Sequence Variation in the Bovine Lipin-1 Gene (LPIN1) and Its Association with Milk Fat and Protein Contents in New Zealand Holstein-Friesian × Jersey (HF × J)-cross Dairy Cows
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cows Investigated and Sample Collection
2.2. Variation Screening and Genotyping
2.3. Sequencing of Variants and Sequence Analysis
2.4. Statistical Analyses
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Carman, G.M.; Han, G.S. Phosphatidic acid phosphatase, a key enzyme in the regulation of lipid synthesis. J. Biol. Chem. 2009, 284, 2593–2597. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Donkor, J.; Sariahmetoglu, M.; Dewald, J.; Brindley, D.N.; Reue, K. Three mammalian lipins act as phosphatidate phosphatases with distinct tissue expression patterns. J. Biol. Chem. 2007, 282, 3450–3457. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reue, K.; Zhang, P. The lipin protein family: Dual roles in lipid biosynthesis and gene expression. FEBS Lett. 2008, 582, 90–96. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Phan, J.; Reue, K. Lipin, a lipodystrophy and obesity gene. Cell. Metab. 2005, 1, 73–83. [Google Scholar] [CrossRef] [Green Version]
- Suviolahti, E.; Reue, K.; Cantor, R.M.; Phan, J.; Gentile, M.; Naukkarinen, J.; Soro-Paavonen, A.; Oksanen, L.; Kaprio, J.; Rissanen, A.; et al. Cross-species analyses implicate Lipin 1 involvement in human glucose metabolism. Hum. Mol. Genet. 2006, 15, 377–386. [Google Scholar] [CrossRef] [Green Version]
- Mohammad, M.A.; Haymond, M.W. Regulation of lipid synthesis genes and milk fat production in human mammary epi-thelial cells during secretory activation. Am. J. Physiol. Endocrinol. Metab. 2013, 305, E700–E716. [Google Scholar] [CrossRef] [Green Version]
- Kim, H.E.; Bae, E.; Jeong, D.Y.; Kim, M.J.; Jin, W.J.; Park, S.W.; Han, G.S.; Carman, G.M.; Koh, E.; Kim, K.S. Lipin1 regulates PPARγ transcriptional activity. Biochem. J. 2013, 453, 49–60. [Google Scholar] [CrossRef]
- Cao, H.; Hegele, R.A. Identification of single-nucleotide polymorphisms in the human LPIN1 gene. J. Hum. Genet. 2002, 47, 370–372. [Google Scholar] [CrossRef]
- Péterfy, M.; Phan, J.; Reue, K. Alternatively spliced lipin isoforms exhibit distinct expression pattern, subcellular localization, and role in adipogenesis. J. Biol. Chem. 2005, 280, 32883–32889. [Google Scholar] [CrossRef] [Green Version]
- Michot, C.; Hubert, L.; Brivet, M.; De Meirleir, L.; Valayannopoulos, V.; Muller-Felber, W.; Venkateswaran, R.; Ogier, H.; Desguerre, I.; Altuzarra, C.; et al. LPIN1 gene mutations: A major cause of severe rhabdomyolysis in early childhood. Hum. Mutat. 2010, 31, E1564–E1573. [Google Scholar] [CrossRef] [Green Version]
- Zeharia, A.; Shaag, A.; Houtkooper, R.H.; Hindi, T.; de Lonlay, P.; Erez, G.; Hubert, L.; Saada, A.; de Keyzer, Y.; Eshel, G.; et al. Mutations in LPIN1 cause recurrent acute myoglobinuria in childhood. Am. J. Hum. Genet. 2008, 83, 489–494. [Google Scholar] [CrossRef] [Green Version]
- Pichler, K.; Scholl-Buergi, S.; Birnbacher, R.; Freilinger, M.; Straub, S.; Brunner, J.; Zschocke, J.; Bittner, R.E.; Karall, D. A novel therapeutic approach for LPIN1 mutation-associated rhabdomyolysis–the Austrian experience. Muscle Nerve 2015, 52, 437–439. [Google Scholar] [CrossRef] [PubMed]
- Bergounioux, J.; Brassier, A.; Rambaud, C.; Bustarret, O.; Michot, C.; Hubert, L.; Arnoux, J.B.; Laquerriere, A.; Bekri, S.; Galene-Gromez, S.; et al. Fatal rhabdomyolysis in 2 children with LPIN1 mutations. J. Pediatr. 2012, 160, 1052–1054. [Google Scholar] [CrossRef] [PubMed]
- Michot, C.; Hubert, L.; Romero, N.B.; Gouda, A.; Mamoune, A.; Mathew, S.; Kirk, E.; Viollet, L.; Rahman, S.; Bekri, S.; et al. Study of LPIN1, LPIN2 and LPIN3 in rhabdomyolysis and exercise-induced myalgia. J. Inherit. Metab. Dis. 2012, 35, 1119–1128. [Google Scholar] [CrossRef] [PubMed]
- Donkor, J.; Zhang, P.; Wong, S.; O’Loughlin, L.; Dewald, J.; Kok, B.P.; Brindley, D.N.; Reue, K. A conserved serine residue is required for the phosphatidate phosphatase activity but not the transcriptional coactivator functions of lipin-1 and lipin-2. J. Biol. Chem. 2009, 284, 29968–29978. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bionaz, M.; Loor, J.J. ACSL1, AGPAT6, FABP3, LPIN1, and SLC27A6 are the most abundant isoforms in bovine mammary tissue and their expression is affected by stage of lactation. J. Nutr. 2008, 138, 1019–1024. [Google Scholar] [CrossRef]
- Han, B.; Yuan, Y.; Liang, R.; Li, Y.; Liu, L.; Sun, D. Genetic effects of LPIN1 polymorphisms on milk production traits in dairy cattle. Genes 2019, 10, 265. [Google Scholar] [CrossRef] [Green Version]
- Li, Q.; Liang, R.; Li, Y.; Gao, T.; Li, Q.; Sun, D.; Li, J. Identification of candidate genes for milk production traits by RNA sequencing on bovine liver at different lactation stages. BMC Genet. 2020, 21, 72. [Google Scholar] [CrossRef]
- Wang, X.; Zhou, H.; Hickford, J.G.; Li, S.; Wang, J.; Liu, X.; Hu, J.; Luo, Y. Variation in the yak lipin-1 gene and its association with milk traits. J. Dairy Res. 2020, 87, 166–169. [Google Scholar] [CrossRef]
- Pegolo, S.; Cecchinato, A.; Mele, M.; Conte, G.; Schiavon, S.; Bittante, G. Effects of candidate gene polymorphisms on the detailed fatty acids profile determined by gas chromatography in bovine milk. J. Dairy Sci. 2016, 99, 4558–4573. [Google Scholar] [CrossRef] [Green Version]
- Nafikov, R.A.; Schoonmaker, J.P.; Korn, K.T.; Noack, K.; Garrick, D.J.; Koehle, K.J.; Minick-Bormann, J.; Reecy, J.M.; Spurlock, D.E.; Beitz, D.C. Polymorphisms in lipogenic genes and milk fatty acid composition in Holstein dairy cattle. Genomics 2014, 104, 572–581. [Google Scholar] [CrossRef] [PubMed]
- New Zealand Dairy Statistics 2019–2020. Available online: http://www.lic.co.nz/about/dairy-statistics (accessed on 3 November 2021).
- Zhou, H.; Hickford, J.G.; Fang, Q. A two-step procedure for extracting genomic DNA from dried blood spots on filter paper for polymerase chain reaction amplification. Anal. Biochem. 2006, 354, 159–161. [Google Scholar] [CrossRef] [PubMed]
- Byun, S.O.; Fang, Q.; Zhou, H.; Hickford, J.G. An effective method for silver-staining DNA in large numbers of polyacrylamide gels. Anal. Biochem. 2009, 385, 174–175. [Google Scholar] [CrossRef] [PubMed]
- Gong, H.; Zhou, H.; Hickford, J.G. Diversity of the glycine/tyrosine-rich keratin-associated protein 6 gene (KAP6) family in sheep. Mol. Biol. Rep. 2011, 38, 31–35. [Google Scholar] [CrossRef]
- Wang, G.; Zhou, H.; Gong, H.; He, J.; Luo, Y.; Hickford, J.G.; Hu, J.; Wang, J.; Liu, X.; Li, S. Variation in the lipin 1 gene is associated with birth weight and carcass traits in New Zealand Romney sheep. Animals 2020, 10, 237. [Google Scholar] [CrossRef] [Green Version]
- Gong, H.; Zhou, H.; Yu, Z.; Dyer, J.; Plowman, J.E.; Hickford, J. Identification of the ovine keratin-associated protein KAP1-2 gene (KRTAP1-2). Exp. Dermatol. 2011, 20, 815–819. [Google Scholar] [CrossRef]
- Wang, J.; Zhou, H.; Hickford, J.G.; Luo, Y.; Gong, H.; Hu, J.; Zhao, M.; Hao, Z.; Shen, J.; Ke, N.; et al. Identification of the ovine keratin-associated protein 2-1 gene and its genetic variation in four Chinese sheep breeds. Genes 2020, 11, 604. [Google Scholar] [CrossRef]
- Yan, W.; Zhou, H.; Luo, Y.; Hu, J.; Hickford, J.G. Allelic variation in ovine fatty acid-binding protein 4 (FABP4) gene. Mol. Biol. Rep. 2012, 39, 10621–10625. [Google Scholar] [CrossRef]
- Zhao, M.; Zhou, H.; Luo, Y.; Wang, J.; Hu, J.; Liu, X.; Li, S.; Zhang, K.; Zhen, H.; Hickford, J.G. Variation in a newly identified caprine keratin-associated protein (KAP) gene is associated with cashmere fiber yield in Longdong cashmere goats. Genes 2021, 12, 625. [Google Scholar] [CrossRef]
- Chen, Y.; Rui, B.B.; Tang, L.Y.; Hu, C.M. Lipin Family Proteins-Key Regulators in Lipid Metabolism. Ann. Nutr. Metab. 2015, 66, 10–18. [Google Scholar] [CrossRef]
- Osorio, J.S.; Lohakare, J.; Bionaz, M. Biosynthesis of milk fat, protein, and lactose: Roles of transcriptional and posttranscriptional regulation. Physiol. Genom. 2016, 48, 231–256. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peterson, T.R.; Sengupta, S.S.; Harris, T.E.; Carmack, A.E.; Kang, S.A.; Balderas, E.; Guertin, D.A.; Madden, K.L.; Carpenter, A.E.; Finck, B.N.; et al. mTOR complex 1 regulates lipin 1 localization to control the SREBP pathway. Cell 2011, 146, 408–420. [Google Scholar] [CrossRef] [PubMed] [Green Version]


| Region Amplified | PCR Primer Sequences (5′–3′) | Amplicon Size | SSCP Conditions |
|---|---|---|---|
| 5′ non-coding | ACAAGGAGAGAACATGGGAG | 416 bp | 14% gel, 350 V, 16 °C |
| CACACCTCAGCACTGGGTC | |||
| LPIN1β-spliced exon | AGCAATTCACTATGGGCCTGC | 468 bp | 10–14% gel, 250–390 V, 4–25 °C |
| CACATAAGTAATTTGGTTAATGG | |||
| 6th coding exon | GATCCAGTCCTCACCACAC | 443 bp | 10% gel, 390 V, 12 °C |
| CAAGAGAGATGTCCTGTCTC |
| Milk Trait | Variant | Absent | n | Present | n | p-Value |
|---|---|---|---|---|---|---|
| Mean ± SE | Mean ± SE | |||||
| Milk yield (L/d) | A | 21.81 ± 0.269 | 177 | 22.10 ± 0.232 | 264 | 0.384 |
| B | 22.04 ± 0.222 | 277 | 21.88 ± 0.285 | 164 | 0.643 | |
| C | 22.28 ± 0.311 | 134 | 21.86 ± 0.211 | 307 | 0.228 | |
| Milk fat percentage (%) | A | 4.93 ± 0.044 | 177 | 4.91 ± 0.038 | 264 | 0.666 |
| B | 4.92 ± 0.036 | 277 | 4.92 ± 0.046 | 164 | 0.989 | |
| C | 4.81 ± 0.050 | 134 | 4.96 ± 0.034 | 307 | 0.006 | |
| Milk protein percentage (%) | A | 4.08 ± 0.022 | 177 | 4.05 ± 0.019 | 264 | 0.169 |
| B | 4.06 ± 0.018 | 277 | 4.07 ± 0.023 | 164 | 0.812 | |
| C | 3.99 ± 0.025 | 134 | 4.09 ± 0.017 | 307 | 0.001 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Du, X.; Zhou, H.; Liu, X.; Li, Y.; Hickford, J.G.H. Sequence Variation in the Bovine Lipin-1 Gene (LPIN1) and Its Association with Milk Fat and Protein Contents in New Zealand Holstein-Friesian × Jersey (HF × J)-cross Dairy Cows. Animals 2021, 11, 3223. https://doi.org/10.3390/ani11113223
Du X, Zhou H, Liu X, Li Y, Hickford JGH. Sequence Variation in the Bovine Lipin-1 Gene (LPIN1) and Its Association with Milk Fat and Protein Contents in New Zealand Holstein-Friesian × Jersey (HF × J)-cross Dairy Cows. Animals. 2021; 11(11):3223. https://doi.org/10.3390/ani11113223
Chicago/Turabian StyleDu, Xiaohua, Huitong Zhou, Xia Liu, Yunhai Li, and Jonathan G. H. Hickford. 2021. "Sequence Variation in the Bovine Lipin-1 Gene (LPIN1) and Its Association with Milk Fat and Protein Contents in New Zealand Holstein-Friesian × Jersey (HF × J)-cross Dairy Cows" Animals 11, no. 11: 3223. https://doi.org/10.3390/ani11113223
APA StyleDu, X., Zhou, H., Liu, X., Li, Y., & Hickford, J. G. H. (2021). Sequence Variation in the Bovine Lipin-1 Gene (LPIN1) and Its Association with Milk Fat and Protein Contents in New Zealand Holstein-Friesian × Jersey (HF × J)-cross Dairy Cows. Animals, 11(11), 3223. https://doi.org/10.3390/ani11113223

