Changes in Antibiotic-Resistance Genes Induced by the Grazing Effect in Three Cladoceran Species
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cladoceran Subculture and Experimental Design
2.2. Field Survey
2.3. DNA Extraction and Gene Detection
2.3.1. Bacterial Abundance
2.3.2. ARG
3. Results
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Holdren, J.P.; Lander, E. Report to the President on Combating Antibiotic Resistance; PCAST: Washington, DC, USA, 2014. [Google Scholar]
- Aminov, R.I. The role of antibiotics and antibiotic resistance in nature. Environ. Microbial. 2009, 11, 2970–2988. [Google Scholar] [CrossRef]
- Durso, L.M.; Cook, K.L. Impacts of antibiotic use in agriculture: What are the benefits and risks? Curr. Opin. Microbiol. 2014, 19, 37–44. [Google Scholar] [CrossRef]
- Berendonk, T.U.; Manaia, C.M.; Merlin, C.; Fatta-Kassinos, D.; Cytryn, E.; Walsh, F.; Bürgmann, H.; Sørum, H.; Norström, M.; Pons, M.N.; et al. Tackling antibiotic resistance: The environmental framework. Nat. Rev. Microbiol. 2015, 13, 310–317. [Google Scholar] [CrossRef]
- Lorenzo, P.; Adriana, A.; Jessica, S.; Carles, B.; Marinella, F.; Marta, L.; Luis, B.J.; Pierre, S. Antibiotic resistance in urban and hospital wastewaters and their impact on a receiving freshwater ecosystem. Chemosphere 2018, 206, 70–82. [Google Scholar] [CrossRef]
- Nnadozie, C.F.; Odume, O.N. Freshwater environments as reservoirs of antibiotic resistant bacteria and their role in the dissemination of antibiotic resistance genes. Environ. Pollut. 2019, 254, 113067. [Google Scholar] [CrossRef]
- Kemper, N. Veterinary antibiotics in the aquatic and terrestrial environment. Ecol. Indic. 2008, 8, 1–13. [Google Scholar] [CrossRef]
- Di Cesare, A.; Pasquaroli, S.; Vignaroli, C.; Paroncini, P.; Luna, G.M.; Manso, E.; Biavasco, F. The marine environment as a reservoir of enterococci carrying resistance and virulence genes strongly associated with clinical strains. Environ. Microbiol. Rep. 2014, 6, 184–190. [Google Scholar] [CrossRef]
- Nakano, D.; Strayer, D.L. Biofouling animals in fresh water: Biology, impacts, and ecosystem engineering. Front. Ecol. Environ. 2014, 12, 167–175. [Google Scholar] [CrossRef]
- Martinez, J.L. Environmental pollution by antibiotics and by antibiotic resistance determinants. Environ. Pollut. 2009, 157, 2893–2902. [Google Scholar] [CrossRef]
- Taylor, N.G.; Verner-Jeffreys, D.W.; Baker-Austin, C. Aquatic systems: Maintaining, mixing and mobilising antimicrobial resistance? Trends Ecol. Evol. 2011, 26, 278–284. [Google Scholar] [CrossRef]
- Czekalski, N.; Berthold, T.; Caucci, S.; Egli, A.; Bürgmann, H. Increased levels of multiresistant bacteria and resistance genes after wastewater treatment and their dissemination into Lake Geneva, Switzerland. Front. Microbiol. 2012, 3, 106. [Google Scholar] [CrossRef] [Green Version]
- Knapp, C.W.; Lima, L.; Olivares-Rieumont, S.; Bowen, E.; Werner, D.; Graham, D.W. Seasonal variations in antibiotic resistance gene transport in the Almendares River, Havana, Cuba. Front. Microbiol. 2012, 3, 396. [Google Scholar] [CrossRef] [Green Version]
- Graham, D.W.; Olivares-Rieumont, S.; Knapp, C.W.; Lima, L.; Werner, D.; Bowen, E. Antibiotic resistance gene abundances associated with waste discharges to the Almendares River near Havana, Cuba. Environ. Sci. Technol. 2011, 45, 418–424. [Google Scholar] [CrossRef]
- Von Wintersdorff, C.J.; Penders, J.; Van Niekerk, J.M.; Mills, N.D.; Majumder, S.; Van Alphen, L.B.; Savelkoul, P.H.; Wolffs, P.F. Dissemination of antimicrobial resistance in microbial ecosystems through horizontal gene transfer. Front. Microbiol. 2016, 7, 173. [Google Scholar] [CrossRef] [Green Version]
- Sun, D.; Jeannot, K.; Xiao, Y.; Knapp, C.W. Horizontal gene transfer mediated bacterial antibiotic resistance. Front. Microbial. 2019, 10, 1933. [Google Scholar] [CrossRef] [Green Version]
- Wang, H.; Hou, L.; Liu, Y.; Liu, K.; Zhang, L.; Huang, F.; Wang, L.; Rashid, A.; Hu, A.; Yu, C. Horizontal and vertical gene transfer drive sediment antibiotic resistome in an urban lagoon system. J. Environ. Sci. 2021, 102, 11–23. [Google Scholar] [CrossRef] [PubMed]
- Agasild, H.; Nõges, T. Cladoceran and rotifer grazing on bacteria and phytoplankton in two shallow eutrophic lakes: In situ measurement with fluorescent microspheres. J. Plankton Res. 2005, 27, 1155–1174. [Google Scholar] [CrossRef] [Green Version]
- Choi, J.Y.; Kim, S.K. Effect of the human utilization of northern snakehead (Channa argus Cantor, 1842) on the settlement of exotic fish and cladoceran community structure. Sustainability 2021, 13, 2486. [Google Scholar] [CrossRef]
- Elendt, B.P. Selenium deficiency in Crustacea. Protoplasma 1990, 154, 25–33. [Google Scholar] [CrossRef]
- Choi, J.Y.; Kim, S.K.; La, G.H.; Chang, K.H.; Kim, D.K.; Jeong, K.Y.; Park, M.S.; Joo, G.J.; Kim, H.W.; Jeong, K.S. Effects of algal food quality on sexual reproduction of Daphnia magna. Ecol. Evol. 2016, 6, 2817–2832. [Google Scholar] [CrossRef] [PubMed]
- Oh, H.J.; Krogh, P.H.; Jeong, H.G.; Joo, G.J.; Kwak, I.S.; Hwang, S.J.; Gim, J.S.; Chang, K.H.; Jo, H. Pretreatment method for DNA barcoding to analyze gut contents of rotifers. Appl. Sci. 2020, 10, 1064. [Google Scholar] [CrossRef] [Green Version]
- Haney, J.F.; Hall, D.J. Sugar-coated Daphnia: A preservation technique for Cladocera 1. Limnol. Oceanogr. 1973, 18, 331–333. [Google Scholar] [CrossRef]
- Mizuno, T.; Takahashi, E. An Illustrated Guide to Freshwater Zooplankton in Japan; Tokai University Press: Tokyo, Japan, 1999; 532p. [Google Scholar]
- Bennke, C.M.; Pollehne, F.; Müller, A.; Hansen, R.; Kreikemeyer, B.; Labrenz, M. The distribution of phytoplankton in the Baltic Sea assessed by a prokaryotic 16S rRNA gene primer system. J. Plankton Res. 2018, 40, 244–254. [Google Scholar] [CrossRef]
- Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 2010, 26, 2460–2461. [Google Scholar] [CrossRef] [Green Version]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Peña, A.G.; Goodrich, J.K.; Gordon, J.I.; et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 2010, 7, 335. [Google Scholar] [CrossRef] [Green Version]
- Di Cesare, A.; Luna, G.M.; Vignaroli, C.; Pasquaroli, S.; Tota, S.; Paroncini, P.; Biavasco, F. Aquaculture can promote the presence and spread of antibiotic-resistant enterococci in marine sediments. PLoS ONE 2013, 8, e62838. [Google Scholar]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [Green Version]
- Eckert, E.M.; Di Cesare, A.; Stenzel, B.; Fontaneto, D.; Corno, G. Daphnia as a refuge for an antibiotic resistance gene in an experimental freshwater community. Sci. Total Environ. 2016, 571, 77–81. [Google Scholar] [CrossRef] [PubMed]
- Choi, J.Y.; Kim, S.K.; Chang, K.H.; Kim, M.C.; La, G.H.; Joo, G.J.; Jeong, K.S. Population growth of the cladoceran, Daphnia magna: A quantitative analysis of the effects of different algal food. PLoS ONE 2014, 9, e95591. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Suzuki, M.T.; Taylor, L.T.; DeLong, E.F. Quantitative analysis of small-subunit rRNA genes in mixed microbial populations via 50-nuclease assays. Appl. Environ. Microbiol. 2000, 66, 4605–4614. [Google Scholar] [CrossRef] [Green Version]
- Ng, L.-K.; Martin, I.; Alfa, M.; Mulvey, M. Multiplex PCR for the detection of tetracycline resistant genes. Mol. Cell. Probes 2001, 15, 209–215. [Google Scholar] [CrossRef] [PubMed]
- Huang, W.; Chen, X.; Wang, K.; Chen, J.; Zheng, B.; Jiang, X. Comparison among the microbial communities in the lake, lake wetland, and estuary sediments of a plain river network. Microbiologyopen 2019, 8, e00644. [Google Scholar] [CrossRef]
- Zhao, Q.; Bai, J.; Gao, Y.; Zhao, H.; Zhang, G.; Cui, B. Shifts in the soil bacterial community along a salinity gradient in the Yellow River Delta. Land Degrad. Dev. 2020, 31, 2255–2267. [Google Scholar] [CrossRef]
- Eckert, E.M.; Pernthaler, J. Bacterial epibionts of Daphnia: A potential route for the transfer of dissolved organic carbon in freshwater food webs. ISME J. 2014, 8, 1808–1819. [Google Scholar] [CrossRef] [Green Version]
- Choi, J.Y.; Kim, S.K.; Jeong, K.S.; Joo, G.J. Distribution pattern of epiphytic microcrustaceans in relation to different macrophyte microhabitats in a shallow wetland (Upo wetlands, South Korea). Oceanol. Hydrobiol. Stud. 2015, 44, 151–163. [Google Scholar] [CrossRef]
- Hall-Stoodley, L.; Costerton, J.W.; Stoodley, P. Bacterial biofilms: From the natural environment to infectious diseases. Nat. Rev. Microbiol. 2004, 2, 95–108. [Google Scholar] [CrossRef]
- Chopra, I.; Roberts, M. Tetracycline antibiotics: Mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol. Mol. Biol. Rev. 2001, 65, 232–260. [Google Scholar] [CrossRef] [Green Version]
- Roberts, M. Tetracycline and MLS Nomenclature. Available online: http://faculty.washington.edu/marilynr/ (accessed on 10 June 2021).
- Shapira, M. Gut microbiotas and host evolution: Scaling up symbiosis. Trends Ecol. Evol. 2016, 31, 539–549. [Google Scholar] [CrossRef]
- Allen, H.K.; Donato, J.; Wang, H.H.; Cloud-Hansen, K.A.; Davies, J.; Handelsman, J. Call of the wild: Antibiotic resistance genes in natural environments. Nat. Rev. Microbiol. 2010, 8, 251–259. [Google Scholar] [CrossRef]
- Choi, J.Y.; Kim, S.K. A study of the distribution of Daphnia obtusa and Simocephalus vetulus in response to varying environmental conditions using field and microcosm approaches. Water 2020, 12, 815. [Google Scholar] [CrossRef] [Green Version]
- Kim, S.K.; Choi, J.Y. Differences in the vertical distribution of two cladoceran species in the Nakdong River estuary, South Korea. Water 2020, 12, 2154. [Google Scholar] [CrossRef]
Target Name | Primer Name | Primer Sequence (5′–3′) | Amplicon Size (bp) | Annealing Temperature (°C) | Reference |
---|---|---|---|---|---|
16SrDNA | Bact1369F | CGGTGAATACGTTCYCGG | 142 | 55 | Suzuki et al. [31] |
Prok1492R | GGHTACCTTGTTACGACTT | ||||
tet(A) | tet(A)F | GCTACATCCTGCTTGCCTTC | 210 | 64 | Ng et al. [32] |
tet(A)R | CATAGATCGCCGTGAAGAGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Choi, J.-Y.; Kim, S.-K. Changes in Antibiotic-Resistance Genes Induced by the Grazing Effect in Three Cladoceran Species. Microorganisms 2021, 9, 1959. https://doi.org/10.3390/microorganisms9091959
Choi J-Y, Kim S-K. Changes in Antibiotic-Resistance Genes Induced by the Grazing Effect in Three Cladoceran Species. Microorganisms. 2021; 9(9):1959. https://doi.org/10.3390/microorganisms9091959
Chicago/Turabian StyleChoi, Jong-Yun, and Seong-Ki Kim. 2021. "Changes in Antibiotic-Resistance Genes Induced by the Grazing Effect in Three Cladoceran Species" Microorganisms 9, no. 9: 1959. https://doi.org/10.3390/microorganisms9091959
APA StyleChoi, J.-Y., & Kim, S.-K. (2021). Changes in Antibiotic-Resistance Genes Induced by the Grazing Effect in Three Cladoceran Species. Microorganisms, 9(9), 1959. https://doi.org/10.3390/microorganisms9091959