A Preliminary Study: Antibiotic Resistance Patterns of Escherichia coli and Enterococcus Species from Wildlife Species Subjected to Supplementary Feeding on Various South African Farms
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Number
2.2. Study Area and Sample Collection
2.3. Isolation and Species Confirmation of Bacteria
2.4. Antibiotic Susceptibility Testing
2.5. Statistical Analysis
2.6. Antibiotic Resistant Gene Detection
3. Results
3.1. Overall Antibiotic Resistance
3.2. Escherichia coli Antibiotic Resistance
3.3. Enterococcus Antibiotic Resistance
3.4. Antibiotic Resistance Gene Detection
4. Discussion
4.1. Overall Antibiotic Resistance
4.2. Escherichia coli Antibiotic Resistance
4.3. Enterococcus Antibiotic Resistance
4.4. Antibiotic Resistance Genes
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
Limitations
References
- Radhouani, H.; Poeta, P.; Gonçalves, A.; Pacheco, R.; Sargo, R.; Igrejas, G. Wild birds as biological indicators of environmental pollution: Antimicrobial resistance patterns of Escherichia coli and enterococci isolated from common buzzards (Buteo buteo). J. Med. Microbiol. 2012, 61, 837–843. [Google Scholar] [CrossRef]
- Rhyan, J.C.; Spraker, T.R. Emergence of diseases from wildlife reservoirs. Vet. Pathol. 2010, 47, 34–39. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- van Doorn, H.R. Emerging infectious diseases. Medicine 2014, 42, 60–63. [Google Scholar] [CrossRef] [PubMed]
- Cunningham, A.A.; Daszak, P.; Wood, L.N. One Health, emerging infectious diseases and wildlife: Two decades of progress? Philos. Trans. R. Soc. B 2017, 372, 1–8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Selva, N.; Berezowska-Cnota, T.; Elguero-Claramunt, I. Unforeseen effects of supplementary feeding: Ungulate baiting sites as hotspots for ground-nest predation. PLoS ONE 2014, 9, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Sorensen, A.; van Beest, F.M.; Brook, R.K. Impacts of wildlife baiting and supplemental feeding on infectious disease transmission risk: A synthesis of knowledge. Prev. Vet. Med. 2014, 113, 356–363. [Google Scholar] [CrossRef]
- Bekker, J.L. A Food Safety Plan for the Game Meat Industry in South Africa. Ph.D. Thesis, Tshwane Univeristy of Technology, Pretoria, South Africa, 2011. [Google Scholar]
- Eagar, H.; Swan, G.; van Vuuren, M. A survey of antimicrobial usage in animals in South Africa with specific reference to food animals. J. S. Afr. Vet. Assoc. 2012, 83, 1–8. [Google Scholar] [CrossRef] [Green Version]
- Love, D.C.; Davis, M.F.; Bassett, A.; Gunther, A.; Nachman, K.E. Dose imprecision and resistance: Free-choice medicated feeds in industrial food animal production in the United States. Environ. Health Perspect. 2011, 119, 279–283. [Google Scholar] [CrossRef] [Green Version]
- Metzler-Zebeli, B.U.; Lawlor, P.G.; Magowan, E.; Zebeli, Q. Effect of freezing conditions on fecal bacterial composition in pigs. Animals 2016, 6, 18. [Google Scholar] [CrossRef] [Green Version]
- Vandera, E.; Tsirka, G.; Kakouri, A.; Koukkou, A.-I.; Samelis, J. Approaches for enhancing in situ detection of enterocin genes in thermized milk, and selective isolation of enterocin-producing Enterococcus faecium from Baird-Parker agar. Int. J. Food Microbiol. 2018, 281, 23–31. [Google Scholar] [CrossRef]
- Boerlin, P.; Travis, R.; Gyles, C.L.; Reid-Smith, R.; Janecko, N.; Lim, H.; Nicholson, V.; McEwen, S.A.; Friendship, R.; Archambault, M. Antimicrobial resistance and virulence genes of Escherichia coli isolates from swine in Ontario. Appl. Environ. Microbiol. 2005, 71, 6753–6761. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sunde, M.; Norstrӧm, M. The genetic background for streptomycin resistance in Escherichia coli influences the distribution of MICs. J. Antimicrob. Chemother. 2005, 56, 87–90. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wilkerson, C.; van Kirk, N.; Roberts, M.C. Antibiotic resistance and distribution of tetracycline resistance genes in Escherichia coli O157:H7 isolates from humans and bovines. Antimicrob. Agents Chemother. 2004, 48, 1066–1067. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tadesse, D.A.; Zhao, S.; Tong, E.; Ayers, S.; Singh, A.; Bartholomew, M.J.; McDermott, P.F. Antimicrobial drug resistance in Escherichia coli from humans and food animals, United States, 1950–2002. Emerg. Infect. Dis. 2012, 18, 741–749. [Google Scholar] [CrossRef] [PubMed]
- Mirzaagha, P.; Louie, M.; Read, R.R.; Sharma, R.; Yanke, L.J.; Topp, E.; McAllister, T.A. Characterization of tetracycline- and ampicillin-resistant Escherichia coli isolated from the feces of feedlot cattle over the feeding period. Can. J. Microbiol. 2009, 55, 750–761. [Google Scholar] [CrossRef] [PubMed]
- Santiago-Rodriguez, T.M.; Rivera, J.I.; Caradin, M.; Toranzos, G.A. Antibiotic resistance and virulence genes in Enterococcus isolated from tropical recreational waters. J. Water Health 2013, 11, 387–396. [Google Scholar] [CrossRef] [Green Version]
- Jia, W.; Li, G.; Wang, W. Prevalence and antimicrobial resistance of Enterococcus species: A hospital-based study in China. Int. J. Environ. Res. Public Health 2014, 11, 3424–3442. [Google Scholar] [CrossRef] [Green Version]
- Trzcinski, K.; Cooper, B.S.; Hryniewicz, W.; Dowson, C.G. Expression of resistance to tetracyclines in strains of methicillin-resistant Staphylococcus aureus. J. Antimicrob. Chemother. 2000, 45, 763–770. [Google Scholar] [CrossRef] [Green Version]
- Kristich, C.; Rice, L.B.; Arias, C.A. Enterococcal infection- treatment and antibiotic resistance. In Enterococci: From Commensals to Leading Causes of Drug Resistant Infection; Gilmore, M.S., Clewell, D.B., Ike, Y., Shankar, N., Eds.; Massachusetts Eye and Ear Infirmary: Boston, MA, USA, 2014; pp. 123–164. [Google Scholar]
- Ünal, N.; Aşkar, S.; Yildirim, M. Antibiotic resistance profile of Enterococcus faecium and Enterococcus faecalis isolated from broiler cloacal samples. Turk. J. Vet. Anim. Sci. 2017, 41, 199–203. [Google Scholar] [CrossRef]
- Kozak, G.K.; Boerlin, P.; Janecko, N.; Reid-Smith, R.J.; Jardine, C. Antimicrobial resistance in Escherichia coli isolates from swine and wild small mammals in the proximity of swine farms and in natural environments in Ontario, Canada. Appl. Environ. Microbiol. 2009, 75, 559–566. [Google Scholar] [CrossRef] [Green Version]
- Malhotra-Kumar, S.; Lammens, C.; Piessens, J.; Goossens, H. Multiplex PCR for simultaneous detection of macrolide and tetracycline resistance determinants in Streptococci. Antimicrob. Agents Chemother. 2005, 49, 4798–4800. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Depardieu, F.; Podglajen, I.; Leclercq, R.; Collatz, E.; Courvalin, P. Modes and modulations of antibiotics resistance gene expression. Clin. Microbiol. Rev. 2007, 20, 79–114. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Haapapuro, E.R.; Barnard, N.D.; Simon, M. Review- animal waste used as livestock feed: Dangers to human health. J. Prev. Med. 1997, 26, 599–602. [Google Scholar] [CrossRef] [PubMed]
- Walker, P.; Rhubart-Berg, P.; McKenzie, S.; Kelling, K.; Lawrence, R.S. Public health implications of meat production and consumption. Public Health Nutr. 2005, 8, 348–356. [Google Scholar] [CrossRef] [Green Version]
- Vittecoq, M.; Godreuil, S.; Prugnolle, F.; Durand, P.; Renaud, N.; Arnal, A.; Aberkane, S.; Gauthier-clerc, M. Antimicrobial resistance in wildlife. J. App. Ecol. 2016, 53, 519–529. [Google Scholar] [CrossRef] [Green Version]
- Skurnik, D.; Ruimy, R.; Andremont, A.; Amorin, C.; Rouquet, P.; Picard, B.; Denamur, E. Effect of human activity on antimicrobial resistance and integrons in animal faecal Escherichia coli. J. Antimicrob. Chemother. 2006, 57, 1215–1219. [Google Scholar] [CrossRef]
- Allen, H.K.; Donato, J.J. Call of the wild: Antibiotic resistance genes in natural environments. Nat. Rev. Microbiol. 2010, 10, 1–9. [Google Scholar] [CrossRef]
- Guenthler, S.; Grobbel, M.; Heidemanns, K.; Schlegel, M.; Ulrich, R.G.; Ewers, C.; Wieler, L.H. First insights into antimicrobial resistance among faecal Escherichia coli isolates from small wild animals in rural areas. Sci. Total Environ. 2010, 408, 3519–3522. [Google Scholar] [CrossRef]
- Dias, D.; Torres, R.T.; Kronvall, G.; Fonseca, C.; Mendo, S.; Caetano, T. Assessment of antibiotic resistance of Escherichia coli isolates and screening of Salmonella spp. in wild ungulates from Portugal. Res. Microbiol. 2015, 166, 584–593. [Google Scholar] [CrossRef]
- King, T.L.B.; Schmidt, S. Assessment of three indigenous South African herbivores as potential reservoirs and vectors of antibiotic-resistant Escherichia coli. Eur. J. Wildl. Res. 2017, 63, 1–8. [Google Scholar] [CrossRef]
- Fan, W.; Hamilton, T.; Webster-Sesay, S.; Nikolich, M.P.; Lindler, L.E. Multiplex real-time SYBR green I PCR assay for detection of tetracycline efflux genes of Gram-negative bacteria. Mol. Cell Probes 2007, 21, 245–256. [Google Scholar] [CrossRef] [PubMed]
- Henton, M.M.; Eagar, H.A.; Swan, G.E.; van Vuuren, M. Antibiotic management and resistance in livestock production. S. Afr. Med. J. 2011, 101, 1–7. [Google Scholar]
- Rolland, R.M.; Hausfater, G.; Marshall, B.; Levy, S.B. Antibiotic resistant bacteria in wild primates: Increased prevalence in baboons feeding on human refuse. Appl. Environ. Microbiol. 1985, 49, 791–794. [Google Scholar] [CrossRef] [Green Version]
- Costa, D.; Poeta, P.; Sáenz, Y.; Vinué, L.; Coelho, A.C.; Matos, M.; Rojo-Bezares, B.; Rodrigues, J.; Torres, C. Mechanisms of antibiotic resistance in Escherichia coli isolates recovered from wild animals. Microb. Drug Resist. 2008, 4, 71–78. [Google Scholar] [CrossRef] [PubMed]
- Lillehaug, A.; Bergsjø, B.; Schau, J.; Bruheim, T.; Vikøren, T.; Handeland, K. Campylobacter spp., Salmonella spp., verocytotoxic Escherichia coli, and antibiotic resistance in indicator organisms in wild cervids. Acta Vet. Scand. 2005, 46, 23–32. [Google Scholar] [CrossRef] [PubMed]
- Katakweba, A.A.S.; Møller, K.S.; Muumba, J.; Muhairwa, A.P.; Damborg, P.; Rosenkrantz, J.T.; Minga, U.M.; Mtambo, M.M.A.; Olsen, J.E. Antimicrobial resistance in faecal samples from buffalo, wildebeest and zebra grazing together with and without cattle in Tanzania. J. Appl. Microbiol. 2015, 118, 966–975. [Google Scholar] [CrossRef] [PubMed]
- Nowakiewicz, A.; Ziółkowska, G.; Zięba, P.; Kostruba, A. Undomesticated animals as a reserviour of multidrug-resistant Enterococcus in Eastern Poland. J. Wildl. Dis. 2014, 50, 645–650. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Liu, K.; Lai, J.; Shen, J.; Wang, Y. Prevalence and antimcirobial resistance of Enterococcus species of food animal origin from Beijing and Shandong province, China. J. Appl. Microbiol. 2012, 114, 555–563. [Google Scholar] [CrossRef]
- Daniel, D.S.; Lee, S.M.; Gan, H.M.; Dykes, G.A.; Rahman, S. Genetic diversity of Enterococcus faecalis isolated from environmental, animal and clinical sources in Malaysia. J. Infect. Public Health 2017, 10, 617–623. [Google Scholar] [CrossRef]
- Speer, B.S.; Shoemaker, N.B.; Salyers, A.A. Bacterial resistance to tetracycline: Mechanisms, transfer, and clinical significance. Clin. Microbiol. Rev. 1992, 5, 387–399. [Google Scholar] [CrossRef]
- Bekker, J.L.; Hoffman, L.C.; Jooste, P.J. Knowledge of stakeholders in the game meat industry and its effect on compliance with food safety standard. Int. J. Environ. Health Res. 2011, 21, 341–363. [Google Scholar] [CrossRef] [PubMed]
- Bryan, A.; Shapir, N.; Sadowsky, M.J. Frequency and distribution of tetracycline resistance genes in genetically diverse, nonselected, and nonclinical Escherichia coli strains isolated from diverse human and animal sources. Appl. Environ. Microbiol. 2004, 70, 2503–2507. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gonçalves, A.; Igrejas, G.; Radhouani, H.; Correia, S.; Pacheco, R.; Santos, T.; Monteiro, R.; Guerra, A.; Petrucci-Fonseca, F.; Brito, F.; et al. Antimicrobial resistance in faecal enterococci and Escherichia coli isolates recovered from Iberian wolf. Lett. Appl. Microbiol. 2013, 56, 268–274. [Google Scholar] [CrossRef] [PubMed]
- Walsh, F.; Duffy, B. The culturable soil antibiotic resistome: A community of multi-drug resistant bacteria. PLoS ONE 2013, 8, 1–11. [Google Scholar] [CrossRef] [Green Version]
- Geirgopapadakou, N.H. Antibiotic resistance in Enterobacteria. In Bacterial Resistance to Antimicrobials, 2nd ed.; CRC Press: Boca Raton, FL, USA, 2008; pp. 291–296. [Google Scholar]
- Jurado-Rabadán, S.; de la Fuente, R.; Ruiz-Santa-Quiteria, J.A.; Orden, J.A.; de Vries, L.E.; Agersø, Y. Detection and linkage to mobile genetic elements of tetracycline resistance gene tet(M) in Escherichia coli isolates from pigs. BMC Vet. Res. 2014, 10, 155. [Google Scholar] [CrossRef] [Green Version]
- Frank, T.; Gautier, V.; Talarmin, A.; Bercion, R.; Arlet, G. Characterisation of sulphonamide resistance genes and class integrin gene cassettes in Enterobacteriaceae, Central African Republic (CAR). J. Antimicrob. Chemother. 2007, 59, 742–745. [Google Scholar] [CrossRef] [Green Version]
- Wang, N.; Yang, X.; Jiao, S.; Zhang, J.; Ye, B.; Gao, S. Sulfonamide-resistant bacteria and their resistance genes in soils fertilised with manures from Jiangsu province, Southeastern China. PLoS ONE 2014, 9, 1–11. [Google Scholar]
- Briñas, L.; Zarazage, M.; Sáenz, Y.; Ruiz-larrea, F.; Torres, C. β–lactamases in ampicillin-resistant Escherichia coli isolates from foods, humans, and healthy animals. Antimicrob. Agents Chemother. 2002, 46, 3156–3163. [Google Scholar] [CrossRef] [Green Version]
- Blahna, M.T.; Zalewski, C.A.; Reuer, J.; Kahlmeter, G.; Foxman, B.; Marrs, C.F. The role of horizontal gene transfer in the spread of trimethoprim-sulfamethoxazole resistance among uropathogenic Escherichia coli in Europe and Canada. J. Antimicrob. Chemother. 2006, 57, 666–672. [Google Scholar] [CrossRef] [Green Version]
- Hoa, P.T.P.; Nonaka, L.; Viet, P.H.; Suzuki, S. Detection of the sul1, sul2, and sul3 genes in sulphonamide-resistant bacteria from wastewater and shrimp ponds of north Vietnam. Sci. Total Environ. 2008, 405, 377–384. [Google Scholar]
- Rawat, D.; Nair, D. Extended-spectrum β-lactamases in Gram negative bacteria. J. Glob. Infect. Dis. 2010, 2, 263–274. [Google Scholar] [CrossRef] [PubMed]
- Paterson, D.L.; Bonomo, R.A. Extended-spectrum β-lactamases: A clinical update. Clin. Microbiol. Rev. 2005, 18, 657–686. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huys, G.; D’Haene, K.; Collard, J.-M.; Swings, J. Prevalence and molecular characterisation of tetracycline resistance in Enterococcus isolates from food. Appl. Environ. Microbiol. 2004, 70, 1555–1562. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hayakawa, K.; Marchaim, D.; Palla, M.; Gudur, U.M.; Pulluru, H.; Bathina, P.; Alshabani, K.; Govindavarjhulla, A.; Mallad, A.; Abbadi, D.R.; et al. Epidemiology of vancomycin-resistant Enterococcus faecalis: A case-case-control study. Antimicrob. Agents Chemother. 2013, 57, 49–55. [Google Scholar] [CrossRef] [Green Version]
- Mercat, M.; Clermont, O.; Massot, M.; Ruppe, E.; de Garine-Wichatitsky, M.; Miguel, E.; Fox, H.V.; Cornelis, D.; Andremont, A.; Denamur, E.; et al. Escherichia coli population structure and antibiotic resistance at buffalo/cattle interface in southern Africa. Appl. Environ. Microbiol. 2016, 82, 1459–1467. [Google Scholar] [CrossRef] [Green Version]
- Fluit, A.C. Genetic methods for detecting bacterial resistance genes. In Bacterial Resistance to Antimicrobials, 2nd ed.; CRC Press: Boca Raton, FL, USA, 2008; pp. 185–192. [Google Scholar]
- Anderson, J.F.; Parrish, T.D.; Akhtar, M.; Zurek, L.; Hirt, H. Antibiotic resistance of Enterococci in Americian Bison (Bison bison) from a nature reserve compared to that of Enterococci in pastured cattle. Appl. Environ. Microbiol. 2008, 74, 1726–1730. [Google Scholar] [CrossRef] [Green Version]
- O’ Driscoll, T.; Crank, C.W. Vancomycin-resistant enterococcal infections: Epidemiology, clinical manifestations, and optimal management. Infect. Drug Resist. 2015, 8, 217–230. [Google Scholar]
- Kahn, C.M.; Line, S. The Merck Veterinary Manual, 10th ed.; Whitehouse Station: Hunterdon, NJ, USA, 2010. [Google Scholar]
- Miller, W.R.; Munita, J.M.; Arias, C.A. Mechanisms of antibiotic resistance in enterococci. Expert Rev. Anti Infect. Ther. 2014, 12, 1221–1236. [Google Scholar] [CrossRef]
- Périchon, B.; Courvalin, P. VanA-type vancomycin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 2009, 53, 4580–4587. [Google Scholar] [CrossRef] [Green Version]
- Guardabassi, L.; Agersø, Y. Genes homologous to glycopeptide resistance vanA are widespread in soil microbial communities. FEMS Microbiol. Lett. 2006, 259, 221–225. [Google Scholar] [CrossRef] [Green Version]
- Gilmore, K.S.; Gilmore, M.S.; Sahn, D.F. Methicillin resistance in Staphylococcus aureus. In Bacterial Resistance to Antimicrobials, 2nd ed.; CRC Press: Boca Raton, FL, USA, 2008; pp. 291–296. [Google Scholar]
Species | Farm Type | Farm Name | Number of Animal Faecal Samples | Sample Collection Method | Type of Supplementary Feed |
---|---|---|---|---|---|
Blue wildebeest | Supplementary fed | Wellington farm 2 | 5 | Ground | Game pellets, lucerne, oats and molasses |
Blue wildebeest | Supplementary fed | Limpopo farm 1 | 5 | Intestinal | Nutrient feed mix |
Blue wildebeest | Not supplementary fed | KwaZulu-Natal | 5 | Ground | - |
African buffalo | Supplementary fed | Wellington farm 1 | 5 | Ground | Lucerne, oat hay and game pellets |
African buffalo | Supplementary fed | Wellington farm 2 | 5 | Ground | Game pellets, lucerne, oats and molasses |
African buffalo | Supplementary fed | Graaff- Reinet | 4 | Ground | Hay, lucerne, game pellets |
African buffalo | Not supplementary fed | KwaZulu-Natal | 5 | Ground | - |
Impala | Supplementary fed | Limpopo farm 2 | 5 | Intestinal | Nutrient feed mix |
Impala | Supplementary fed | Limpopo farm 3 | 5 | Intestinal | Nutrient feed mix |
Impala | Not supplementary fed | KwaZulu-Natal | 5 | Ground | - |
Ingredient | Percentage (%) |
---|---|
Brewer’s grain | 13 |
Wheat | 6 |
Soya cake | 7 |
Cotton seed cake | 5 |
Maize | 16 |
Lime | 1 |
Trace mineral supplement | 1 |
Salt | <1 |
Micronutrient pack | <1 |
Molasses | 12 |
Lucerne | 4 |
Grass | 34 |
Antimicrobial Agent | Disk Content | Zone Diameter (Nearest Whole mm) | ||
---|---|---|---|---|
Resistant | Intermediately Resistant | Susceptible | ||
Escherichia coli | ||||
Ampicillin | 10 μg | ≤13 | 14–16 | ≥17 |
Ceftazidime | 30 μg | ≤17 | 18–20 | ≥21 |
Chloramphenicol | 30 μg | ≤12 | 13–17 | ≥18 |
Streptomycin | 10 μg | ≤11 | 12–14 | ≥15 |
Sulphafurazole | 10 μg | ≤12 | 13–16 | ≥17 |
Tetracycline | 300 μg | ≤11 | 12–14 | ≥15 |
Enterococcus | ||||
Erythromycin | 15 μg | ≤13 | 14–22 | ≥23 |
Penicillin | 10 U | ≤28 | - | ≥29 |
Tetracycline | 30 μg | ≤14 | 15–18 | ≥19 |
Vancomycin | 30 μg | - | - | ≥15 |
Antibiotic | Gene | Primers F: 5’-3’ Primers R: 5’-3’ | bp | Reaction Conditions | Reference | Positive Control from This Study |
---|---|---|---|---|---|---|
Tetracycline | tetA | F: GGCGGTCTTCTTCATCATGC R: CGGCAGGCAGAGCAAGTAGA | 502 | 15 min initial denaturation at 95 °C followed by 35 cycles of 20 s at 95 °C, 40 s at 66 °C, and 40 s at 72 °C; and a final extension step of 4 min at 72 °C. | Adapted from [12] | E. coli CA4c |
tetB | F: CATTAATAGGCGCATCGCTG R: TGAAGGTCATCGATAGCAGG | 930 | E. coli CA4c | |||
Sulphafurazole | sul1 | F: CGGCGTGGGCTACCTGAACG R: GCCGATCGCGTGAAGTTCCG | 433 | 15 min initial denaturation at 95 °C followed by 30 cycles of 20 s at 95 °C, 40 s at 66 °C, and 40 s at 72 °C and a final extension step of 4 min at 72 °C. | Adapted from [22] | E. coli BB3a |
sul2 | F: CGGCATCGTCAACATAACCT R: TGTGCGGATGAAGTCAGCTC | 721 | E. coli BB3a | |||
Ampicillin | blaCMY | F: GACAGCCTCTTTCTCCACA R: TGGACACGAAGGCTACGTA | 1000 | 15 min initial denaturation at 94 °C followed by 30 cycles of 1 min at 94 °C, 1min at 55 °C, and 1 min at 72 °C and a final extension step of 10 min at 72 °C. | [22] | E. coli E1B2b |
Streptomycin | aadA | F: GTGGATGGCGGCCTGAAGCC R: AATGCCCAGTCGGCAGCG | 525 | 15 min initial denaturation at 95 °C followed by 35 cycles of 1 min at 94 °C, and 1 min at 60 °C and 1 min at 72 °C and a final extension step of 7 min 72 °C. | Adapted from [12] | E. coli E1B1b |
Antibiotic | Gene | Primers F: 5’-3’ Primers R: 5’-3’ | bp | Reaction Conditions | Reference | Positive Control from This Study |
---|---|---|---|---|---|---|
Tetracycline | tetK | F: GATCAATTGTAGCTTTAGGTGAAGG R: TTTTGTTGATTTACCAGGTACCATT | 1515 | 15 min initial denaturation at 95 °C followed by 30 cycles of 95 °C for 30 s, 62 °C for 1 min and 65 °C for 1 min and a final extension step of 72 °C for 4 min. | Adapted from [23] | E. faecalis I1aM |
tetL | F: TGGTGGAATGATAGCCCATT R: CAGGAATGACAGCACGCTAA | 229 | E. faecalis I1aM | |||
tetM | F: GTGGACAAAGGTACAACGAG R: CGGTAAAGTTCGTCACACAC | 406 | E. faecalis I1aM | |||
Vancomycin | vanA | F: GGGAAAACGACAATTGC R: GTACAATGCGGCCGTTA | 732 | 15 min initial denaturation at 95 °C followed by 30 cycles of 95 °C for 30 s, 54 °C for 1 min and 72 °C for 1 min and a final extension step of 72 °C for 4 min. | Adapted from [24] | E. faecalis S1d |
vanB | F: ACGGAATGGGAAGCCGA R: TGCACCCGATTTCGTTC | 647 | E. faecalis SB4c |
Location | Animal | Phenotypic Resistance a | Genotypic Resistance | |||||
---|---|---|---|---|---|---|---|---|
blaCMY | sul1 | sul2 | tetA | tetB | aadA1 | |||
Limpopo farm 2 | Wildebeest 1 | AMP(S), SF(S), TE(I), ST(R) | - | - | - | - | - | + |
Limpopo farm 2 | Wildebeest 2 | AMP(I), SF(I), TE(I), ST(R) | + | - | - | - | - | + |
Limpopo farm 2 | Impala 1 | AMP(I), SF(I), TE(I), ST(R) | - | - | - | - | - | + |
Limpopo farm 1 | Impala 1 | AMP(R), SF(S), TE(S), ST(S) | + | - | - | - | - | - |
Limpopo farm 1 | Impala 2 | AMP(S), SF(S), TE(S), ST(S) | - | - | - | - | - | - |
Wellington farm 1 | Buffalo 1 | AMP(S), SF(S), TE(S), ST(R) | + | - | - | - | - | + |
Wellington farm 1 | Buffalo 2 | AMP(R), SF(S), TE(R), ST(R) | + | - | - | + | - | + |
Wellington farm 1 | Buffalo 3 | AMP(I), SF(I), TE(I), ST(R) | + | - | - | - | - | + |
Wellington farm 1 | Buffalo 4 | AMP(R), SF(S), TE(R), ST(R) | + | - | - | - | + | + |
Wellington farm 1 | Buffalo 5 | AMP(R), SF(R), TE(S), ST(R) | + | - | + | - | - | + |
Wellington farm 2 | Buffalo 1 | AMP(S), SF(I), TE(I), ST(R) | + | - | - | - | - | + |
Wellington farm 2 | Buffalo 2 | AMP(S), SF(S), TE(S), ST(I) | + | - | - | - | - | + |
Wellington farm 2 | Wildebeest 1 | AMP(S), SF(I), TE(I), ST(I) | - | - | - | - | - | + |
Wellington farm 2 | Wildebeest 2 | AMP(S), SF(I), TE(S), ST(R) | + | - | - | - | - | + |
KwaZulu-Natal | Impala 1 | AMP(S), SF(S), TE(S), ST(I) | + | - | - | - | - | - |
Location | Animal | Phenotypic Resistancen b | Genotypic Resistance | ||||
---|---|---|---|---|---|---|---|
tetL | tetK | tetM | vanA | vanB | |||
Limpopo farm 2 | Wildebeest 1 | TE(R), VA(S) | - | - | + | + | - |
Limpopo farm 2 | Wildebeest 2 | TE(R), VA(R) | + | - | + | + | - |
Limpopo farm 1 | Impala 1 | TE(S), VA(R) | - | - | - | + | - |
Limpopo farm 1 | Impala 2 | TE(S), VA(R) | - | - | - | + | - |
Limpopo farm 1 | Impala 3 | TE(S), VA(R) | - | - | - | + | - |
Wellington farm 1 | Buffalo 1 | TE(I), VA(R) | - | - | - | + | - |
Wellington farm 1 | Buffalo 2 | TE(I), VA(R) | - | - | - | + | - |
Wellington farm 1 | Buffalo 3 | TE(I), VA(R) | - | - | - | + | - |
Wellington farm 1 | Buffalo 4 | TE(R), VA(R) | - | - | + | + | - |
KwaZulu-Natal | Wildebeest 1 | TE(S), VA(R) | - | - | - | + | - |
KwaZulu-Natal | Buffalo 1 | TE(S), VA(S) | - | - | - | - | - |
Animal | TE | ST | SF | AMP | NA | C | CAZ | Reference |
---|---|---|---|---|---|---|---|---|
Wild birds | 75 | 75 | - | 60 | 33.3 | 41.7 | 0 | [1] |
Small wild mammals | 29 | 7 | 12 | 7 | - | 2 | - | [22] |
Rodents | 1.5 | 4 | - | 2 | 0 | 0 | 0 | [29] |
Wild ungulates | 8 | 4 | - | 10 | 0 | 0 | 0 | [30] |
Wild ungulates | - | <5 | - | - | - | - | 7–53 | [31] |
Wolf | 30 | 25 | - | 25 | 10 | 5 | 0 | [32] |
Buffalo | 0–7.7 | 3.8–17.3 | 37.5–38.5 | - | - | 1.9–5.8 | - | [33] |
Wild Cervids | 8.6 | 22.1 | 11 | - | 0 | 0 | - | [34] |
Wild animals | 34.8 | 22.3 | - | 22.3 | 14.3 | 6.3 | 0.9 | [35] |
Wild ungulates | 38.3 | 48.4 | - | - | - | - | - | [36] |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
van den Honert, M.S.; Gouws, P.A.; Hoffman, L.C. A Preliminary Study: Antibiotic Resistance Patterns of Escherichia coli and Enterococcus Species from Wildlife Species Subjected to Supplementary Feeding on Various South African Farms. Animals 2020, 10, 396. https://doi.org/10.3390/ani10030396
van den Honert MS, Gouws PA, Hoffman LC. A Preliminary Study: Antibiotic Resistance Patterns of Escherichia coli and Enterococcus Species from Wildlife Species Subjected to Supplementary Feeding on Various South African Farms. Animals. 2020; 10(3):396. https://doi.org/10.3390/ani10030396
Chicago/Turabian Stylevan den Honert, Michaela Sannettha, Pieter Andries Gouws, and Louwrens Christiaan Hoffman. 2020. "A Preliminary Study: Antibiotic Resistance Patterns of Escherichia coli and Enterococcus Species from Wildlife Species Subjected to Supplementary Feeding on Various South African Farms" Animals 10, no. 3: 396. https://doi.org/10.3390/ani10030396