Effect of a Phytogenic Feed Additive on Growth Performance, Nutrient Digestion, and Immune Response in Broiler-Fed Diets with Two Different Levels of Crude Protein
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Treatments
2.2. Birds Husbandry and Sample Collection
2.3. Chemical Analysis
2.4. Isolation of mRNA and RT-qPCR
2.5. Enzyme Activity Assay
2.6. Statistical Analysis
3. Results and Discussions
3.1. Growth Performance
3.2. Nutrient Digestibility
3.3. Gene Expression of Transporter and Immunity
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- The European Parliament and the Council of the European Union. Regulation No 1831/2003 of the European Parliament and Council of 22 September 2003 on additives for use in animal nutrition. Off. J. Eur. Union 2003, 268, 29–43. [Google Scholar]
- Jamroz, D.; Wiliczkiewicz, A.; Wertelecki, T.; Orda, J.; Skorupińska, J. Use of active substances of plant origin in chicken diets based on maize and locally grown cereals. Br. Poult. Sci. 2005, 46, 485–493. [Google Scholar] [CrossRef]
- Hong, J.-C.; Steiner, T.; Aufy, A.; Lien, T.-F. Effects of supplemental essential oil on growth performance, lipid metabolites and immunity, intestinal characteristics, microbiota and carcass traits in broilers. Livest. Sci. 2012, 144, 253–262. [Google Scholar] [CrossRef]
- Murugesan, G.R.; Syed, S.B.; Haldar, S.; Pender, C. Pender. Phytogenic feed additives as an alternative to antibiotic growth promoters in broiler chickens. Front. Vet. Sci. 2015, 2, 21. [Google Scholar]
- Liu, N.; Wang, J.; Gu, K.; Deng, Q.; Wang, J. Effects of dietary protein levels and multienzyme supplementation on growth performance and markers of gut health of broilers fed a miscellaneous meal based diet. Anim. Feed. Sci. Technol. 2017, 234, 110–117. [Google Scholar] [CrossRef]
- Liu, N.; Wang, J.; Liu, Z.; Chen, Y.; Wang, J.P. Tetramethylpyrazine attenuates necrotic enteritis by reducing gut oxidative stress, inflammation, opportunistic bacteria and endotoxins of broilers. Euro. Poult. Sci. 2018, 82, 233. [Google Scholar]
- Bregendahl, K.; Sell, J.L.; Zimmerman, D.R. Effect of low-protein diets on growth performance and body composition of broiler chicks. Poult. Sci. 2002, 81, 1156–1167. [Google Scholar] [CrossRef]
- Chalova, V.; Kim, J.; Patterson, P.; Ricke, S.; Kim, W. Reduction of nitrogen excretion and emissions from poultry: A review for conventional poultry. Worlds Poult. Sci. J. 2016, 72, 509–520. [Google Scholar] [CrossRef]
- Kroismayr, A.; Schedle, K.; Sehm, J.; Pfaffl, M.W.; Plitzner, C.; Foissy, H.; Ettle, T.; Mayer, H.; Schreiner, M.; Windisch, W. Effects of antimicrobial feed additives on gut microbiology and blood parameters of weaned piglets. Bodenkultur 2008, 59, 111–120. [Google Scholar]
- Akbarian-Tefaghi, M.; Ghasemi, E.; Khorvash, M. Performance, rumen fermentation and blood metabolites of dairy calves fed starter mixtures supplemented with herbal plants, essential oils or monensin. J. Anim. Physiol. Anim. Nutr. 2018, 102, 630–638. [Google Scholar] [CrossRef]
- Peterson, B.; Peatman, E.; Ourth, D.; Waldbieser, G. Phytogenic feed-additive effects on channel catfish rhamnose-binding lectin levels, and susceptibility to Edwardsiella ictaluri. Dis. Aquat. Org. 2018, 129, 99–106. [Google Scholar] [CrossRef]
- Zumbaugh, C.; Murugesan, G.; Wong, E.; Syed, B.; Persia, M. Evaluation of a phytogenic feed additive on performance, nutrient digestion, and absorption in turkey poults. Anim. Feed. Sci. Technol. 2020, 267, 114575. [Google Scholar] [CrossRef]
- Paraskeuas, V.; Fegeros, K.; Palamidi, I.; Theodoropoulos, G.; Mountzouris, K.C. Phytogenic Administration and Reduction of Dietary Energy and Protein Levels Affects Growth Performance, Nutrient Digestibility and Antioxidant Status of Broilers. J. Poult. Sci. 2016, 53, 264–273. [Google Scholar] [CrossRef] [PubMed]
- Paraskeuas, V.V.; Mountzouris, K.C. Modulation of broiler gut microbiota and gene expression of Toll-like receptors and tight junction proteins by diet type and inclusion of phytogenics. Poult. Sci. 2019, 98, 2220–2230. [Google Scholar] [CrossRef] [PubMed]
- Mitsch, P.; Zitterl-Eglseer, K.; Köhler, B.; Gabler, C.; Losa, R.; Zimpernik, I. The effect of two different blends of essential oil components on the proliferation of Clostridium perfringens in the intestines of broiler chickens. Poult. Sci. 2004, 83, 669–675. [Google Scholar] [CrossRef]
- Zheng, L.; Bielke, J.; Ramirez, S.; Pender, C.; Tacconi, A.; Murugessan, G.R.; Bielke, L. Using yucca and/or phytogenics on alleviating negative effects of necrotic enteritis in broilers. Poult. Sci. Ann. Meet. 2019, 93, 186. [Google Scholar]
- Cobb Vantress Inc. Cobb500 Broiler Performance & Nutrition Supplement Guide; Cobb Vantress Inc.: Siloam Springs, AR, USA, 2018. [Google Scholar]
- Wang, J.; Choi, H.; Kim, W. Effects of dietary energy level and 1,3-diacylglycerol on growth performance and carcass yield in broilers. J. Appl. Poult. Res. 2020, 29, 665–672. [Google Scholar] [CrossRef]
- Williams, C.H.; David, D.J.; Iismaa, O. The determination of chromic oxide in faeces samples by atomic absorption spectrophotometry. J. Agric. Sci. 1962, 59, 381–385. [Google Scholar] [CrossRef]
- AOAC. Official Method of Analysis of the Association of Official Analytical Chemists; AOAC International: Arlington, TX, USA, 1996. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Dahlqvist, A. Method for assay of intestinal disaccharidases. Anal. Biochem. 1964, 7, 18–25. [Google Scholar] [CrossRef]
- Sun, X. Effect of Corn Quality and Enzyme Supplementation on Broiler Performance, Gastrointestinal Enzyme Activity, Nutrient Retention, Intestinal Mucin, and Jejunal Gene Expression; Virginia Tech: Montgomery, VA, USA, 2007. [Google Scholar]
- SAS Institute. SAS® User’s Guide for Personal Computer; SAS Institute Inc.: Cary, NC, USA, 2008. [Google Scholar]
- Wu, G.; Wu, Z.; Dai, Z.; Yang, Y.; Wang, W.; Liu, C.; Wang, B.; Wang, J.; Yin, Y. Dietary requirements of “nutritionally non-essential amino acids” by animals and humans. Amino Acids 2013, 44, 1107–1113. [Google Scholar] [CrossRef]
- Ullrich, C.; Langeheine, M.; Brehm, R.; Taube, V.; Siebert, D.; Visscher, C. Influence of Reduced Protein Content in Complete Diets with a Consistent Arginine–Lysine Ratio on Performance and Nitrogen Excretion in Broilers. Sustainability 2018, 10, 3827. [Google Scholar] [CrossRef]
- Pesti, G.M. Impact of dietary amino acid and crude protein levels in broiler feeds on biological performance. J. Appl. Poult. Res. 2009, 18, 477–486. [Google Scholar] [CrossRef]
- Pender, C.; Ramirez, S.; Murugesan, G.R.; Sobotik, B.E.; Archer, G.S. Evaluating the effects of a novel phytogenic feed additive on performance of broilers fed a low or standard protein diet. Poult. Sci. Ann. Meet. 2020, 82, 161. [Google Scholar]
- Sadek, K.; Ahmed, H.; Ayoub, M.; Elsabagh, M. Evaluation of Digestarom and thyme as phytogenic feed additives for broiler chickens. Eur. Poult. Sci. 2014, 78. [Google Scholar] [CrossRef]
- Mountzouris, K.; Paraskevas, V.; Tsirtsikos, P.; Palamidi, I.; Steiner, T.; Schatzmayr, G.; Fegeros, K. Assessment of a phytogenic feed additive effect on broiler growth performance, nutrient digestibility and caecal microflora composition. Anim. Feed. Sci. Technol. 2011, 168, 223–231. [Google Scholar] [CrossRef]
- Pirgozliev, V.; Mansbridge, S.C.; Rose, S.P.; Lillehoj, H.S.; Bravo, D. Immune modulation, growth performance, and nutrient retention in broiler chickens fed a blend of phytogenic feed additives. Poult. Sci. 2019, 98, 3443–3449. [Google Scholar] [CrossRef] [PubMed]
- Schiering, C.; Wincent, E.; Metidji, A.; Iseppon, A.; Li, Y.; Potocnik, A.J.; Omenetti, S.; Henderson, C.J.; Wolf, C.J.H.C.R.; Nebert, D.W.; et al. Feedback control of AHR signalling regulates intestinal immunity. Nat. Cell Biol. 2017, 542, 242–245. [Google Scholar] [CrossRef]
- Mescher, M.; Haarmann-Stemmann, T. Modulation of CYP1A1 metabolism: From adverse health effects to chemoprevention and therapeutic options. Pharmacol. Ther. 2018, 187, 71–87. [Google Scholar] [CrossRef] [PubMed]
- Deng, Q.; Shi, H.; Luo, Y.; Zhao, H.; Liu, N. Effect of dietary Lactobacilli mixture on Listeria monocytogenes infection and virulence property in broilers. Poult. Sci. 2020, 99, 3655–3662. [Google Scholar] [CrossRef]
- Klasing, K. Nutrition and the immune system. Br. Poult. Sci. 2007, 48, 525–537. [Google Scholar] [CrossRef] [PubMed]
- Ding, K.; Jiang, Q.; Wang, J.; Liu, N.; Zhang, F. Effect of tetramethylpyrazine on growth performance, Campylobacter jejuni carriage and endogenous antimicrobial peptides in rabbits. Czech J. Anim. Sci. 2019, 64, 465–471. [Google Scholar] [CrossRef]
- Wang, J.; Liu, N.; Zhang, F. Tetramethylpyrazine Protects Oxidative Stability and Gelation Property of Rabbit Myofibrillar Proteins. Food Sci. Anim. Resour. 2019, 39, 623–631. [Google Scholar] [CrossRef] [PubMed]
| Item | 0–14 d | 15–28 d | 29–42 d | |||
|---|---|---|---|---|---|---|
| PC 1 | NC 1,2 | PC 1 | NC 1,2 | PC 1 | NC 1,2 | |
| Ingredient (%) | ||||||
| Corn | 58.17 | 58.20 | 62.75 | 62.25 | 64.52 | 69.00 |
| Soybean meal | 36.42 | 33.27 | 31.58 | 28.21 | 29.36 | 25.49 |
| DCP 1 | 1.57 | 1.57 | 1.44 | 1.47 | 1.24 | 1.26 |
| Soybean oil | 1.70 | 2.56 | 2.19 | 2.54 | 3.00 | 2.35 |
| Limestone | 1.18 | 1.18 | 1.13 | 1.14 | 1.05 | 1.07 |
| Common salt | 0.30 | 0.30 | 0.30 | 0.30 | 0.30 | 0.30 |
| DL-methionine | 0.25 | 0.24 | 0.22 | 0.19 | 0.18 | 0.16 |
| Premix 1,3 | 0.25 | 0.25 | 0.25 | 0.25 | 0.25 | 0.25 |
| L-lysine-HCL | 0.08 | 0.09 | 0.08 | 0.09 | 0.02 | 0.05 |
| Sand | 0 | 2.21 | 0 | 1.48 | 0 | 0 |
| Calculated nutrient 1 (%) | ||||||
| ME 1 (kcal/kg) | 3008 | 3008 | 3086 | 3086 | 3160 | 3160 |
| Crude protein | 22.00 | 20.50 | 20.00 | 18.50 | 19.00 | 17.50 |
| Dig-Lysine | 1.18 | 1.10 | 1.05 | 0.97 | 0.95 | 0.88 |
| Dig-Methionine | 0.58 | 0.55 | 0.52 | 0.48 | 0.47 | 0.43 |
| Dig-TSAA | 0.88 | 0.83 | 0.80 | 0.74 | 0.74 | 0.68 |
| Dig-Threonine | 0.78 | 0.73 | 0.71 | 0.65 | 0.67 | 0.62 |
| Ca | 0.90 | 0.90 | 0.84 | 0.84 | 0.76 | 0.76 |
| Non-phytate P | 0.45 | 0.45 | 0.42 | 0.42 | 0.38 | 0.38 |
| Analyzed nutrient | ||||||
| Crude protein, % | 22.24 | 20.81 | 20.36 | 18.25 | 19.15 | 17.88 |
| GE 1, kcal/kg | 3815 | 3803 | 3986 | 3957 | 4016 | 4004 |
| Gene Name | Primer (5′→3′) | Length | Reference Sequence | |
|---|---|---|---|---|
| Forward | Reverse | |||
| Nutrient transporters | ||||
| Eaat3 | tgctgctttggattcagtgt | agcaatgactgtagtgcagaagtaatatatg | 79 | XM_424930.5 |
| Pept1 | cccctgaggaggatcactggtt | caaaagagcagcagcaacga | 66 | NM_204365.1 |
| Glut5 | ttgctggctttgggttgtg | ggaggttgagggccaaagtc | 60 | XM_417596.5 |
| Sglt1 | gccgtggccagggctta | caataacctgatctgtgcaccagta | 71 | NM_001293240.1 |
| Immunity | ||||
| CYP1A1 | gcttcaaccccaacagctac | gtgttcatgttcaccacgct | 118 | NM_205147.1 |
| IL-6 | ataaatcccgatgaagtgg | ctcacggtcttctccataaa | 146 | NM_204628.1 |
| IL-8 | cgttcagcgattgaactccg | ctgccttgtccagaattgcc | 211 | NM_205018.1 |
| HO-1 | cacgagttcaagctggtcac | ctgcagctccatcggaaaat | 120 | NM_205344.1 |
| UGT1A1 | ccaacctgccaaagaacgtg | ccctcgtaaacaccgtgtga | 115 | XM_015289249.1 |
| GAPDH | tcagcagcaggcttcactac | gctaaggctgtggggaaagt | 161 | NM_204305.1 |
| Item | BWG (g/bird) | FI (g/bird) | FCR | ||||||
|---|---|---|---|---|---|---|---|---|---|
| 0–14 d | 0–28 d | 0–42 d | 0–14 d | 0–28 d | 0–42 d | 0–14 d | 0–28 d | 0–42 d | |
| Main effect of dietary protein level | |||||||||
| PC 1,2 | 324 | 1235 | 2488 | 457 | 1805 | 4110 | 1.409 | 1.420 B | 1.665 B |
| NC 1,2 | 322 | 1207 | 2424 | 460 | 1882 | 4194 | 1.430 | 1.510 A | 1.731 A |
| SEM 2 | 2.91 | 14.63 | 22.03 | 4.65 | 28.5 | 35.7 | 0.018 | 0.021 | 0.010 |
| Main effect of PFA level | |||||||||
| 0 | 323 | 1223 | 2434 | 458 | 1838 | 4185 | 1.425 | 1.479 A | 1.724 A |
| 125 ppm | 324 | 1218 | 2478 | 459 | 1856 | 4157 | 1.420 | 1.456 B | 1.683 B |
| SEM 2 | 2.97 | 14.1 | 24.5 | 4.53 | 31.28 | 32.3 | 0.020 | 0.016 | 0.013 |
| Treatments | |||||||||
| PC 1,2 + 0 | 321 | 1235 | 2479 | 452 | 1777 | 4085 | 1.411 | 1.390 | 1.668 |
| NC 1,2 + 0 | 328 | 1212 | 2498 | 461 | 1885 | 4204 | 1.427 | 1.506 | 1.760 |
| PC 1,2 + PFA 2 | 325 | 1235 | 2390 | 463 | 1833 | 4127 | 1.432 | 1.444 | 1.662 |
| NC 1,2 + PFA 2 | 320 | 1202 | 2458 | 457 | 1879 | 4184 | 1.370 | 1.515 | 1.702 |
| SEM 2 | 2.38 | 10.5 | 18.0 | 2.99 | 22.5 | 23.9 | 0.018 | 0.021 | 0.010 |
| p-value | |||||||||
| Protein level | 0.639 | 0.211 | 0.076 | 0.637 | 0.108 | 0.089 | 0.475 | 0.032 | <0.010 |
| PFA 2 | 0.808 | 0.820 | 0.221 | 0.911 | 0.702 | 0.984 | 0.984 | 0.042 | 0.034 |
| Interaction | 0.170 | 0.821 | 0.484 | 0.294 | 0.500 | 0.525 | 0.885 | 0.584 | 0.104 |
| Item | DM (%) | CP (%) | IDE (kcal/kg) | |||
|---|---|---|---|---|---|---|
| 21 d | 42 d | 21 d | 42 d | 21 d | 42 d | |
| The main effect of dietary protein level | ||||||
| PC 1,2 | 71.8 | 71.1 | 81.2 A | 79.7 | 2837 | 2878 |
| NC 1,2 | 70.6 | 72.1 | 78.2 B | 78.0 | 2791 | 2838 |
| SEM 2 | 1.13 | 0.75 | 0.96 | 0.89 | 51.0 | 34.1 |
| The main effect of PFA level | ||||||
| 0 | 71.0 | 71.6 | 79.6 | 78.9 | 2807 | 2853 |
| 125 ppm | 71.4 | 71.6 | 79.8 | 78.8 | 2821 | 2863 |
| SEM 2 | 1.12 | 0.76 | 1.03 | 0.95 | 50.6 | 34.3 |
| Treatments | ||||||
| PC 1,2 + 0 | 71.2 | 71.4 | 80.9 | 80.0 | 2834 | 2849 |
| NC 1,2 + 0 | 70.9 | 71.9 | 78.4 | 77.9 | 2781 | 2857 |
| PC 1,2 + PFA 2 | 72.4 | 70.9 | 81.4 | 79.4 | 2840 | 2826 |
| NC 1,2 + PFA 2 | 70.4 | 72.3 | 78.1 | 78.2 | 2801 | 2899 |
| p-value | ||||||
| PFA | 0.827 | 0.997 | 0.910 | 0.925 | 0.8596 | 0.846 |
| CP level | 0.476 | 0.389 | 0.047 | 0.226 | 0.5432 | 0.426 |
| Interaction | 0.622 | 0.666 | 0.789 | 0.761 | 0.9296 | 0.516 |
| Item | Jejunal Digesta | Brush Border Enzyme | ||||
|---|---|---|---|---|---|---|
| Alkaline Phosphatase U/mg | Amylase U/mg | Lipase mU/mg | Maltase mg/mg | Sucrase mg/mg | Aminopeptidase µmol/mg | |
| 21 d of age | ||||||
| Control 2 | 1.549 | 4.912 | 23.172 | 3.236 | 2.458 | 0.202 |
| PFA 1 | 1.109 | 4.348 | 22.963 | 4.161 | 2.456 | 0.195 |
| SEM 1 | 0.291 | 0.158 | 1.564 | 0.25 | 0.15 | 0.009 |
| p-value | 0.289 | 0.475 | 0.950 | 0.115 | 0.996 | 0.693 |
| 42 d of age | ||||||
| Control 2 | 1.381 | 4.764 | 22.560 | 2.983 | 2.011 | 0.098 |
| PFA 1 | 1.048 | 4.489 | 17.500 | 2.769 | 2.077 | 0.101 |
| SEM 1 | 0.231 | 0.161 | 2.246 | 0.33 | 0.38 | 0.011 |
| p-value | 0.602 | 0.8812 | 0.275 | 0.659 | 0.845 | 0.485 |
| Item | Nutrient Transporter | Immunity | |||||||
|---|---|---|---|---|---|---|---|---|---|
| Eaat3 1 | Pept1 1 | Glut5 1 | Sglt1 1 | CYP1A 1 | IL-6 1 | IL-8 1 | HO-1 1 | UGAT1A1 1 | |
| 21 d of age | |||||||||
| Control 2 | 1.09 | 1.04 | 1.07 | 1.04 | 1.42 A | 1.16 A | 1.11 | 1.01 | 1.03 |
| PFA 1 | 0.73 | 0.71 | 0.92 | 0.86 | 0.38 B | 0.57 B | 1.19 | 0.99 | 0.86 |
| SEM 1 | 0.12 | 0.12 | 0.17 | 0.14 | 0.25 | 0.15 | 0.26 | 0.09 | 0.1 |
| p-value | 0.193 | 0.151 | 0.721 | 0.583 | 0.032 | 0.037 | 0.507 | 0.881 | 0.279 |
| 42 d of age | |||||||||
| Control 2 | 1.18 | 1.2 | 1.14 | 1.24 | 0.91 | 1.34 | 1.22 | 1.03 | 1.02 |
| PFA 1 | 0.82 | 0.75 | 0.83 | 0.78 | 1.03 | 1.04 | 1.35 | 1.07 | 1.1 |
| SEM 1 | 0.22 | 0.23 | 0.18 | 0.26 | 0.33 | 0.38 | 0.32 | 0.12 | 0.12 |
| p-value | 0.429 | 0.119 | 0.135 | 0.402 | 0.945 | 0.544 | 0.699 | 0.821 | 0.679 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, J.; Su, S.; Pender, C.; Murugesan, R.; Syed, B.; Kim, W.K. Effect of a Phytogenic Feed Additive on Growth Performance, Nutrient Digestion, and Immune Response in Broiler-Fed Diets with Two Different Levels of Crude Protein. Animals 2021, 11, 775. https://doi.org/10.3390/ani11030775
Wang J, Su S, Pender C, Murugesan R, Syed B, Kim WK. Effect of a Phytogenic Feed Additive on Growth Performance, Nutrient Digestion, and Immune Response in Broiler-Fed Diets with Two Different Levels of Crude Protein. Animals. 2021; 11(3):775. https://doi.org/10.3390/ani11030775
Chicago/Turabian StyleWang, Jinquan, Shengchen Su, Chasity Pender, Raj Murugesan, Basharat Syed, and Woo Kyun Kim. 2021. "Effect of a Phytogenic Feed Additive on Growth Performance, Nutrient Digestion, and Immune Response in Broiler-Fed Diets with Two Different Levels of Crude Protein" Animals 11, no. 3: 775. https://doi.org/10.3390/ani11030775
APA StyleWang, J., Su, S., Pender, C., Murugesan, R., Syed, B., & Kim, W. K. (2021). Effect of a Phytogenic Feed Additive on Growth Performance, Nutrient Digestion, and Immune Response in Broiler-Fed Diets with Two Different Levels of Crude Protein. Animals, 11(3), 775. https://doi.org/10.3390/ani11030775

