Effects of Diet and Phytogenic Inclusion on the Antioxidant Capacity of the Broiler Chicken Gut
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Experimental Treatments
2.2. Broiler Growth Performance Responses
2.3. Organ Sampling
2.4. Molecular Analyses
2.4.1. RNA Isolation and Reverse-Transcription PCR
2.4.2. Quantitative Real-Time PCR
2.5. Biochemical Analyses
2.6. Statistical Analysis
3. Results
3.1. Growth Performance Responses
3.2. Profile of Selected Gene Expression along the Intestine
3.2.1. Duodenum
3.2.2. Jejunum
3.2.3. Ileum
3.2.4. Ceca
3.3. Total Antioxidant Capacity (TAC) along the Intestine
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mountzouris, K.; Paraskevas, V.; Tsirtsikos, P.; Palamidi, I.; Steiner, T.; Schatzmayr, G.; Fegeros, K. Assessment of a phytogenic feed additive effect on broiler growth performance, nutrient digestibility and caecal microflora composition. Anim. Feed Sci. Technol. 2011, 168, 223–231. [Google Scholar] [CrossRef]
- Amad, A.; Manner, K.; Wendler, K.; Neumann, K.; Zentek, J. Effects of a phytogenic feed additive on growth performance and ileal nutrient digestibility in broiler chickens. Poult. Sci. 2011, 90, 2811–2816. [Google Scholar] [CrossRef]
- Mountzouris, K.C.; Paraskeuas, V.; Fegeros, K. Priming of intestinal cytoprotective genes and antioxidant capacity by dietary phytogenic inclusion in broilers. Anim. Nutr. 2020, 6, 305–312. [Google Scholar] [CrossRef]
- Vomund, S.; Schäfer, A.; Parnham, M.J.; Brüne, B.; Knethen, A. Nrf2, the master regulator of anti-oxidative responses. Int. J. Mol. Sci. 2017, 18, 2772. [Google Scholar] [CrossRef] [Green Version]
- Sahin, K.; Orhan, C.; Tuzcu, M.; Ali, S.; Sahin, N.; Hayirli, A. Epigallocatechin-3-gallate prevents lipid peroxidation and enhances antioxidant defense system via modulating hepatic nuclear transcription factors in heat-stressed quails. Poult. Sci. 2010, 89, 2251–2258. [Google Scholar] [CrossRef]
- Stefanson, A.; Bakovic, M. Dietary Regulation of Keap1/Nrf2/ARE Pathway: Focus on Plant-Derived Compounds and Trace Minerals. Nutrients 2014, 6, 3777–3801. [Google Scholar] [CrossRef] [Green Version]
- Chen, X.; Li, R.; Geng, Z. Cold stress initiates the Nrf2/UGT1A1/L-FABP signaling pathway in chickens. Poult. Sci. 2015, 94, 2597–2603. [Google Scholar] [CrossRef]
- Lu, M.; Ji, J.; Jiang, Z.; You, Q. The Keap1-Nrf2-ARE pathway as a potential preventive and therapeutic target: An update. Med. Res. Rev. 2016, 36, 924–963. [Google Scholar] [CrossRef]
- Baird, L.; Dinkova-Kostova, A. The cytoprotective role of the Keap1–Nrf2 pathway. Arch. Toxicol. 2011, 85, 241–272. [Google Scholar] [CrossRef]
- Lee, M.; Lin, W.; Yu, B.; Lee, T. Antioxidant capacity of phytochemicals and their potential effects on oxidative status in animals—A review. Asian-Australas. J. Anim. Sci. 2016, 30, 299–308. [Google Scholar] [CrossRef]
- Delles, R.; Xiong, Y.; True, A.; Ao, T.; Dawson, K. Dietary antioxidant supplementation enhances lipid and protein oxidative stability of chicken broiler meat through promotion of antioxidant enzyme activity1. Poult. Sci. 2014, 93, 1561–1570. [Google Scholar] [CrossRef]
- Dinkova-Kostova, A.; Talalay, P. NAD(P)H quinone acceptor oxidoreductase 1 (NQO1), a multifunctional antioxidant enzyme and exceptionally versatile cytoprotector. Arch. Biochem. Biophys. 2010, 501, 116–123. [Google Scholar] [CrossRef] [Green Version]
- Zhang, G.; Yang, Z.; Wang, Y.; Yang, W. Effects of Astragalus membranaceus root processed to different particle sizes on growth performance, antioxidant status, and serum metabolites of broiler chickens1. Poult. Sci. 2012, 92, 178–183. [Google Scholar] [CrossRef]
- Ding, C.; Fan, X.; Wu, G. Peroxiredoxin 1—An antioxidant enzyme in cancer. J. Cell. Mol. Med. 2016, 21, 193–202. [Google Scholar] [CrossRef]
- Collet, J.F.; Messens, J. Structure, function and mechanism of thioredoxin proteins. Antioxid. Redox Signal. 2010, 13, 1205–1216. [Google Scholar] [CrossRef]
- Fontana, L. The scientific basis of caloric restriction leading to longer life. Curr. Opin. Gastroenterol. 2009, 25, 144–150. [Google Scholar] [CrossRef]
- Roth, G.S.; Ingram, D.K.; Black, A.; Lane, M.A. Effects of reduced energy intake on the biology of aging: The primate model. Eur. J. Clin. Nutr. 2000, 54, S15–S20. [Google Scholar] [CrossRef]
- Bocci, V.; Valacchi, G. Nrf2 activation as target to implement therapeutic treatments. Front. Chem. 2015, 3, 4. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.R.; Li, G.H.; Zhou, M.X.; Xiang, L.; Ren, D.M.; Lou, H.X.; Wang, X.N.; Shen, T. Discovery of natural flavonoids as activators of Nrf2-mediated defense system. Structure-activity relationship and inhibition of intracellular oxidative insults. Biorg. Med. Chem. 2018, 26, 5140–5150. [Google Scholar] [CrossRef]
- Qin, S.; Hou, D.X. The biofunctions of phytochemicals and their applications in farm animals: The Nrf2/Keap1 system as a target. Engineering 2017, 3, 738–752. [Google Scholar] [CrossRef]
- Kaschubek, T.; Mayer, E.; Rzesnik, S.; Grenier, B.; Bachinger, D.; Schieder, C.; Konig, J.; Teichmann, K. Effects of phytogenic feed additives on cellular oxidative stress and inflammatory reactions in intestinal porcine epithelial cells. J. Anim. Sci. 2018, 96, 3657–3669. [Google Scholar] [CrossRef]
- Surai, P.F.; Kochish, I.I.; Fisinin, V.I.; Kidd, M.T. Antioxidant defense systems and oxidative stress in poultry biology: An update. Antioxidants 2019, 8, 235. [Google Scholar] [CrossRef] [Green Version]
- EC. 43. Council directive of June 2007 laying down minimum rules for the protection of chickens kept for meat production. Off. J. Eur. Union 2007, 182, 19–28.
- EU. 63. Directive of the European Parliament and of the Council of 22 Spetember 2010 on the protection of animals used for scientific purposes. Off. J. Eur. Union 2010, 276, 33–79.
- Pfaffl, M. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Hellemans, J.; Mortier, G.; Paepe, A.D.; Speleman, F.; Vandesompele, J. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol. 2007, 8, R19. [Google Scholar] [CrossRef] [Green Version]
- Cao, G.; Prior, R. Measurement of oxygen radical absorbance capacity in biological samples. Methods Enzymol. 1999, 299, 50–62. [Google Scholar]
- Prior, R.; Hoang, H.; Gu, L.; Wu, X.; Bacchiocca, M.; Howard, L.; Hampsch-Woodill, M.; Huang, D.; Ou, B.; Jacob, R. Assays for Hydrophilic and Lipophilic Antioxidant Capacity (oxygen radical absorbance capacity (ORACFL)) of Plasma and Other Biological and Food Samples. J. Agric. Food Chem. 2003, 51, 3273–3279. [Google Scholar] [CrossRef]
- Bravo, D.; Pirgozliev, V.; Rose, S. A mixture of carvacrol, cinnamaldehyde, and capsicum oleoresin improves energy utilization and growth performance of broiler chickens fed maize-based diet. J. Anim. Sci. 2014, 92, 1531–1536. [Google Scholar] [CrossRef] [Green Version]
- Yang, J.; Liu, L.; Sheikhahmadi, A.; Wang, Y.; Li, C.; Jiao, H.; Lin, H.; Song, Z. Effects of Corticosterone and dietary energy on immune function of broiler chickens. PLoS ONE 2015, 10, e0119750. [Google Scholar] [CrossRef] [Green Version]
- Paraskeuas, V.; Fegeros, K.; Palamidi, I.; Theodoropoulos, G.; Mountzouris, K.C. Phytogenic administration and reduction of dietary energy and protein levels affects growth performance, nutrient digestibility and antioxidant status of broilers. J. Poult. Sci. 2016, 53, 264–273. [Google Scholar] [CrossRef] [Green Version]
- Taleb, Z.; Sadeghi1, A.A.; Shawrang, P.; Chamani, M.; Aminafshar, M. Effect of energy levels and sources on the blood attributes and immune response in broiler chickens exposed to heat stress. J. Livest. Sci. 2017, 8, 52–58. [Google Scholar]
- Hafeez, A.; Männer, K.; Schieder, C.; Zentek, J. Effect of supplementation of phytogenic feed additives (powdered vs. encapsulated) on performance and nutrient digestibility in broiler chickens. Poult. Sci. 2015, 95, 622–629. [Google Scholar] [CrossRef]
- Du, E.; Wang, W.; Gan, L.; Li, Z.; Guo, S.; Guo, Y. Effects of thymol and carvacrol supplementation on intestinal integrity and immune responses of broiler chickens challenged with Clostridium perfrngens. J. Anim. Sci. Biotechnol. 2016, 7, 2–10. [Google Scholar] [CrossRef] [Green Version]
- Paraskeuas, V.; Mountzouris, K.C. Broiler gut microbiota and expression of gut barrier genes affected by cereal type and phytogenic inclusion. Anim. Nutr. 2019, 5, 22–31. [Google Scholar] [CrossRef]
- Paraskeuas, V.; Mountzouris, K.C. Modulation of broiler gut microbiota and gene expression of Toll-like receptors and tight junction proteins by diet type and inclusion of phytogenics. Poult. Sci. 2019, 98, 2220–2230. [Google Scholar] [CrossRef] [PubMed]
- Mueller, K.; Blum, N.; Kluge, H.; Mueller, A. Influence of broccoli extract and various essential oils on performance and expression of xenobiotic- and antioxidant enzymes in broiler chickens. Br. J. Nutr. 2011, 108, 588–602. [Google Scholar] [CrossRef] [Green Version]
- Michiels, J.; Missotten, J.; Dierick, N.; Fremaut, D.; Maene, P.; De Smet, S. In vitro degradation and in vivo passage kinetics of carvacrol, thymol, eugenol and trans-cinnamaldehyde along the gastrointestinal tract of piglets. J. Sci. Food Agric. 2008, 88, 2371–2381. [Google Scholar] [CrossRef]
- Zainal, T.; Oberley, T.; Allison, D.; Szweda, L.; Weindruch, R. Caloric restriction of rhesus monkeys lowers oxidative damage in skeletal muscle. FASEB J. 2000, 14, 1825–1836. [Google Scholar] [CrossRef] [Green Version]
- Cho, C. Modulation of glutathione and thioredoxin systems by calorie restriction during the aging process. Exp. Gerontol. 2003, 38, 539–548. [Google Scholar] [CrossRef]
- Jung, K.; Kwak, M. The Nrf2 system as a potential target for the development of indirect antioxidants. Molecules 2010, 15, 7266–7291. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kostyuk, S.; Porokhovnik, L.; Ershova, E.; Malinovskaya, E.; Konkova, M.; Kameneva, L.; Dolgikh, O.; Veiko, V.; Pisarev, V.; Martynov, A.; et al. Changes of KEAP1/NRF2 and IKB/NF-κB Expression Levels Induced by Cell-Free DNA in Different Cell Types. Oxid. Med. Cell. Longev. 2018, 2018, 1–17. [Google Scholar] [CrossRef] [Green Version]
- Ahmadi, F. Effect of turmeric powder on performance, oxidative stress state and some of blood parameters in broiler fed on diets containing aflatoxin. Glob. Vet. 2010, 5, 312–317. [Google Scholar]
- Zou, Y.; Wang, J.; Peng, J.; Wei, H. Oregano essential oil induces SOD1 and GSH expression through Nrf2 activation and alleviates hydrogen peroxide—Induced oxidative damage in JPEC-J2 cells. Oxid. Med. Cell. Longev. 2016, 2016, 1–13. [Google Scholar]
- Xiao, R.; Power, R.; Mallonee, D.; Routt, K.; Spangler, L.; Pescatore, A.; Cantor, A.; Ao, T.; Pierce, J.; Dawson, K. Effects of yeast cell wall-derived mannan-oligosaccharides on jejunal gene expression in young broiler chickens. Poult. Sci. 2012, 91, 1660–1669. [Google Scholar] [CrossRef]
- Lagerstrom, M.C.; Hellstrom, A.R.; Gloriam, D.E.; Larsson, T.P.; Schioth, H.B.; Fredriksson, R. The G Protein-Coupled receptor subset of the chicken genome. PLoS Comput. Biol. 2006, 6, 493–507. [Google Scholar] [CrossRef] [Green Version]
Target | Primer Sequence (5′-3′) | Annealing Temperature (°C) | PCR Product Size (bp) | GenBank (NCBI Reference Sequence) |
---|---|---|---|---|
GAPDH | F: ACTTTGGCATTGTGGAGGGT R: GGACGCTGGGATGATGTTCT | 59.5 | 131 | NM_204305.1 |
ACTB | F: CACAGATCATGTTTGAGACCTT R: CATCACAATACCAGTGGTACG | 60 | 101 | NM_205518.1 |
Nrf2 | F: AGACGCTTTCTTCAGGGGTAG R: AAAAACTTCACGCCTTGCCC | 60 | 285 | NM_205117.1 |
Keap1 | F: GGTTACGATGGGACGGATCA R: CACGTAGATCTTGCCCTGGT | 62 | 135 | XM_025145847.1 |
CAT | F: ACCAAGTACTGCAAGGCGAA R: TGAGGGTTCCTCTTCTGGCT | 60 | 245 | NM_001031215 |
SOD1 | F: AGGGGGTCATCCACTTCC R: CCCATTTGTGTTGTCTCCAA | 60 | 122 | NM_205064.1 |
XOR | F:GTGTCGGTGTACAGGATACAGAC R:CCTTACTATGACAGCATCCAGTG | 61 | 110 | NM_205127.1 |
GPX2 | F: GAGCCCAACTTCACCCTGTT R: CTTCAGGTAGGCGAAGACGG | 62 | 75 | NM_001277854.1 |
GPX | F: GGCTCGGTGTCGTTAGTTGT R: GCCCAAACTGATTGCATGGG | 60 | 139 | NM_001163245.1 |
HMOX1 | F: ACACCCGCTATTTGGGAGAC R: GAACTTGGTGGCGTTGGAGA | 62 | 134 | NM_205344.1 |
NQO1 | F: GAGCGAAGTTCAGCCCAGT R: ATGGCGTGGTTGAAAGAGGT | 60.5 | 150 | NM_001277619.1 |
GST | F: GCCTGACTTCAGTCCTTGGT R: CCACCGAATTGACTCCATCT | 60 | 138 | NM_001001776.1 |
GSR | F: GTGGATCCCCACAACCATGT R: CAGACATCACCGATGGCGTA | 62 | 80 | XM_015276627.1 |
PRDX1 | F: CTGCTGGAGTGCGGATTGT R: GCTGTGGCAGTAAAATCAGGG | 61 | 105 | NM_001271932.1 |
TXN | F:ACGGAAAGAAGGTGCAGGAAT R: GATCCAGACATGCTCCGATGT | 60 | 110 | NM_205453.1 |
Overall BWG (g) | Overall FI (g) | Overall FCR (g FI/g BWG) | |
---|---|---|---|
Diet type 1 | |||
L | 2411.7 A | 4114.9 A | 1.71 B |
H | 2692.1 B | 4194.3 B | 1.56 A |
PFA addition 2 | |||
No | 2523.1 X | 4138.2 | 1.65 Y |
Yes | 2580.7 Y | 4171.1 | 1.62 X |
Treatments (Interactions) | |||
L− | 2353.3 a | 4086.3 | 1.74 c |
L+ | 2470.1 b | 4143.6 | 1.68 b |
H− | 2692.8 c | 4190.1 | 1.56 a |
H+ | 2691.3 c | 4198.6 | 1.56 a |
SEM 4 | 16.78 | 38.20 | 0.013 |
PD3 | <0.001 | 0.046 | <0.001 |
PP3 | 0.002 | 0.395 | 0.043 |
PD×P3 | 0.001 | 0.528 | 0.024 |
Item | Type of Diet 2 | PFA Supplementation 3 | p-Values 4 | |||||
---|---|---|---|---|---|---|---|---|
Duodenum | L | H | No | Yes | SEM 5 | Diet (D) | PFA (P) | D × P |
Genes 1 | ||||||||
Nrf2 | 1.01 | 1.29 | 1.17 | 1.13 | 0.222 | 0.224 | 0.836 | 0.794 |
KEAP1 | 1.08 | 1.05 | 0.89 X | 1.25 Y | 0.096 | 0.753 | 0.001 | 0.125 |
CAT | 2.22 | 2.15 | 1.78 X | 2.59 Y | 0.366 | 0.842 | 0.035 | 0.491 |
SOD1 | 1.02 | 1.14 | 0.92 X | 1.24 Y | 0.131 | 0.385 | 0.019 | 0.063 |
XOR | 1.16 | 1.04 | 0.97 | 1.23 | 0.184 | 0.513 | 0.171 | 0.475 |
GPX2 | 1.69 B | 1.03 A | 1.06 | 1.66 | 0.313 | 0.043 | 0.063 | 0.170 |
GPX7 | 1.33 | 1.23 | 1.49 | 1.07 | 0.367 | 0.791 | 0.262 | 0.862 |
HMOX1 | 0.94 A | 1.19 B | 0.87 X | 1.26 Y | 0.101 | 0.017 | 0.001 | 0.017 |
NQO1 | 1.11 | 1.01 | 0.86 X | 1.25 Y | 0.109 | 0.368 | 0.001 | 0.183 |
GST | 1.48 | 1.15 | 1.03 | 1.60 | 0.327 | 0.271 | 0.071 | 0.934 |
GSR | 1.10 | 1.18 | 0.93 X | 1.34 Y | 0.194 | 0.664 | 0.041 | 0.062 |
PRDX1 | 1.77 | 1.62 | 1.38 X | 2.00 Y | 0.249 | 0.557 | 0.019 | 0.794 |
TXN | 0.92 B | 1.26 A | 0.94 X | 1.24 Y | 0.136 | 0.019 | 0.035 | 0.120 |
Item | Type of Diet 2 | PFA Supplementation 3 | p-Values 4 | |||||
---|---|---|---|---|---|---|---|---|
Jejunum | L | H | No | Yes | SEM 5 | Diet (D) | PFA (P) | D × P |
Genes 1 | ||||||||
Nrf2 | 1.28 | 1.20 | 1.26 | 1.22 | 0.330 | 0.849 | 0.829 | 0.743 |
Keap1 | 1.09 | 1.07 | 1.07 | 1.09 | 0.109 | 0.926 | 0.886 | 0.430 |
CAT | 1.17 | 1.00 | 1.08 | 1.09 | 0.126 | 0.180 | 0.951 | 0.719 |
SOD1 | 1.10 | 1.06 | 1.03 | 1.13 | 0.137 | 0.734 | 0.480 | 0.066 |
XOR | 1.15 | 1.05 | 1.08 | 1.12 | 0.158 | 0.492 | 0.831 | 0.953 |
GPX2 | 1.46 B | 0.87 A | 1.00 | 1.33 | 0.138 | 0.005 | 0.108 | 0.294 |
GPX7 | 1.13 | 1.10 | 1.12 | 1.11 | 0.175 | 0.850 | 0.960 | 0.930 |
HMOX1 | 0.96 | 1.22 | 1.01 | 1.16 | 0.095 | 0.064 | 0.285 | 0.375 |
NQO1 | 1.04 | 1.08 | 1.09 | 1.03 | 0.088 | 0.766 | 0.628 | 0.793 |
GST | 0.91 | 1.34 | 1.00 | 1.24 | 0.148 | 0.050 | 0.260 | 0.245 |
GSR | 0.95 | 1.12 | 1.05 | 1.01 | 0.110 | 0.130 | 0.749 | 0.206 |
PRDX1 | 2.39 B | 1.63 A | 1.99 | 2.01 | 0.225 | 0.002 | 0.908 | 0.654 |
TXN | 1.06 | 1.09 | 1.11 | 1.04 | 0.136 | 0.818 | 0.637 | 0.824 |
Item | Type of Diet 2 | PFA Supplementation 3 | p-Values 4 | |||||
---|---|---|---|---|---|---|---|---|
Ileum | L | H | No | Yes | SEM 5 | Diet (D) | PFA (P) | D × P |
Genes 1 | ||||||||
Nrf2 | 1.33 | 1.05 | 1.35 | 1.03 | 0.226 | 0.220 | 0.166 | 0.114 |
Keap1 | 1.11 | 1.03 | 1.02 | 1.12 | 0.126 | 0.553 | 0.438 | 0.433 |
CAT | 1.26 B | 0.91 A | 1.00 | 1.17 | 0.120 | 0.006 | 0.149 | 0.151 |
SOD1 | 1.11 | 1.00 | 1.06 | 1.05 | 0.113 | 0.336 | 0.903 | 0.981 |
XOR | 1.05 | 1.08 | 1.04 | 1.08 | 0.128 | 0.836 | 0.757 | 0.724 |
GPX2 | 1.45 | 1.06 | 0.81 X | 1.70 Y | 0.251 | 0.657 | <0.001 | 0.007 |
GPX7 | 1.10 | 1.21 | 1.23 | 1.08 | 0.224 | 0.633 | 0.507 | 0.779 |
HMOX1 | 0.96 | 1.20 | 0.97 | 1.19 | 0.134 | 0.096 | 0.115 | 0.024 |
NQO1 | 1.18 | 0.95 | 1.05 | 1.08 | 0.119 | 0.058 | 0.845 | 0.184 |
GST | 1.08 | 1.42 | 0.98 | 1.51 | 0.347 | 0.477 | 0.629 | 0.333 |
GSR | 1.22 | 0.94 | 1.01 | 1.15 | 0.153 | 0.078 | 0.375 | 0.994 |
PRDX1 | 1.65 | 2.06 | 1.57 | 2.14 | 0.289 | 0.163 | 0.060 | 0.125 |
TXN | 1.03 | 1.13 | 1.08 | 1.08 | 0.155 | 0.528 | 0.994 | 0.599 |
Item | Type of Diet 2 | PFA Supplementation 3 | p-Values 4 | |||||
---|---|---|---|---|---|---|---|---|
Ceca | L | H | No | Yes | SEM 5 | Diet (D) | PFA (P) | D × P |
Genes 1 | ||||||||
Nrf2 | 1.16 | 1.14 | 1.18 | 1.13 | 0.204 | 0.910 | 0.787 | 0.718 |
Keap1 | 1.31 B | 0.93 A | 1.01 | 1.24 | 0.147 | 0.014 | 0.133 | 0.077 |
CAT | 1.05 | 1.24 | 0.91 | 1.38 | 0.255 | 0.454 | 0.077 | 0.202 |
SOD1 | 1.13 | 1.11 | 1.04 | 1.20 | 0.172 | 0.926 | 0.352 | 0.135 |
XOR | 1.21 | 1.07 | 1.00 | 1.28 | 0.262 | 0.402 | 0.393 | 0.359 |
GPX2 | 1.40 B | 0.86 A | 1.02 | 1.24 | 0.166 | 0.003 | 0.198 | 0.102 |
GPX7 | 1.39 B | 0.94 A | 1.08 | 1.25 | 0.201 | 0.032 | 0.406 | 0.144 |
HMOX1 | 1.22 | 1.04 | 1.12 | 1.15 | 0.152 | 0.247 | 0.865 | 0.991 |
NQO1 | 1.11 | 1.09 | 1.17 | 1.03 | 0.148 | 0.911 | 0.359 | 0.454 |
GST | 1.34 | 0.99 | 0.98 X | 1.35 Y | 0.175 | 0.058 | 0.041 | 0.461 |
GSR | 1.10 | 1.23 | 1.24 | 1.10 | 0.207 | 0.522 | 0.505 | 0.191 |
PRDX1 | 1.94 B | 1.29 A | 1.44 | 1.79 | 0.221 | 0.006 | 0.127 | 0.962 |
TXN | 1.21 | 1.05 | 0.99 | 1.27 | 0.199 | 0.445 | 0.167 | 0.560 |
TAC 1 (mmol TE/g Tissue) | Type of Diet 2 | PFA Supplementation 3 | SEM 4 | p-Values 5 | ||||
---|---|---|---|---|---|---|---|---|
Item | L | H | No | Yes | Diet (D) | PFA (P) | D × P | |
Duodenum | 46.46 | 46.53 | 44.38 | 48.60 | 2.279 | 0.976 | 0.073 | 0.024 |
Jejunum | 39.22 A | 52.38 B | 38.32 X | 53.29 Y | 3.748 | 0.001 | <0.001 | 0.250 |
Ileum | 32.53 | 34.31 | 29.73 X | 37.11 Y | 3.316 | 0.594 | 0.033 | 0.007 |
Ceca | 33.94 | 39.03 | 32.49 X | 40.48 Y | 3.564 | 0.163 | 0.032 | 0.300 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Griela, E.; Paraskeuas, V.; Mountzouris, K.C. Effects of Diet and Phytogenic Inclusion on the Antioxidant Capacity of the Broiler Chicken Gut. Animals 2021, 11, 739. https://doi.org/10.3390/ani11030739
Griela E, Paraskeuas V, Mountzouris KC. Effects of Diet and Phytogenic Inclusion on the Antioxidant Capacity of the Broiler Chicken Gut. Animals. 2021; 11(3):739. https://doi.org/10.3390/ani11030739
Chicago/Turabian StyleGriela, Eirini, Vasileios Paraskeuas, and Konstantinos C. Mountzouris. 2021. "Effects of Diet and Phytogenic Inclusion on the Antioxidant Capacity of the Broiler Chicken Gut" Animals 11, no. 3: 739. https://doi.org/10.3390/ani11030739
APA StyleGriela, E., Paraskeuas, V., & Mountzouris, K. C. (2021). Effects of Diet and Phytogenic Inclusion on the Antioxidant Capacity of the Broiler Chicken Gut. Animals, 11(3), 739. https://doi.org/10.3390/ani11030739