Black Soldier Fly (Hermetia illucens) Larvae and Prepupae Defatted Meals in Diets for Zebrafish (Danio rerio)
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insect Source
2.2. Experimental Diets
2.3. Fish Feeding Trial and Growth Analysis
- Weight gain (WG) = final fish weight (Wf) − initial fish weight (Wi);
- Daily growth rate (DGR) = (Wf − Wi)/T, where T represents the time of the study in days;
- Specific growth rate (SGR) = ((ln Wf − ln Wi/T)) × 100;
- Condition factor index (K) = (W × L−3) × 103, where W is mass in milligrams and L is standard length in millimeters.
2.4. RNA Extraction and cDNA Synthesis
2.5. Quantitative Gene Expression (qPCR)
2.6. Statistical Analysis
3. Results
3.1. Survival and Growth Performance
3.2. Quantitative Gene Expression
3.2.1. Muscle Growth
3.2.2. Enzymatic Hydrolysis of Chitin
3.2.3. Immune Response
3.2.4. Stress Response
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- FAO. The State of World Fisheries and Aquaculture 2020. Sustainability in action. Rome. Available online: http://www.fao.org/documents/card/en/c/ca9229en (accessed on 7 July 2020).
- Daniel, N. A review on replacing fish meal in aqua feeds using plant protein sources. Int. J. Fish. Aquat. Stud. 2018, 6, 164–179. [Google Scholar]
- Hua, K.; Cobcroft, J.M.; Cole, A.; Condon, K.; Jerry, D.R.; Mangott, A.; Praeger, C.; Vucko, M.J.; Zeng, C.; Zenger, K.; et al. The future of aquatic protein: Implications for protein sources in aquaculture diets. One Earth 2019, 1, 316–329. [Google Scholar] [CrossRef]
- Henry, M.; Gasco, L.; Piccolo, G.; Fountoulaki, E. Review on the use of insects in the diet of farmed fish: Past and future. Anim. Feed Sci. Tech. 2015, 203, 1–22. [Google Scholar] [CrossRef]
- AAFCO (Association of American Feed Control Officials). AAFCO Midyear Meeting Agenda Book; Hyatt Regency: Savannah, GA, USA, 2019; p. 42. [Google Scholar]
- Ramos-Elorduy, J.; González, E.A.; Hernández, A.R.; PINO, J.M. Use of Tenebrio molitor (Coleoptera: Tenebrionidae) to recycle organic wastes and as feed for broiler chickens. J. Econ. Entomol. 2002, 95, 214–220. [Google Scholar] [CrossRef] [PubMed]
- Van Huis, A.; Van Itterbeeck, J.; Klunder, H.; Mertens, E.; Halloran, A.; Muir, G.; Vantomme, P. Edible Insects —Future Prospects for Food and Feed Security; Forestry Paper 171; FAO (Food and Agriculture Organization of the United Nations): Rome, Italy, 2013. [Google Scholar]
- Chia, S.Y.; Tanga, C.M.; van Loon, J.J.A.; Dicke, M. Insects for sustainable animal feed: Inclusive business models involving smallholder farmers. Curr. Opin. Environ. Sustain. 2019, 41, 23–30. [Google Scholar] [CrossRef]
- Abdel-Tawwab, M.; Khalil, R.H.; Metwally, A.A.; Shakweer, M.S.; Khallaf, M.A.; Abdel- Latif, H.M.R. Effects of black soldier fly (Hermetia illucens L.) larvae meal on growth performance, organs-somatic indices, body composition, and hemato-biochemical variables of European sea bass. Dicentrarchus Labrax. Aquac. 2020, 522, 735136. [Google Scholar] [CrossRef]
- Belghit, I.; Liland, N.S.; Gjesdal, P.; Biancarosa, I.; Menchetti, E.; Li, Y.; Waagbø, R.; Krogdahl, Å.; Lock, E.J. Black soldier fly larvae meal can replace fish meal in diets of sea-water phase Atlantic salmon (Salmo salar). Aquaculture 2019, 503, 609–619. [Google Scholar] [CrossRef]
- Fawole, F.J.; Adeoye, A.A.; Tiamiyu, L.O.; Ajala, K.I.; Obadara, S.O.; Ganiyu, I.O. Substituting fishmeal with Hermetia illucens in the diets of African catfish (Clarias gariepinus): Effects on growth, nutrient utilization, haematophysiological response, and oxidative stress biomarker. Aquaculture 2020, 518, 734849. [Google Scholar] [CrossRef]
- Sealey, W.M.; Gaylord, T.G.; Barrows, F.T.; Tomberlin, J.K.; McGuire, M.A.; Ross, C.; St-Hilaire, S. Sensory Analysis of Rainbow Trout, Oncorhynchus mykiss, Fed Enriched Black Soldier Fly Prepupae, Hermetia illucens. J. World Aquac. Soc. 2011, 42, 34–45. [Google Scholar] [CrossRef]
- Zarantoniello, M.; Randazzo, B.; Truzzi, C.; Giorgini, E.; Marcellucci, C.; Vargas-Abúndez, J.A.; Zimbelli, A.; Annibaldi, A.; Parisi, G.; Tulli, F.; et al. A six-months study on Black Soldier Fly (Hermetia illucens) based diets in zebrafish. Sci. Rep. 2019, 9, 8598. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Chen, X.; Wang, H.; Yang, Q.; Ur Rehman, K.; Li, W.; Cai, M.; Li, Q.; Mazza, L.; Zhang, J.; et al. Dynamic changes of nutrient composition throughout the entire life cycle of black soldier fly. PLoS ONE 2017, 12, e0182601. [Google Scholar] [CrossRef] [PubMed]
- Giannetto, A.; Oliva, S.; Ceccon Lanes, C.F.; de Araújo Pedron, F.; Savastano, D.; Baviera, C.; Parrino, V.; Lo Paro, G.; Spanò, N.; Cappello, T.; et al. Hermetia illucens (Diptera: Stratiomydae) larvae and prepupae: Biomass production, fatty acid profile and expression of key genes involved in lipid metabolism. J. Biotechnol. 2020, 307, 44–54. [Google Scholar] [CrossRef] [PubMed]
- Giannetto, A.; Oliva, S.; Riolo, K.; Savastano, D.; Parrino, V.; Cappello, T.; Maisano, M.; Fasulo, S.; Mauceri, A. Waste Valorization via Hermetia Illucens to Produce Protein-Rich Biomass for Feed: Insight into the Critical Nutrient Taurine. Animals 2020, 10, 1710. [Google Scholar] [CrossRef] [PubMed]
- Huyben, D.; Vidakovi´c, A.; Werner Hallgren, S.; Langeland, M. High-throughput sequencing of gut microbiota in rainbow trout (Oncorhynchus mykiss) fed larval and pre-pupae stages of black soldier fly (Hermetia illucens). Aquaculture 2019, 500, 485–491. [Google Scholar] [CrossRef]
- Zarantoniello, M.; Bruni, L.; Randazzo, B.; Vargas, A.; Gioacchini, G.; Truzzi, C.; Annibaldi, A.; Riolo, P.; Parisi, G.; Cardinaletti, G.; et al. Partial Dietary Inclusion of Hermetia illucens (Black Soldier Fly) Full-Fat Prepupae in Zebrafish Feed: Biometric, Histological, Biochemical, and Molecular Implications. Zebrafish 2018, 15, 519–532. [Google Scholar] [CrossRef] [PubMed]
- Ulloa, P.E.; Iturra, P.; Neira, R.; Araneda, C. Zebrafish as a model organism for nutrition and growth: Towards comparative studies of nutritional genomics applied to aquacultured fishes. Rev. Fish Biol. Fisher. 2011, 21, 649–666. [Google Scholar] [CrossRef]
- Kim, W.; Bae, S.; Park, H.; Park, K.; Lee, S.; Choi, Y.; Han, S.; Koh, Y.H. The Larval Age and Mouth Morphology of the Black Soldier Fly, Hermetia illucens (Diptera: Stratiomyidae). Int. J. Indust. Entomol. 2010, 21, 185–187. [Google Scholar]
- Tomberlin, J.K.; Adler, P.H.; Myers, H.M. Development of the black soldier fly (Diptera: Stratiomyidae) in relation to temperature. Environ. Entomol. 2009, 38, 930–934. [Google Scholar] [CrossRef] [PubMed]
- Fernandes, H.; Peres, H.; Carvalho, A.P. Dietary protein requeriment during juvenile growth of zebrafish (Danio rerio). Zebrafish 2016, 13, 548–555. [Google Scholar] [CrossRef] [PubMed]
- AOAC—Association of Official Analytical Chemists. Official Methods of Analysis of the Association of the Analytical Chemists, 16th ed.; AOAC: Washington, DC, USA, 1995; p. 1025. [Google Scholar]
- Bligh, E.G.; Dyer, W.J. A rapid method of total lipid extraction and purification. Can. J. Biochem. Phys. 1959, 37, 911–917. [Google Scholar] [CrossRef] [PubMed]
- Van Soest, P.J.; Robertson, J.B.; Lewis, B.A. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J. Dairy Sci. 1991, 74, 3583–3597. [Google Scholar] [CrossRef]
- Finke, M.D. Complete Nutrient Content of Four Species of Feeder Insects. Zoo Biol. 2013, 32, 27–36. [Google Scholar] [CrossRef] [PubMed]
- Westerfield, M. The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish (Brachydanio rerio), 3rd ed.; University of Oregon Press: Eugene, OR, USA, 1995. [Google Scholar]
- Grush, J.; Noakes, D.J.G.; Moccia, R.D. The efficacy of clove oil as an anesthetic for the zebrafish, Danio rerio (Hamilton). Zebrafish 2004, 1, 46–53. [Google Scholar] [CrossRef] [PubMed]
- Giannetto, A.; Nagasawa, K.; Fasulo, S.; Fernandes, J.M.O. Influence of photoperiod on expression of DNA (cytosine-5) methyltransferases in Atlantic cod. Gene 2013, 519, 222–230. [Google Scholar] [CrossRef] [PubMed]
- Nagasawa, K.; Giannetto, A.; Fernandes, J.M.O. Photoperiod influences growth and MLL (mixed-lineage leukaemia) expression in Atlantic cod. PLoS ONE 2012, 7, e36908. [Google Scholar] [CrossRef] [PubMed][Green Version]
- SAS Institute Inc. SAS® University Edition Quick Start Guide for Students with Visual Impairments; SAS Institute Inc.: Cary, NC, USA, 2018. [Google Scholar]
- Hua, K. A meta-analysis of the effects of replacing fish meals with insect meals on growth performance of fish. Aquaculture 2021, 530, 735732. [Google Scholar] [CrossRef]
- Zarantoniello, M.; Randazzo, B.; Gioacchini, G.; Truzzi, C.; Giorgini, E.; Riolo, P.; Gioia, G.; Bertolucci, C.; Osimani, A.; Cardinaletti, G.; et al. Zebrafish (Danio rerio) physiological and behavioural responses to insect-based diets: A multidisciplinary approach. Sci. Rep. 2020, 10, 10648. [Google Scholar] [CrossRef] [PubMed]
- Tschirner, M.; Simon, A. Influence of different growing substrates and processing on the nutrient composition of black soldier fly larvae destined for animal feed. J. Insects Food Feed 2015, 1, 249–259. [Google Scholar] [CrossRef]
- Spranghers, T.; Ottoboni, M.; Klootwijk, C.; Ovyn, A.; Deboosere, S.; De Meulenaer, B.; De Smet, S. Nutritional composition of black soldier fly (Hermetia illucens ) prepupae reared on different organic waste substrates. J. Sci. Food Agric. 2016, 97, 2594–2600. [Google Scholar] [CrossRef] [PubMed]
- Johnston, I.A.; Bower, N.I.; Macqueen, D.J. Growth and the regulation of myotomal muscle mass in teleost fish. J. Exp. Biol. 2011, 214, 1617–1628. [Google Scholar] [CrossRef] [PubMed]
- Gabillard, J.C.; Kamangar, B.B.; Montserrat, N. Coordinated regulation of the GH/IGF system genes during refeeding in rainbow trout (Oncorhynchus mykiss). J. Endocrinol. 2006, 191, 15–24. [Google Scholar] [CrossRef] [PubMed]
- Lavajoo, F.; Perelló-Amorós, m.; Vélez, E.J.; Sánchez-Moya, A.; Balbuena-Pecino, S.; Riera-Heredia, N.; Fernández-Borràs, J.; Blasco, J.; Navarro, I.; Capilla, E.; et al. Regulatory mechanisms involved in muscle and bone remodeling during refeeding in gilthead sea bream. Sci. Rep. 2020, 10, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Kroeckel, S.; Harjes, A.G.E.; Roth, I.; Katz, H.; Wuertz, S.; Susenbeth, A.; Schulz, C. When a turbot catches a fly: Evaluation of a pre-pupae meal of the Black Soldier Fly (Hermetia illucens) as fish meal substitute—Growth performance and chitin degradation in juvenile turbot (Psetta maxima). Aquaculture 2012, 364, 345–352. [Google Scholar] [CrossRef]
- Shiau, S.Y.; Yu, Y.P. Dietary supplementation of chitin and chitosan depresses growth in tilapia, Oreochromis niloticus× O. aureus. Aquaculture 1999, 179, 439–446. [Google Scholar] [CrossRef]
- Diener, S.; Zurbrügg, C.; Tockner, K. Conversion of organic material by black soldier fly larvae: Establishing optimal feeding rates. Waste Manag. Res. 2009, 27, 603–610. [Google Scholar] [CrossRef] [PubMed]
- Gopalakannan, A.; Arul, V. Immunomodulatory effects of dietary intake of chitin, chitosan and levamisole on the immune system of Cyprinus carpio and control of Aeromonas hydrophila infection in ponds. Aquaculture 2006, 255, 179–187. [Google Scholar] [CrossRef]
- Hansen, A.C.; Rosenlund, G.; Karlsen, Ø.; Koppe, W.; Hemre, G.I. Total replacement of fish meal with plant proteins in diets for Atlantic cod (Gadus morhua L.) I—Effects on growth and protein retention. Aquaculture 2007, 272, 599–611. [Google Scholar] [CrossRef]
- Rapatsa, M.M.; Moyo, N.A.G. Evaluation of Imbrasia belina meal as a fishmeal substitute in Oreochromis mossambicus diets: Growth performance, histological analysis and enzyme activity. Aquac. Rep. 2017, 5, 18–26. [Google Scholar] [CrossRef]
- Fines, B.C.; Holt, G.J. Chitinase and apparent digestibility of chitin in the digestive tract of juvenile cobia, Rachycentron canadum. Aquaculture 2010, 303, 34–39. [Google Scholar] [CrossRef]
- Danulat, E. The effects of various diets on chitinase and bglucosidase activities and the condition of cod, Gadus morhua (L.). J. Fish Biol. 1986, 28, 191–197. [Google Scholar] [CrossRef]
- Lindsay, G.J.H.; Walton, M.J.; Adron, J.W.; Fletcher, T.C.; Cho, C.Y.; Cowey, C.B. The growth of rainbow trout (Salmo gairdneri) given diets containing chitin and its relationship to chitinolytic enzymes and chitin digestibility. Aquaculture 1984, 37, 315–334. [Google Scholar] [CrossRef]
- Kamilya, D.; Khan, M.I.R. Chitin and chitosan as promising immunostimulant for aquaculture. In Handbook of Chitin and Chitosan, 1st ed.; Thomas, S., Pius, A., Gopi, S., Eds.; Elsevier: Amsterdã, The Netherlands, 2020; pp. 761–771. [Google Scholar] [CrossRef]
- Esteban, M.A.; Mulero, V.; Cuesta, A.; Ortuño, J.; Meseguer, J. Effects of injecting chitin particles on the innate immune response of gilthead seabream (Sparus aurata L.). Fish Shellfish Immun. 2000, 10, 543–554. [Google Scholar] [CrossRef] [PubMed]
- Harikrishnan, R.; Kim, J.S.; Balasundaram, C.; Heo, M.S. Dietary supplementation with chitin and chitosan on haematology and innate immune response in Epinephelus bruneus against Philasterides dicentrarchi. Exp. Parasitol. 2012, 131, 116–124. [Google Scholar] [CrossRef] [PubMed]
- Xiao, X.; Jin, P.; Zheng, L.; Cai, M.; Yu, Z.; Yu, J.; Zhang, J. Effects of black soldier fly (Hermetia illucens) larvae meal protein as a fishmeal replacement on the growth and immune index of yellow catfish (Pelteobagrus fulvidraco). Aquac. Res. 2018, 1–9. [Google Scholar] [CrossRef]
- Stenberg, O.K.; Holen, E.; Piemontese, L.; Liland, N.S.; Lock, E.J.; Espe, M.; Belghit, I. Effect of dietary replacement of fish meal with insect meal on in vitro bacterial and viral induced gene response in Atlantic salmon (Salmo salar) head kidney leukocytes. Fish Shellfish Immun. 2019, 91, 223–232. [Google Scholar] [CrossRef] [PubMed]
Ingredients | Control | V Instar | Prepupae |
---|---|---|---|
Fish meal | 500 | - | - |
Defatted V instar larvae meal | - | 500 | - |
Defatted prepupae meal | - | - | 500 |
Soy protein concentrate | 250 | 148.8 | 200 |
Soybean meal | 140 | 241.2 | 190 |
Canola oil | 40 | 40 | 40 |
Defatted rice meal | 30 | 30 | 30 |
Vitamin/MineralPremix | 30 | 30 | 30 |
Salt | 10 | 10 | 10 |
Proximate composition (%) | |||
Crude protein | 46.43 | 45.39 | 46.92 |
Crude lipid | 9.40 | 9.70 | 9.13 |
Ash | 22.19 | 9.16 | 9.01 |
NFE 1 | 13.86 | 24.11 | 18.50 |
Acid detergent fiber | 8.12 | 11.64 | 13.60 |
Chitin | 6.31 | 7.22 | |
Dry matter | 94.53 | 92.69 | 93.30 |
- | |||
Gross energy (MJ Kg−1)2 | 17.09 | 18.74 | 18.57 |
Protein/energy (g/MJ) | 27.17 | 24.22 | 25.27 |
Gene Name | Forward (5′-3′) Reverse (5′-3′) | Size (bp) | E (%) | GenBank | Reference |
---|---|---|---|---|---|
igf-1 | GGCAAATCTCCACGATCTCTAC | 198 | 105 | ENSDART00000004717.8 | [13] |
CGGTTTCTCTTGTCTCTCTCAG | |||||
igf-2 | CGTGTGTGGAGAAGATGGCT | 156 | 108 | ENSDART00000009642.7 | This study |
ACATCTCGCTCCGACTTCAC | |||||
mstnb | CGGACTGGACTGCGATGAG | 174 | 97 | ENSDART00000100386.2 | [13] |
AGATGGGTGTGGGGATACTTC | |||||
myod1 | AGACGAGAAGACGGAACAGC | 116 | 99 | NM_131262.2 | This study |
CACGATGCTGGACAGACAAT | |||||
myog | CACATACTGGGGTGTCGTCC | 199 | 94 | ENSDART00000014062.7 | This study |
GCCTCTGTTCCCGTTATGCT | |||||
myf5 | GCAGTGTTTGTCCAGCATCG | 192 | 102 | ENSDART00000112035.2 | This study |
GCAAGCAGTGTGAGTAAGCGT | |||||
il1b | AGGCTGGAGATGTGGACTTC | 95 | 94 | ENSDART00000185837 | [13] |
GTGGATTGGGGTTTGATGTG | |||||
il6 | ATGACGGCATTTGAAGGGGT | 115 | 94 | ENSDART00000166112.2 | This study |
TCAGGACGCTGTAGATTCGC | |||||
tnfα | GGAGAGTTGCCTTTACCGCT | 155 | 90 | ENSDART00000025847.9 | This study |
TGTTGATTGCCCTGGGTCTT | |||||
hsp70 | TCCTGACCATTGAAGACGGC | 151 | 100 | ENSDART00000124762.3 | This study |
GCCCTCTTGTTCTGACTGATGT | |||||
nr3c1 | CTGTGTTTCGCTCCAGACCT | 184 | 94 | ENSDART00000181179.1 | This study |
TCTTCAACCCATCCTTCGG | |||||
chia.2 | AGTGCTGCTGTATCTGCTGG | 127 | 90 | ENSDART00000164702.2 | This study |
CTGTGAATCGCTCCCAAGTT | |||||
chia.3 | TGCCTCCAATGCCTTCAACT | 122 | 101 | ENSDART00000067817.6 | This study |
TCCATCTGGCTTCCCATTACA | |||||
chia.5 | CACGGCTCACAGGACAACAT | 160 | 105 | NM_001110041 | This study |
CATACGCAGCAAAGCCCAT | |||||
arp | CATCTCGCCCTTCTCCTACG | 168 | 101 | AF134852 | This study |
GCAAGAGTTGGGTAGCCGAT | |||||
rpl13 | ATCTCTGTTGACTCACGCCG | 80 | 103 | ENSDART00000176368.2 | This study |
GTGCGGTATTCCTTCAGCCT | |||||
ef1-α | CCTGCCAATGTAACCACTGA | 193 | 95 | NM_131263 | This study |
TGATGACCTGAGCGTTGAAG |
Treatment | Control | V Instar | Prepupae |
---|---|---|---|
Survival rate (%) | 92.50 ± 3.23 a | 93.75 ± 4.73 a | 96.25 ± 2.39 a |
Final total length (mm) | 24.11 ± 0.64 b | 26.08 ± 0.98 ab | 28.46 ± 0.38 a |
Final standard length (mm) | 20.14 ± 0.63 b | 21.84 ± 0.68 ab | 23.08 ± 0.26 a |
Height (mm) | 5.38 ± 0.16 b | 5.71 ± 0.12 ab | 6.11 ± 0.09 a |
Final body weight (mg) | 132.99 ± 10.39 b | 159.41 ± 13.58 ab | 189.70 ± 5.00 a |
Weight gain (mg) | 127.99 ± 10.39 b | 154.41 ± 13.58 ab | 184.70 ± 5.39 a |
Daily growth rate (mg/day) | 2.13 ± 0.17 b | 2.57 ± 0.23 ab | 3.08 ± 0.08 a |
Specific growth rate | 5.37 ± 0.12 b | 5.67 ± 0.14 ab | 5.97 ± 0.04 a |
Condition factor index | 1.55 ± 0.02 a | 1.39 ± 0.03 b | 1.46 ± 0.03 ab |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lanes, C.F.C.; Pedron, F.A.; Bergamin, G.T.; Bitencourt, A.L.; Dorneles, B.E.R.; Villanova, J.C.V.; Dias, K.C.; Riolo, K.; Oliva, S.; Savastano, D.; et al. Black Soldier Fly (Hermetia illucens) Larvae and Prepupae Defatted Meals in Diets for Zebrafish (Danio rerio). Animals 2021, 11, 720. https://doi.org/10.3390/ani11030720
Lanes CFC, Pedron FA, Bergamin GT, Bitencourt AL, Dorneles BER, Villanova JCV, Dias KC, Riolo K, Oliva S, Savastano D, et al. Black Soldier Fly (Hermetia illucens) Larvae and Prepupae Defatted Meals in Diets for Zebrafish (Danio rerio). Animals. 2021; 11(3):720. https://doi.org/10.3390/ani11030720
Chicago/Turabian StyleLanes, Carlos F. C., Fabio A. Pedron, Giovani T. Bergamin, Andressa L. Bitencourt, Brenda E. R. Dorneles, Jessica C. V. Villanova, Kimberly C. Dias, Kristian Riolo, Sabrina Oliva, Domenico Savastano, and et al. 2021. "Black Soldier Fly (Hermetia illucens) Larvae and Prepupae Defatted Meals in Diets for Zebrafish (Danio rerio)" Animals 11, no. 3: 720. https://doi.org/10.3390/ani11030720
APA StyleLanes, C. F. C., Pedron, F. A., Bergamin, G. T., Bitencourt, A. L., Dorneles, B. E. R., Villanova, J. C. V., Dias, K. C., Riolo, K., Oliva, S., Savastano, D., & Giannetto, A. (2021). Black Soldier Fly (Hermetia illucens) Larvae and Prepupae Defatted Meals in Diets for Zebrafish (Danio rerio). Animals, 11(3), 720. https://doi.org/10.3390/ani11030720