaRa, Tokyo, Japan). Three to five independent clones of each PEDV amplicon were sequenced. DNA was sequenced using an ABI 3730XL Sanger-based genetic analyzer (Applied Biosystems, Waltham, MA, USA).

2.4. Electron Microscopy and Pathology

Electron microscopy was performed following previous research [16]. Hematoxylin and eosin (H&E) staining of ileum samples was carried out according to the protocols described in [21].

2.5. Sequence Alignment and Phylogenetic and Recombination Analyses

Phylogenetic trees based on the complete genome and spike sequences were constructed using the neighbor joining (NJ) method in MEGA v4.0. Bootstrap values were estimated for 1000 replicates. Simplot v3.5.1 was used for nucleotide sequence comparison of SC-YB73 to the reference PEDV strains. The sequences obtained in this study were assembled and submitted to GenBank (accession number MT263014).

3. Results

3.1. Virus Isolation and Identification

The PCR results confirmed that the two small-intestine samples were only positive for the PEDV strain SC-YB73 (data not shown). The other two samples were negative for PEDV, PDCoV, TGEV, and PoRV. At the beginning of passage five (P5), typical cytopathic effects (CPE) were found in VERO-E6 cells (data not shown). Following this, the SC-YB73 strain was purified through three rounds of plaque cloning and serially passaged for three generations in VERO-E6 cells. SC-YB73 titer (6.5 × 106 TCID50/mL) was measured in VERO-E6 cells. The classical coronavirus shape was confirmed using electron microscopy, with virions measuring approximately 150 nm in diameter (Figure 1A,B). The histopathological analysis showed the shedding of intestinal villi, the degeneration and necrosis of mucosal epithelium, the infiltration of inflammatory cells in the mucosa and submucosal interstitium, the edema of submucosa and muscularis, and the congestion of blood vessels (Figure 2A,B).

3.2. Phylogenetic Analysis and Recombination of SC-YB73

The genome sequence of the SC-YB73 strain was 28,040 nucleotide (nt) long. Whole-genome sequence alignment showed nucleotide homologies of 95.9% (CH/HB2/2018) to 99.6% (85/7/c40) between the SC-YB73 strain and 27 PEDV domestic reference strains. Based on the complete genome sequence, 50 unique positions were identified in SC-YB73 that were not found in the 27 other strains, suggesting that SC-YB73 possesses several novel characteristics (Table S1). A comparative sequence analysis identified a 6 nt insertion in the E gene of SC-YB73 not present in the other PEDV strains. The insertion did not change the existing ORF, with only two additional amino acids being produced (Figure 3A,B). The phylogenetic analysis indicated that the SC-YB73 strain, along with domestic strains CH-HB2-2018, GDS47, JS-HZ2012, CH_ZMDZY_11, and SNJ-P, belonged to the GII-a subgroup and formed a single branch. In addition, the US PEDV prototype-like strain GDS21 isolated in Guangdong in 2014 was closely related to PC21A, TC-PC21A-(PE103)-P4, IA49379, TW-Yulin550-2018, and COL/Cundinamarca/2014. These findings suggest that different PEDV strains, i.e., SC-YB73, GDS47, and GDS21, have been circulating in Guangdong since 2014 (Figure 4A). The S gene of SC-YB73 was closely clustered with domestic strains CH-HB2-2018 and SNJ-P (Figure 4B). A Simplot (v3.5.1) analysis was performed to identify possible recombination events and breakpoints in the complete nucleotide sequence of the SC-YB73 genome. The results indicated that SC-YB73 is probably a recombinant from GDS47, US PEDV prototype-like strains TW/Yunlin550/2018, and COL/Cundinamarca/2014, with crossover events having been detected (Figure 5) and recombination event breakpoints within the E, M, and N genes.

4. Discussion

As an evolutionary driving force, mutations such as point mutations, insertions, and deletions in structural and non-structural proteins have led to changes in the tropism and virulence of coronaviruses [22,23,24]. For example, deletions in the spike protein and ORF3 in TGEV result in a tropism shift from the intestinal to respiratory tract [25,26]. Deletions in ORF3abc in canine coronavirus HLJ-073 result in changes in cell tropism [24]. In the case of PEDV, deletions and insertions in the spike protein and ORF3 [27,28,29], as well as mutations in those genes, are closely related to viral replication and pathogenicity [2,4,5,30]. For example, HM2017 contains two insertions in the S gene [27]; HLJBY shows a 133-amino-acid deletion in ORF3 [28]; and 15 novel PEDV variants identified in Japan exhibit large genomic deletions [29]. Here, using PCR and pathological analyses, we isolated a novel PEDV strain, SC-YB73, in China. Based on sequencing analysis, no deletions were found in the complete sequence, and six nucleotides were inserted in the E gene without disrupting the ORF, resulting in two additional amino acids. This is the first report of an insertion in the E gene. Previous studies have suggested that the function of the E and M proteins in murine hepatitis virus (MHV) is to promote particle formation and secretion [31,32]. Whether the biological function of the SC-YB73 E protein affects pathogenicity needs further study. In addition, SC-YB73 may be virulent to piglets and exhibited 50 unique positions in the complete genome compared with 27 other strains. The positions in SC-YB73 were distinct from any other Chinese and non-Chinese strains, suggesting that the strain has antigenic variation or different biological activity and underwent a rapid evolutionary process. Further experiments are needed to evaluate the pathogenicity of SC-YB73 and the relationship between pathogenicity and the unique positions in the complete genome.
Another evolutionary driver is recombination, which plays an important role in the evolution of PEDV, leading to the emergence of highly virulent and immunogenic mutant strains (6,10). In this study, SC-YB73 showed evidence of potential recombination events from GDS47, US PEDV prototype strains TW/Yunlin550/2018, and COL/Cundinamarca/2014. Furthermore, the analyses confirmed the probable occurrence of recombination in the E, M, and N genes of SC-YB73. Thus, these results suggest that SC-YB73 was generated via the recombination of Guangdong circulating strains and US PEDV prototype strains. This represents a potential biosafety concern, as foreign strains can cause antigen mutations through recombination with circulating strains. In addition, recombination within subgroups is a common phenomenon and a driving force of PEDV evolution. Therefore, there is a growing need for novel effective and safe vaccines against PEDV. It is also important that PEDV outbreaks be examined in the context of new recombinant variants and that preventive measures against antigenic variation be considered.

5. Conclusions

We successfully isolated and identified PEDV strain SC-YB73. Based on a comparative sequence analysis with other PEDV strains, we gained a comprehensive understanding of the mutation and recombination of the PEDV strain. In future research, we aim to evaluate the function of E-gene insertions using in vitro cellular culture and in vivo animal experiments.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani12172189/s1, Table S1: Multiple sequence alignment of PEDV strains.

Author Contributions

Conceptualization, F.C., Y.L. and X.H.; methodology, X.H., Y.S., Y.L. and Y.H.; validation, Y.L., X.L., Y.D., H.F., Z.T. and Y.S.; formal analysis, X.H., Z.T., Y.L. and Y.D.; investigation, Y.H., X.L., Y.D. and M.L.; resources, X.H., Y.L., Z.T. and F.C.; data curation, X.H., Y.L., Z.T., M.L., H.F. and F.C.; writing—original draft preparation, X.H., Y.L., Y.H., X.L. and H.F.; writing—review and editing, X.H., Z.T., X.L., Y.H., M.L., Y.L. and F.C.; visualization, X.H., Y.S., Y.D., H.F. and M.L.; supervision, F.C. and X.H.; project administration, X.H. and F.C.; funding acquisition, X.H., F.C., Y.L. and Z.T. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Doctor Launch Project of Yibin University (2019QD09 and 2019QD10), Research and Development Projects in Key Areas of Guangdong Province (2020B1111320001 and 2020A1111280010), and National Key R&D Program of China (2021YFF0703300). The funders had no role in study design and data analysis, nor in the decision to publish or prepare the manuscript.

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki, and approved by the Ethics Committee of Yibin University (approval ID: YB2019–0005 and 1 July 2019).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are openly available in GenBank database, accession number [MT263014].

Conflicts of Interest

The authors declare no conflict of interest.

Availability of Data and Materials

The DNA sequences obtained in this study were submitted to the GenBank database (accession number: MT263014).

Abbreviations

Porcine epidemic diarrhea virus (PEDV); open reading frames (ORFs); porcine deltacoronavirus (PDCoV); transmissible gastroenteritis virus (TGEV); porcine rotavirus (PoRV); rapid amplification of cDNA ends (RACE); neighbor joining (NJ); nucleotides (nt); median tissue culture infective dose (TCID50); insertions and deletions (INDELs); Dulbecco’s modified Eagle medium (DMEM).

References

  1. Pensaert, M.B.; de Bouck, P. A new coronavirus-like particle associated with diarrhea in swine. Arch. Virol. 1978, 58, 243–247. [Google Scholar] [CrossRef] [PubMed]
  2. Kaewborisuth, C.; He, Q.; Jongkaewwattana, A. The Accessory Protein ORF3 Contributes to Porcine Epidemic Diarrhea Virus Replication by Direct Binding to the Spike Protein. Viruses 2018, 10, 399. [Google Scholar] [CrossRef]
  3. Lee, C. Porcine epidemic diarrhea virus: An emerging and re-emerging epizootic swine virus. Virol. J. 2015, 12, 193. [Google Scholar] [CrossRef] [PubMed]
  4. Si, F.; Hu, X.; Wang, C.; Chen, B.; Wang, R.; Dong, S.; Yu, R.; Li, Z. Porcine Epidemic Diarrhea Virus (PEDV) ORF3 Enhances Viral Proliferation by Inhibiting Apoptosis of Infected Cells. Viruses 2020, 12, 214. [Google Scholar] [CrossRef] [PubMed]
  5. Si, F.; Chen, B.; Hu, X.; Yu, R.; Dong, S.; Wang, R.; Li, Z. Porcine Epidemic Diarrhea Virus ORF3 Protein Is Transported through the Exocytic Pathway. J. Virol. 2020, 94, e00808-20. [Google Scholar] [CrossRef] [PubMed]
  6. Sun, D.; Wang, X.; Wei, S.; Chen, J.; Feng, L. Epidemiology and vaccine of porcine epidemic diarrhea virus in China: A mini-review. J. Vet. Med. Sci. 2016, 78, 355–363. [Google Scholar] [CrossRef]
  7. Li, W.; Li, H.; Liu, Y.; Pan, Y.; Deng, F.; Song, Y.; Tang, X.; He, Q. New variants of porcine epidemic diarrhea virus, China, 2011. Emerg. Infect. Dis. 2012, 18, 1350–1353. [Google Scholar] [CrossRef]
  8. Chen, J.; Liu, X.; Shi, D.; Shi, H.; Zhang, X.; Feng, L. Complete genome sequence of a porcine epidemic diarrhea virus variant. J. Virol. 2012, 86, 3408. [Google Scholar] [CrossRef]
  9. Hanke, D.; Pohlmann, A.; Sauter-Louis, C.; Höper, D.; Stadler, J.; Ritzmann, M.; Steinrigl, A.; Schwarz, B.A.; Akimkin, V.; Fux, R.; et al. Porcine epidemic diarrhea in Europe: In-detail analyses of disease dynamics and molecular epidemiology. Viruses 2017, 9, 177. [Google Scholar] [CrossRef]
  10. Guo, J.; Fang, L.; Ye, X.; Chen, J.; Xu, S.; Zhu, X.; Miao, Y.; Wang, D. Evolutionary and genotypic analyses of global porcine epidemic diarrhea virus strains. Transbound. Emerg. Dis. 2019, 66, 111–118. [Google Scholar] [CrossRef]
  11. Sun, Y.; Chen, Y.; Han, X.; Yu, Z.; Wei, Y.; Zhang, G. Porcine epidemic diarrhea virus in Asia: An alarming threat to the global pig industry. Infect. Genet. Evol. J. Mol. Epidemiol. Evol. Genet. Infect. Dis. 2019, 70, 24–26. [Google Scholar] [CrossRef] [PubMed]
  12. Zhu, T.; Du, S.; Cao, D.; Pei, Z.; Guo, Y.; Shao, H.; Wang, H.; Wang, K.; Hu, G. Isolation and identification of a variant subtype G 2b porcine epidemic diarrhea virus and S gene sequence characteristic. Infect. Genet. Evol. J. Mol. Epidemiol. Evol. Genet. Infect. Dis. 2019, 71, 82–90. [Google Scholar] [CrossRef] [PubMed]
  13. Vlasova, A.N.; Marthaler, D.; Wang, Q.; Culhane, M.R.; Rossow, K.D.; Rovira, A.; Collins, J.; Saif, L.J. Distinct characteristics and complex evolution of PEDV strains, North America, May 2013–February 2014. Emerg. Infect. Dis. 2014, 20, 1620–1628. [Google Scholar] [CrossRef] [PubMed]
  14. Li, R.; Qiao, S.; Yang, Y.; Guo, J.; Xie, S.; Zhou, E.; Zhang, G. Genome sequencing and analysis of a novel recombinant porcine epidemic diarrhea virus strain from Henan, China. Virus Genes 2016, 52, 91–98. [Google Scholar] [CrossRef] [PubMed]
  15. Chen, Q.; Gauger, P.C.; Stafne, M.R.; Thomas, J.T.; Madson, D.M.; Huang, H.; Zheng, Y.; Li, G.; Zhang, J. Pathogenesis comparison between the United States porcine epidemic diarrhoea virus prototype and S-INDEL-variant strains in conventional neonatal piglets. J. Gen. Virol. 2016, 97, 1107–1121. [Google Scholar] [CrossRef]
  16. Hu, X., Jr.; Li, N., Jr.; Tian, Z., Jr.; Yin, X., Jr.; Qu, L.; Qu, J. Molecular characterization and phylogenetic analysis of transmissible gastroenteritis virus HX strain isolated from China. BMC Vet. Res. 2015, 11, 72. [Google Scholar] [CrossRef]
  17. Song, D.; Zhou, X.; Peng, Q.; Chen, Y.; Zhang, F.; Huang, T.; Zhang, T.; Li, A.; Huang, D.; Wu, Q.; et al. Newly emerged porcine deltacoronavirus associated with diarrhoea in swine in China: Identification, prevalence and full-length genome sequence analysis. Transbound. Emerg. Dis. 2015, 62, 575–580. [Google Scholar] [CrossRef]
  18. Nagai, M.; Shimada, S.; Fujii, Y.; Moriyama, H.; Oba, M.; Katayama, Y.; Tsuchiaka, S.; Okazaki, S.; Omatsu, T.; Furuya, T.; et al. H2 genotypes of G4P[6], G5P[7], and G9[23] porcine rotaviruses show super-short RNA electropherotypes. Vet. Microbiol. 2015, 176, 250–256. [Google Scholar] [CrossRef]
  19. Tuchiya, K.; Kasaoka, T.; Azetaka, M.; Takahashi, E.; Konishi, S. Plaque assay for canine coronavirus in CRFK cells. Nihon Juigaku Zasshi Jpn. J. Vet. Sci. 1987, 49, 571–573. [Google Scholar] [CrossRef][Green Version]
  20. Pizzi, M. Sampling variation of the fifty percent end-point, determined by the Reed-Muench (Behrens) method. Hum. Biol. 1950, 22, 151–190. [Google Scholar]
  21. Liu, Q.; Zhang, Y.L.; Hu, S.P.; Ma, Z.L.; Gao, S.L.; Sun, B.; Xiao, F.; Zhang, Z.; Cai, X.H.; He, X.J. Expression of immunoproteasome subunits in the porcine lung: Alterations during normal and inflammatory conditions. Vet. Microbiol. 2017, 210, 134–141. [Google Scholar] [CrossRef] [PubMed]
  22. Laude, H.; Van Reeth, K.; Pensaert, M. Porcine respiratory coronavirus: Molecular features and virus-host interactions. Vet. Res. 1993, 24, 125–150. [Google Scholar] [PubMed]
  23. Guan, Y.; Zheng, B.J.; He, Y.Q.; Liu, X.L.; Zhuang, Z.X.; Cheung, C.L.; Luo, S.W.; Li, P.H.; Zhang, L.J.; Guan, Y.J.; et al. Isolation and characterization of viruses related to the SARS coronavirus from animals in southern China. Science 2003, 302, 276–278. [Google Scholar] [CrossRef] [PubMed]
  24. Chen, S.; Liu, D.; Tian, J.; Kang, H.; Guo, D.; Jiang, Q.; Liu, J.; Li, Z.; Hu, X. Molecular characterization of HLJ-073, a recombinant canine coronavirus strain from China with an ORF3abc deletion. Arch. Virol. 2019, 164, 2159–2164. [Google Scholar] [CrossRef]
  25. Kim, L.; Hayes, J.; Lewis, P.; Parwani, A.V.; Chang, K.O.; Saif, L.J. Molecular characterization and pathogenesis of transmissible gastroenteritis coronavirus (TGEV) and porcine respiratory coronavirus (PRCV) field isolates co-circulating in a swine herd. Arch. Virol. 2000, 145, 1133–1147. [Google Scholar] [CrossRef]
  26. Britton, P.; Mawditt, K.L.; Page, K.W. The cloning and sequencing of the virion protein genes from a British isolate of porcine respiratory coronavirus: Comparison with transmissible gastroenteritis virus genes. Virus Res. 1991, 21, 181–198. [Google Scholar] [CrossRef]
  27. Yang, D.; Su, M.; Li, C.; Zhang, B.; Qi, S.; Sun, D.; Yin, B. Isolation and characterization of a variant subgroup GII-a porcine epidemic diarrhea virus strain in China. Microb. Pathog. 2020, 140, 103922. [Google Scholar] [CrossRef]
  28. Huan, C.; Pan, H.; Fu, S.; Xu, W.; Gao, Q.; Wang, X.; Gao, S. Characterization and evolution of the coronavirus porcine epidemic diarrhoea virus HLJBY isolated in China. Transbound. Emerg. Dis. 2020, 67, 65–79. [Google Scholar] [CrossRef]
  29. Diep, N.V.; Norimine, J.; Sueyoshi, M.; Lan, N.T.; Yamaguchi, R. Novel porcine epidemic diarrhea virus (PEDV) variants with large deletions in the spike (S) gene coexist with PEDV strains possessing an intact S gene in domestic pigs in Japan: A new disease situation. PLoS ONE 2017, 12, e0170126. [Google Scholar] [CrossRef]
  30. Wang, D.; Ge, X.; Chen, D.; Li, J.; Cai, Y.; Deng, J.; Zhou, L.; Guo, X.; Han, J.; Yang, H. The S Gene Is Necessary but Not Sufficient for the Virulence of Porcine Epidemic Diarrhea Virus Novel Variant Strain BJ2011C. J. Virol. 2018, 92, e00603-18. [Google Scholar] [CrossRef]
  31. Bos, E.C.; Luytjes, W.; van der Meulen, H.V.; Koerten, H.K.; Spaan, W.J. The production of recombinant infectious DI-particles of a murine coronavirus in the absence of helper virus. Virology 1996, 218, 52–60. [Google Scholar] [CrossRef] [PubMed]
  32. Vennema, H.; Godeke, G.J.; Rossen, J.W.; Voorhout, W.F.; Horzinek, M.C.; Opstelten, D.J.; Rottier, P.J. Nucleocapsid-independent assembly of coronavirus-like particles by co-expression of viral envelope protein genes. EMBO J. 1996, 15, 2020–2028. [Google Scholar] [CrossRef] [PubMed]
Figure 1. (A) Electron micrograph of purified isolate negatively stained with 2% phosphotungstic acid. (B) Ultra-thin sections of infected VERO-E6 cells displaying typical viral particles, organized as paracrystalline structures within cytosol. Scale bar, 200 nm.
Figure 1. (A) Electron micrograph of purified isolate negatively stained with 2% phosphotungstic acid. (B) Ultra-thin sections of infected VERO-E6 cells displaying typical viral particles, organized as paracrystalline structures within cytosol. Scale bar, 200 nm.
Animals 12 02189 g001
Figure 2. Pathology of jejunum villi of piglet samples: (A) control and (B) diseased piglets.
Figure 2. Pathology of jejunum villi of piglet samples: (A) control and (B) diseased piglets.
Animals 12 02189 g002
Figure 3. Multiple sequence alignment of E gene of PEDV strains (A) and partial-Sanger-sequencing peak map for SC-YB73 (B). The red box was present the six nucleotide acid insertions.
Figure 3. Multiple sequence alignment of E gene of PEDV strains (A) and partial-Sanger-sequencing peak map for SC-YB73 (B). The red box was present the six nucleotide acid insertions.
Animals 12 02189 g003
Figure 4. Phylogenetic analyses of complete sequence (A) and spike sequence (B) regions of SC-YB73 and most closely related strains in GenBank for which whole genome sequences were available. Neighbor joining was used for the construction of the phylogenetic tree with 1000 bootstrap replicates shown at branches. Scale bar represents p-distance. Red circle represents isolated strain in this study. Green circles represent possible recombinant strains. Black triangles represent US-PEDV-S-INDEL-variant-like strains. Black squares represent US PEDV prototype-like strains. CHN, China; USA, United States of America; GER, Germany; BEL, Belgium; COL, Columbia; KR, Republic of Korea; MEX, Mexico; FRA, France; ITA, Italy.
Figure 4. Phylogenetic analyses of complete sequence (A) and spike sequence (B) regions of SC-YB73 and most closely related strains in GenBank for which whole genome sequences were available. Neighbor joining was used for the construction of the phylogenetic tree with 1000 bootstrap replicates shown at branches. Scale bar represents p-distance. Red circle represents isolated strain in this study. Green circles represent possible recombinant strains. Black triangles represent US-PEDV-S-INDEL-variant-like strains. Black squares represent US PEDV prototype-like strains. CHN, China; USA, United States of America; GER, Germany; BEL, Belgium; COL, Columbia; KR, Republic of Korea; MEX, Mexico; FRA, France; ITA, Italy.
Animals 12 02189 g004
Figure 5. Recombination analysis of PEDV strains. Crossover region in SC-YB73 genome was detected with Simplot v3.5.1. Y-axis shows percentage of permuted trees employing a sliding window of 200 nucleotides (nt) and step size of 20 nt. Other parameters used included Kimura (2-parameter) distance model, 2.0 Ts/Tv ratio, neighbor-joining tree model, and 1000 bootstrap replicates. COL/Cundinamarca/2014:KU569509/2014/COL; GDS47:MH726382/2016/CHN; TW/Yunlin550/2018:MK673545/2019/CHN.
Figure 5. Recombination analysis of PEDV strains. Crossover region in SC-YB73 genome was detected with Simplot v3.5.1. Y-axis shows percentage of permuted trees employing a sliding window of 200 nucleotides (nt) and step size of 20 nt. Other parameters used included Kimura (2-parameter) distance model, 2.0 Ts/Tv ratio, neighbor-joining tree model, and 1000 bootstrap replicates. COL/Cundinamarca/2014:KU569509/2014/COL; GDS47:MH726382/2016/CHN; TW/Yunlin550/2018:MK673545/2019/CHN.
Animals 12 02189 g005
Table 1. Primers used for identifying and sequencing the PEDV SC-YB73 strain.
Table 1. Primers used for identifying and sequencing the PEDV SC-YB73 strain.
NameSequence (5′-3′)Position
Porf3-UGGAGCTCAATGTAGTTCCAA24,886–24,905
Porf3-LAGCTGCTTTACCATTGAGGA25,185–25,204
1-FAGCTCTTTCTCTAGACTCTT32–51
1-RAGCTGCTCCCAAGCTGCGCT1511–1530
2-FTTTTTGAATGACTCGAGCAT1331–1350
2-RTAAACTGGGTCAATGGTTCT3011–3030
3-FGAATTAGAAGAGACGACATT2831–2850
3-RTGTCATAATTAGCATCACCA5011–5030
4-FTACAAATTCCAATTTGGATT4831–4850
4-RAATAAAAGTGCAGCCTGGAC7011–7030
5-FATGTTTTCCTTGGCTGCGAT6831–6850
5-RTCAAAAGAGCCTACGAACTT9011–9030
6-FTTGTACTTTTTGTGCACTAA8831–8850
6-RGTTAGCAACCATATACTTAA10,911–10,930
7-FCTACGGTATTCTCTACTGGT10,831–10,850
7-RAGAACTTAACGCATTTAAGC13,131–13,150
8-FACCGAGTATACTATGATGGA12,931–12,950
8-RGTTTTGTTGTGGCGGTAGTT16,011–16,030
9-FACAGGTTGGCAAATGATGTC15,731–15,750
9-RCGGTATATTTACAGACATCC19,011–19,030
10-FGTTAGAGATGGTACTGTTGA18,811–18,830
10-RGGGCCTAATGTTTTAATGCT21,021–21,040
11-FCTGTGCTGGCCAACATCCAA20,831–20,850
11-RATTAGAATGGTAGAAGAAAC22,831–22,850
12-FGCTTTAGAGGTGAGGGTATC22,600–22,619
12-RATCACCCGGTACAAGTACTG24,100–24,119
13-FGTCAAATCGCAATCTCAGCG24,000–24,019
13-RTATAATAAGCAGGAAAAAGA25,516–25,535
14-FTCAATTCAACTAGACGAGTA25,430–25,449
14-RTCTGTTCTTGGACTGGTTAC26,986–27,005
15-FCTACTTCACGTGCAAACTCA26,806–26,825
15-RTATCAACACCGTCAGGTCTT28,016–28,035
5′RACEGCCCACATACGCACTAAGCT501–520
3′RACEACTGGCTTATTCTGGCTATG27,721–27,740
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Hu, X.; Lian, Y.; He, Y.; Liu, X.; Tian, Z.; Dai, Y.; Liu, M.; Fan, H.; Shi, Y.; Cong, F. Molecular Characterization and Phylogenetic Analysis of a Variant Recombinant Porcine Epidemic Diarrhea Virus Strain in China. Animals 2022, 12, 2189. https://doi.org/10.3390/ani12172189

AMA Style

Hu X, Lian Y, He Y, Liu X, Tian Z, Dai Y, Liu M, Fan H, Shi Y, Cong F. Molecular Characterization and Phylogenetic Analysis of a Variant Recombinant Porcine Epidemic Diarrhea Virus Strain in China. Animals. 2022; 12(17):2189. https://doi.org/10.3390/ani12172189

Chicago/Turabian Style

Hu, Xiaoliang, Yuexiao Lian, Yucan He, Xiangxiao Liu, Zhige Tian, Yi Dai, Mengyuan Liu, Huayan Fan, Yue Shi, and Feng Cong. 2022. "Molecular Characterization and Phylogenetic Analysis of a Variant Recombinant Porcine Epidemic Diarrhea Virus Strain in China" Animals 12, no. 17: 2189. https://doi.org/10.3390/ani12172189

APA Style

Hu, X., Lian, Y., He, Y., Liu, X., Tian, Z., Dai, Y., Liu, M., Fan, H., Shi, Y., & Cong, F. (2022). Molecular Characterization and Phylogenetic Analysis of a Variant Recombinant Porcine Epidemic Diarrhea Virus Strain in China. Animals, 12(17), 2189. https://doi.org/10.3390/ani12172189

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop