Interleukin 17D Enhances the Developmental Competence of Cloned Pig Embryos by Inhibiting Apoptosis and Promoting Embryonic Genome Activation
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Medium and Reagents
2.3. In Vitro Oocyte Maturation
2.4. In Vitro Fertilization
2.5. Somatic Cell Nuclear Transfer
2.6. IL17D Treatment
2.7. Transcriptome Sequencing
2.8. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.9. Terminal Deoxynucleotidyl Transferase (TdT)-Mediated 2′-Deoxyuridine-5′-Triphosphate-Digoxigenin Nick-End Labeling (TUNEL) Assay
2.10. Plasmid Construction
2.11. Microinjection
2.12. Statistical Analysis
3. Results
3.1. IL17D Expression Is Abnormal in Cloned Pig Embryos Compared to That in In Vivo-Fertilization-Derived Pig Embryos
3.2. IL17D Treatment Improved the Developmental Competence of Porcine SCNT and IVF Embryos
3.3. IL17D Treatment Inhibited the Apoptosis of Porcine SCNT and IVF Embryos at Blastocyst Stage
3.4. IL17D Treatment Increased the Expression of Global Genes in Porcine SCNT Embryos at 4-Cell Stage
3.5. IL17D Treatment Improved Porcine SCNT Embryo Development by Regulating Apoptosis-Related Pathways
3.6. The Effects of IL17D on Improving Porcine SCNT Embryo Development Might Be Related to the Up-Regulation of GADD45B Expression
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Li, Z.; He, X.; Chen, L.; Shi, J.; Rong, Z.; Xu, W.; Liu, D.; Wu, Z. Bone marrow mesenchymal stem cells are an attractive donor cell type for production of cloned pigs as well as genetically modified cloned pigs by somatic cell nuclear transfer. Cell. Reprogram. 2013, 15, 459–470. [Google Scholar] [CrossRef] [Green Version]
- Shi, J.; Tan, B.; Luo, L.; Li, Z.; Hong, L.; Yang, J.; Cai, G.; Zheng, E.; Wu, Z.; Gu, T. Assessment of the growth and reproductive performance of cloned pietrain boars. Animals 2020, 10, 2053. [Google Scholar] [CrossRef]
- Zhang, X.; Li, Z.; Yang, H.; Liu, D.; Cai, G.; Li, G.; Mo, J.; Wang, D.; Zhong, C.; Wang, H. Novel transgenic pigs with enhanced growth and reduced environmental impact. eLife 2018, 7, e34286. [Google Scholar] [CrossRef] [PubMed]
- Su, F.; Wang, Y.; Liu, G.; Ru, K.; Liu, X.; Yu, Y.; Liu, J.; Wu, Y.; Quan, F.; Guo, Z.; et al. Generation of transgenic cattle expressing human β--defensin 3 as an approach to reducing susceptibility to Mycobacterium bovis infection. FEBS J. 2016, 283, 776–790. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Y.; Wang, Y.; Yulin, B.; Tang, B.; Wang, M.; Zhang, C.; Zhang, W.; Jin, J.; Li, T.; Zhao, R. CRISPR/Cas9--mediated sheep MSTN gene knockout and promote sSMSCs differentiation. J. Cell. Biochem. 2018, 120, 1794–1806. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Li, J.; Vendahl, L.P.; Schmidt, M.; Larsen, K.; Callesen, H. In Vitro manipulation techniques of porcine embryos: A meta-analysis related to transfers, pregnancies and piglets. Reprod. Fertil. Dev. 2014, 27, 429. [Google Scholar] [CrossRef]
- Skrzyszowska, M.; Samiec, M. Generating cloned goats by somatic cell nuclear transfer-molecular determinants and application to transgenics and biomedicine. Int. J. Mol. Sci. 2021, 22, 7490. [Google Scholar] [CrossRef]
- Czernik, M.; Anzalone, D.A.; Palazzese, L.; Oikawa, M.; Loi, P. Somatic cell nuclear transfer: Failures, successes and the challenges ahead. Int. J. Dev. Biol. 2019, 63, 123–130. [Google Scholar] [CrossRef] [PubMed]
- Keefer, C.L. Lessons learned from nuclear transfer (cloning). Theriogenology 2008, 69, 48–54. [Google Scholar] [CrossRef]
- Samiec, M.; Skrzyszowska, M. Preimplantation developmental capability of cloned pig embryos derived from different types of nuclear donor somatic cells. Ann. Anim. Sci. 2010, 10, 385–398. [Google Scholar]
- Em, S.; Shah, F.; Kataria, M.; Yadav, P.S. A comparative study on expression profile of developmentally important genes during pre-implantation stages in buffalo hand-made cloned embryos derived from adult fibroblasts and amniotic fluid derived stem cells. Cytotechnology 2016, 68, 1447–1461. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Samiec, M.; Skrzyszowska, M. Assessment of In Vitro developmental capacity of porcine nuclear-transferred embryos reconstituted with rumulus oophorus cells undergoing vital diagnostics for apoptosis detection / ocena zdolności rozwojowych In Vitro klonalnych zarodków świni rekonsty. Ann. Anim. Sci. 2013, 13, 513–529. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.; Lee, Y.; Lee, G.S.; Lee, S.T.; Lee, E. Comparative study of the developmental competence of cloned pig embryos derived from spermatogonial stem cells and fetal fibroblasts. Reprod. Domest. Anim. 2019, 54, 1258–1264. [Google Scholar] [CrossRef] [PubMed]
- Wiater, J.; Samiec, M.; Skrzyszowska, M.; Lipinski, D. Trichostatin A-assisted epigenomic modulation affects the expression profiles of not only recombinant human alpha 1,2-fucosyltransferase and alpha-galactosidase A enzymes but also galalpha1--> 3Gal epitopes in porcine Bi-transgenic adult cutaneous fibroblast cells. Int. J. Mol. Sci. 2021, 22, 1386. [Google Scholar]
- Gupta, M.K.; Heo, Y.T.; Kim, D.K.; Lee, H.T.; Uhm, S.J. 5-Azacytidine improves the meiotic maturation and subsequent In Vitro development of pig oocytes. Anim. Reprod. Sci. 2019, 208, 106118. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Cui, W.; Meng, C.; Zhang, J.; Li, Y.; Qian, Y.; Xing, G.; Zhao, D.; Cao, S. MC1568 enhances histone acetylation during oocyte meiosis and improves development of somatic cell nuclear transfer embryos in pig. Cell. Reprogram. 2018, 20, 55–65. [Google Scholar] [CrossRef]
- Akagi, S.; Tamura, S.; Matsukawa, K. Timing of the first cleavage and In Vitro developmental potential of bovine somatic cell nuclear transfer embryos activated by different protocols. Cell. Reprogram. 2020, 22, 36–42. [Google Scholar] [CrossRef]
- Samiec, M.; Skrzyszowska, M. The use of different methods of oocyte activation for generation of porcine fibroblast cell nuclear-transferred embryos. Ann. Anim. Sci. 2010, 10, 399–411. [Google Scholar]
- Ongaratto, F.L.; Rodriguez-Villamil, P.; Bertolini, M.; Carlson, D.F. Influence of oocyte selection, activation with a zinc chelator and inhibition of histone deacetylases on cloned porcine embryo and chemically activated oocytes development. Zygote 2020, 28, 286–290. [Google Scholar] [CrossRef]
- Samiec, M.; Skrzyszowska, M.; Lipinski, D. Pseudophysiological transcomplementary activation of reconstructed oocytes as a highly efficient method used for producing nuclear-transferred pig embryos originating from transgenic foetal fibroblast cells. Pol. J. Vet. Sci. 2012, 15, 509–516. [Google Scholar] [CrossRef] [Green Version]
- Agrawal, H.; Selokar, N.L.; Saini, M.; Singh, M.K.; Chauhan, M.S.; Palta, P.; Singla, S.K.; Manik, R.S. m-carboxycinnamic acid bishydroxamide improves developmental competence, reduces apoptosis and alters epigenetic status and gene expression pattern in cloned buffalo (Bubalus bubalis) embryos. Reprod. Domest. Anim. 2018, 53, 986–996. [Google Scholar] [CrossRef]
- Jeong, P.S.; Sim, B.W.; Park, S.H.; Kim, M.J.; Kang, H.G.; Nanjidsuren, T.; Lee, S.; Song, B.S.; Koo, D.B.; Kim, S.U. Chaetocin improves pig cloning efficiency by enhancing epigenetic reprogramming and autophagic activity. Int. J. Mol. Sci. 2020, 21, 4836. [Google Scholar] [CrossRef]
- Samiec, M.; Romanek, J.; Lipiński, D.; Opiela, J. Expression of pluripotency--related genes is highly dependent on trichostatin A--assisted epigenomic modulation of porcine mesenchymal stem cells analysed for apoptosis and subsequently used for generating cloned embryos. Anim. Sci. J. 2019, 90, 1127–1141. [Google Scholar] [CrossRef] [PubMed]
- Magalhaes, L.C.; Cortez, J.V.; Bhat, M.H.; Sampaio, A.; Freitas, J.; Duarte, J.; Melo, L.M.; Freitas, V. In Vitro development and mitochondrial gene expression in brown brocket deer (Mazama gouazoubira) embryos obtained by interspecific somatic cell nuclear transfer. Cell. Reprogram. 2020, 22, 208–216. [Google Scholar] [CrossRef] [PubMed]
- Samiec, M. The role of mitochondrial genome (mtDNA) in somatic and embryo cloning of mammals. A review. J. Anim. Feed Sci. 2005, 14, 213–233. [Google Scholar] [CrossRef] [Green Version]
- Srirattana, K.; Matsukawa, K.; Akagi, S.; Tasai, M.; Tagami, T.; Nirasawa, K.; Nagai, T.; Kanai, Y.; Parnpai, R.; Takeda, K. Constant transmission of mitochondrial DNA in intergeneric cloned embryos reconstructed from swamp buffalo fibroblasts and bovine ooplasm. Anim. Sci. J. 2011, 82, 236–243. [Google Scholar] [CrossRef]
- Samiec, M. The effect of mitochondrial genome on architectural remodeling and epigenetic reprogramming of donor cell nuclei in mammalian nuclear transfer-derived embryos. J. Anim. Feed Sci. 2005, 14, 393–422. [Google Scholar] [CrossRef] [Green Version]
- Xu, L.; Mesalam, A.; Lee, K.L.; Song, S.H.; Khan, I.; Chowdhury, M.; Lv, W.; Kong, I.K. Improves the In Vitro developmental competence and reprogramming efficiency of cloned bovine embryos by additional complimentary cytoplasm. Cell. Reprogram. 2019, 21, 51–60. [Google Scholar] [CrossRef] [Green Version]
- Samiec, M.; Skrzyszowska, M. Extranuclear inheritance of mitochondrial genome and epigenetic reprogrammability of chromosomal telomeres in somatic cell cloning of mammals. Int. J. Mol. Sci. 2021, 22, 3099. [Google Scholar] [CrossRef] [PubMed]
- Song, S.H.; Oh, S.H.; Xu, L.; Lee, K.L.; Hwang, J.Y.; Joo, M.D.; Kong, I.K. Effect of additional cytoplasm of cloned embryo on In Vitro developmental competence and reprogramming efficiency in mice. Cell. Reprogram. 2020, 22, 236–243. [Google Scholar] [CrossRef]
- Konno, S.; Wakayama, S.; Ito, D.; Kazama, K.; Hirose, N.; Ooga, M.; Wakayama, T. Removal of remodeling/reprogramming factors from oocytes and the impact on the full-term development of cloned embryos. Development 2020, 147, dev.190777. [Google Scholar] [CrossRef] [PubMed]
- Samiec, M.; Skrzyszowska, M. Can reprogramming of overall epigenetic memory and specific parental genomic imprinting memory within donor cell-inherited nuclear genome be a major hindrance for the somatic cell cloning of mammals?—A review. Ann. Anim. Sci. 2018, 18, 623–638. [Google Scholar] [CrossRef] [Green Version]
- Zhou, C.; Zhang, J.; Zhang, M.; Wang, D.; Ma, Y.; Wang, Y.; Wang, Y.; Huang, Y.; Zhang, Y. Transcriptional memory inherited from donor cells is a developmental defect of bovine cloned embryos. FASEB J. 2020, 34, 1637–1651. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hao, Y. Apoptosis and In Vitro development of preimplantation porcine embryos derived In Vitro or by nuclear transfer. Biol. Reprod. 2003, 69, 501. [Google Scholar] [CrossRef]
- Kamjoo, M.; Brison, D.R.; Kimber, S.J. Apoptosis in the preimplantation mouse embryo: Effect of strain difference and In Vitro culture. Mol. Reprod. Dev. 2010, 61, 67–77. [Google Scholar] [CrossRef]
- Bohrer, R.C.; Che, L.; Goncalves, P.; Duggavathi, R.; Bordignon, V. Phosphorylated histone H2A.x in porcine embryos produced by IVF and somatic cell nuclear transfer. Reproduction 2013, 146, 325–333. [Google Scholar] [CrossRef] [Green Version]
- Chen, H.; Zhang, L.; Guo, Z.; Wang, Y.; He, R.; Qin, Y.; Quan, F.; Zhang, Y. Improving the development of early bovine somatic--cell nuclear transfer embryos by treating adult donor cells with vitamin C. Mol. Reprod. Dev. 2016, 82, 867–879. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Falcone, T.; Attaran, M.; Goldberg, J.M.; Agarwal, A.; Sharma, R.K. Vitamin C and vitamin E supplementation reduce oxidative stress-induced embryo toxicity and improve the blastocyst development rate. Fertil. Steril. 2002, 78, 1272–1277. [Google Scholar] [CrossRef]
- Liang, S.; Jin, Y.X.; Yuan, B.; Zhang, J.B.; Kim, N.H. Melatonin enhances the developmental competence of porcine somatic cell nuclear transfer embryos by preventing DNA damage induced by oxidative stress. Sci. Rep. 2017, 7, 11114. [Google Scholar] [CrossRef] [Green Version]
- Su, J.; Wang, Y.; Xing, X.; Zhang, L.; Sun, H.; Zhang, Y. Melatonin significantly improves the developmental competence of bovine somatic cell nuclear transfer embryos. J. Pineal Res. 2015, 59, 455–468. [Google Scholar] [CrossRef]
- Cui, X.S.; Jeong, Y.J.; Jun, J.H.; Kim, N.H. Insulin-like growth factor-I alters apoptosis related genes and reduces apoptosis in porcine parthenotes developing In Vitro. Theriogenology 2005, 63, 1070–1080. [Google Scholar] [CrossRef]
- Loureiro, B.; Oliveira, L.J.; Favoreto, M.G.; Hansen, P.J. Colony-stimulating factor 2 inhibits induction of apoptosis in the bovine preimplantation embryo. Am. J. Reprod. Immunol. 2011, 65, 578–588. [Google Scholar] [CrossRef] [PubMed]
- Sosa, F.; Block, J.; Yao, X.; Hansen, P.J. Determinants of survival of the bovine blastocyst to cryopreservation stress: Treatment with colony stimulating factor 2 during the morula-to-blastocyst transition and embryo sex. CABI Agric. Biosci. 2020, 1, 12. [Google Scholar] [CrossRef]
- Chang, H.Y.; Xie, R.X.; Zhang, L.; Fu, L.Z.; Zhang, C.T.; Chen, H.H.; Wang, Z.Q.; Zhang, Y.; Quan, F.S. Overexpression of miR-101-2 in donor cells improves the early development of Holstein cow somatic cell nuclear transfer embryos. J. Dairy Sci. 2019, 102, 4662–4673. [Google Scholar] [CrossRef] [Green Version]
- Wang, M.; Gao, Y.; Qu, P.; Qing, S.; Qiao, F.; Zhang, Y.; Mager, J.; Wang, Y. Sperm-borne miR-449b influences cleavage, epigenetic reprogramming and apoptosis of SCNT embryos in bovine. Sci. Rep. 2017, 7, 13403. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hamazaki, N.; Uesaka, M.; Nakashima, K.; Agata, K.; Imamura, T. Gene activation-associated long noncoding RNAs function in mouse preimplantation development. Development 2015, 142, 910–920. [Google Scholar] [CrossRef] [Green Version]
- Deng, W.; Yang, D.; Zhao, B.; Ouyang, Z.; Song, J.; Fan, N.; Liu, Z.; Zhao, Y.; Wu, Q.; Nashun, B.; et al. Use of the 2A peptide for generation of multi-transgenic pigs through a single round of nuclear transfer. PLoS ONE 2011, 6, e19986. [Google Scholar] [CrossRef] [Green Version]
- Funahashi, H.; Cantley, T.C.; Day, B.N. Synchronization of meiosis in porcine oocytes by exposure to dibutyryl cyclic adenosine monophosphate improves developmental competence following In Vitro fertilization. Biol. Reprod. 1997, 57, 49–53. [Google Scholar] [CrossRef] [Green Version]
- Yoshioka, K.; Suzuki, C.; Tanaka, A.; Anas, I.M.; Iwamura, S. Birth of piglets derived from porcine zygotes cultured in a chemically defined medium. Biol. Reprod. 2002, 66, 112–119. [Google Scholar] [CrossRef] [Green Version]
- Picelli, S.; Faridani, O.R.; Bjorklund, A.K.; Winberg, G.; Sagasser, S.; Sandberg, R. Full-length RNA-seq from single cells using Smart-seq2. Nat. Protoc. 2014, 9, 171–181. [Google Scholar] [CrossRef] [PubMed]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [Green Version]
- Kim, D.; Pertea, G.; Trapnell, C.; Pimentel, H.; Kelley, R.; Salzberg, S.L. TopHat2: Accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 2013, 14, R36. [Google Scholar] [CrossRef] [Green Version]
- Trapnell, C.; Roberts, A.; Goff, L.; Pertea, G.; Kim, D.; Kelley, D.R.; Pimentel, H.; Salzberg, S.L.; Rinn, J.L.; Pachter, L. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat. Protoc. 2012, 7, 562–578. [Google Scholar] [CrossRef] [Green Version]
- He, X.; Tan, C.; Li, Z.; Zhao, C.; Shi, J.; Zhou, R.; Wang, X.; Jiang, G.; Cai, G.; Liu, D.; et al. Characterization and comparative analyses of transcriptomes of cloned and In Vivo fertilized porcine pre-implantation embryos. Biol. Open 2019, 8, o39917. [Google Scholar] [CrossRef] [Green Version]
- Ao, Z.; Wu, X.; Zhou, J.; Gu, T.; Wang, X.; Shi, J.; Zhao, C.; Cai, G.; Zheng, E.; Liu, D.; et al. Cloned pig fetuses exhibit fatty acid deficiency from impaired placental transport. Mol. Reprod. Dev. 2019, 86, 1569–1581. [Google Scholar] [CrossRef]
- Dhanasekaran, S.; Doherty, T.M.; Kenneth, J. Comparison of different standards for real-time PCR-based absolute quantification. J. Immunol. Methods 2010, 354, 34–39. [Google Scholar] [CrossRef]
- KEGG PATHWAY: IL-17 Signaling Pathway-Sus Scrofa (Pig). Available online: https://www.kegg.jp/pathway/ssc04657 (accessed on 14 May 2021).
- KEGG PATHWAY: Apoptosis-Sus Scrofa (Pig). Available online: https://www.kegg.jp/pathway/ssc04210 (accessed on 14 May 2021).
- Ueda, T.; Kohama, Y.; Kuge, A.; Kido, E.; Sakurai, H. GADD45 family proteins suppress JNK signaling by targeting MKK7. Arch. Biochem. Biophys. 2017, 635, 1–7. [Google Scholar] [CrossRef] [Green Version]
- Papa, S.; Zazzeroni, F.; Bubici, C.; Jayawardena, S.; Franzoso, G. Gadd45 beta mediates the NF-kappa B suppression of JNK signalling by targeting MKK7/JNKK2. Nat. Cell Biol. 2004, 6, 146–153. [Google Scholar] [CrossRef]
- Schüle, K.M.; Leichsenring, M.; Andreani, T.; Vastolo, V.; Niehrs, C. GADD45 promotes locus-specific DNA demethylation and 2C cycling in embryonic stem cells. Gene. Dev. 2019, 33, 782–798. [Google Scholar] [CrossRef] [Green Version]
- Galluzzi, L.; Blomgren, K.; Kroemer, G. Mitochondrial membrane permeabilization in neuronal injury. Nat. Rev. Neurosci. 2009, 10, 481–494. [Google Scholar] [CrossRef]
- Nechiporuk, T.; Kurtz, S.E.; Nikolova, O.; Liu, T.; Jones, C.L.; D’Alessandro, A.; Culp-Hill, R.; D’Almeida, A.; Joshi, S.K.; Rosenberg, M.; et al. The TP53 apoptotic network is a primary mediator of resistance to BCL2 inhibition in AML cells. Cancer Discov. 2019, 9, 910–925. [Google Scholar] [CrossRef]
- Oyadomari, S.; Mori, M. Roles of CHOP/GADD153 in endoplasmic reticulum stress. Cell Death Differ. 2004, 11, 381–389. [Google Scholar] [CrossRef] [Green Version]
- Ashkenazi, A.; Fairbrother, W.J.; Leverson, J.D.; Souers, A.J. From basic apoptosis discoveries to advanced selective BCL-2 family inhibitors. Nat. Rev. Drug Discov. 2017, 16, 273. [Google Scholar] [CrossRef]
- Shen, J.; Zhang, Y.; Yu, H.; Shen, B.; Liang, Y.; Jin, R.; Liu, X.; Shi, L.; Cai, X. Role of DUSP1/MKP1 in tumorigenesis, tumor progression and therapy. Cancer Med. 2016, 5, 2061–2068. [Google Scholar] [CrossRef] [Green Version]
- Li, H.; Song, M.; Yang, W.; Cao, P.; Zheng, L.; Zuo, Y. A Comparative analysis of single-cell transcriptome identifies reprogramming driver factors for efficiency improvement. Mol. Ther. Nucleic Acids 2020, 19, 1053–1064. [Google Scholar] [CrossRef]
- Kong, Q.; Yang, X.; Zhang, H.; Liu, S.; Zhao, J.; Zhang, J.; Weng, X.; Jin, J.; Liu, Z. Lineage specification and pluripotency revealed by transcriptome analysis from oocyte to blastocyst in pig. FASEB J. 2020, 34, 691–705. [Google Scholar] [CrossRef] [Green Version]
- Ramos-Ibeas, P.; Sang, F.; Zhu, Q.; Tang, W.; Withey, S.; Klisch, D.; Wood, L.; Loose, M.; Surani, M.A.; Alberio, R. Pluripotency and X chromosome dynamics revealed in pig pre-gastrulating embryos by single cell analysis. Nat. Commun 2019, 10, 500. [Google Scholar] [CrossRef] [Green Version]
Types of Treated Embryos | Time Point of IL17D Addition | Groups | Evaluation Indexes | |
---|---|---|---|---|
Experiment 1 | SCNT | 1-cell stage | NC, 5, 25, 50 and 100 ng/mL | Cleavage rate, blastocyst rate |
Experiment 2 | IVF | 1-cell stage | NC, 50 ng/mL | Cleavage rate, blastocyst rate |
Experiment 3 | SCNT | 4-cell stage | NC, 50 ng/mL | Cleavage rate, blastocyst rate |
Experiment 4 | SCNT | 1-cell stage | NC, 50 ng/mL | Total cell number, number of apoptotic cells, percentage of apoptosis cells, apoptosis-related gene expression levels at blastocyst stage |
Experiment 4 | IVF | 1-cell stage | NC, 50 ng/mL | Total cell number at blastocyst stage |
Experiment 5 | SCNT | 1-cell stage | NC, 50 ng/mL | Transcriptome sequencing and qPCR validation at 4-cell stage |
Gene | Primer Sequences (5′-3′) | Product Size (bp) | Gene Accession Number |
---|---|---|---|
BCL2 | F: TCGCCCTGTGGATGACTGAGTAC | 131 | XM_021099593 |
R: AGACAGCCAGGAGAAATCAAATAGAGG | |||
BCL2L1 | F: TGAGCAGGTATTGAACGAACTCTTCC | 143 | NM_214285 |
R: CCATCCAAGTTGCGATCCGACTC | |||
TP53 | F: GCCCATCCTCACCATCATCACAC | 81 | NM_213824 |
R: GCACAAACACGCACCTCAAAGC | |||
CYCS | F: CGAGTGGTGGCTTGTCTGTTGAG | 101 | NM_001129970 |
R: GGCACTGGGCACACTTCTGAAC | |||
BAX | F: ATCGGCTGCTGGGCTGGATC | 124 | XM_003127290 |
R: ATGGTGAGCGAGGCGGTGAG | |||
BCL2L11 | F: TGCCAAGCCTTCAACCATTATCTCAG | 117 | NM_001160074 |
R: GTCTCCAATACGCCGTAACTCCTG | |||
BAD | F: CCGAGGAGGATGAAGGGACTGAG | 138 | XM_021082883 |
R: AGGAACCCTGGAACTCGTCACTC | |||
FOS | F: GGAGTCGTGAAGACCATGCC | 189 | NM_001123113 |
R: TAGCTGGTCTGTCTCCGCTTG | |||
JUN | F: AGGCGGAGAGGAAGCGTATGAG | 145 | NM_213880 |
R: CTGAGCATGTTGGCGGTGGAC | |||
MAP3K8 | F: CCAGTGAAGAGCCAGCAGTGTAC | 150 | XM_021064738 |
R: GCAAGTCCTCCACGGTTCCATATC | |||
MYC | F: TCAACGTCAGCTTCACCAACAGG | 85 | NM_001005154 |
R: AAGTTCTCCTCCTCGTCGCAGTAG | |||
GADD45B | F: TGAATTTGCTCTGTACCCAGGAACTC | 108 | XM_005654701 |
R: GTAAGCCTCCCATCTCTCTTTCAGTG | |||
GAPDH | F: TGACCCCTTCATTGACCTCC | 88 | XM_021091114 |
R: CTCCGCCTTGACTGTGCC |
Groups | No. of Repetition | No. of Cultured SCNT Embryos | No. of Cleaved Embryos (%) | No. of Blastocysts (%) |
---|---|---|---|---|
NC | 4 | 160 | 127 (79.12 ± 5.21 a) | 25 (15.48 ± 4.9 a) |
5 ng/mL IL17D | 3 | 105 | 78 (74.29 ± 2.86 a) | 18 (17.14 ± 5.71 ab) |
25 ng/mL IL17D | 3 | 107 | 76 (72.38 ± 7.19 a) | 21 (19.6 ± 2.54 ab) |
50 ng/mL IL17D | 4 | 166 | 131 (81.62 ± 6.99 a) | 46 (27.59 ± 3.09 c) |
100 ng/mL IL17D | 4 | 162 | 129 (79.47 ± 5.51 a) | 36 (22.06 ± 2.39 bc) |
Groups | No. of Repetition | No. of Cultured SCNT Embryos | No. of Cleaved Embryos (%) | No. of Blastocysts (%) |
---|---|---|---|---|
NC | 6 | 298 | 211 (69.64 ± 8.76 a) | 45 (14.97 ± 4.14 a) |
50 ng/mL IL17D | 6 | 289 | 210 (71.66 ± 8.32 a) | 67 (23.54 ± 3.34 b) |
Groups | No. of Repetition | No. of Cultured SCNT Embryos | No. of Cleaved Embryos (%) | No. of Blastocysts (%) |
---|---|---|---|---|
NC | 3 | 122 | 91 (74.57 ± 1.8 a) | 15 (12.28 ± 2.32 a) |
50 ng/mL IL17D | 3 | 117 | 88 (75.21 ± 2.96 a) | 14 (11.97 ± 1.48 a) |
Groups | No. of Repetition | No. of Cultured SCNT Embryos | No. of Cleaved Embryos (%) | No. of Blastocysts (%) |
---|---|---|---|---|
NC | 3 | 113 | 88 (77.9 ± 5.94 a) | 5 (4.41 ± 1.48 a) |
10 ng/µL | 3 | 113 | 77 (68.14 ± 0.49 a) | 8 (7.09 ± 1.58 a) |
50 ng/µL | 3 | 111 | 78 (69.61 ± 4.45 a) | 10 (8.89 ± 5.49 a) |
100 ng/µL | 3 | 112 | 82 (73.87 ± 7.8 a) | 12 (10.81 ± 2.7 b) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, X.; Zhao, H.; Lai, J.; Zhang, N.; Shi, J.; Zhou, R.; Su, Q.; Zheng, E.; Xu, Z.; Huang, S.; et al. Interleukin 17D Enhances the Developmental Competence of Cloned Pig Embryos by Inhibiting Apoptosis and Promoting Embryonic Genome Activation. Animals 2021, 11, 3062. https://doi.org/10.3390/ani11113062
Wu X, Zhao H, Lai J, Zhang N, Shi J, Zhou R, Su Q, Zheng E, Xu Z, Huang S, et al. Interleukin 17D Enhances the Developmental Competence of Cloned Pig Embryos by Inhibiting Apoptosis and Promoting Embryonic Genome Activation. Animals. 2021; 11(11):3062. https://doi.org/10.3390/ani11113062
Chicago/Turabian StyleWu, Xiao, Huaxing Zhao, Junkun Lai, Ning Zhang, Junsong Shi, Rong Zhou, Qiaoyun Su, Enqin Zheng, Zheng Xu, Sixiu Huang, and et al. 2021. "Interleukin 17D Enhances the Developmental Competence of Cloned Pig Embryos by Inhibiting Apoptosis and Promoting Embryonic Genome Activation" Animals 11, no. 11: 3062. https://doi.org/10.3390/ani11113062
APA StyleWu, X., Zhao, H., Lai, J., Zhang, N., Shi, J., Zhou, R., Su, Q., Zheng, E., Xu, Z., Huang, S., Hong, L., Gu, T., Yang, J., Yang, H., Cai, G., Wu, Z., & Li, Z. (2021). Interleukin 17D Enhances the Developmental Competence of Cloned Pig Embryos by Inhibiting Apoptosis and Promoting Embryonic Genome Activation. Animals, 11(11), 3062. https://doi.org/10.3390/ani11113062