Next Article in Journal
SARS-CoV-2 Spike Mutations, L452R, T478K, E484Q and P681R, in the Second Wave of COVID-19 in Maharashtra, India
Next Article in Special Issue
Resistance to Boscalid, Fluopyram and Fluxapyroxad in Blumeriella jaapii from Michigan (U.S.A.): Molecular Characterization and Assessment of Practical Resistance in Commercial Cherry Orchards
Previous Article in Journal
Genome Characterization of Nocturne116, Novel Lactococcus lactis-Infecting Phage Isolated from Moth
Previous Article in Special Issue
Fungicide Resistance Evolving in Ramularia collo-cygni Population in Estonia
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 9
Issue 7
10.3390/microorganisms9071541
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Review

Grapevine Powdery Mildew: Fungicides for Its Management and Advances in Molecular Detection of Markers Associated with Resistance

by
Andrea Kunova
*,
Cristina Pizzatti
,
Marco Saracchi
,
Matias Pasquali
and
Paolo Cortesi
Department of Food, Environmental and Nutritional Science (DeFENS), University of Milan, Via Celoria 2, 20133 Milan, Italy
*
Author to whom correspondence should be addressed.
Microorganisms 2021, 9(7), 1541; https://doi.org/10.3390/microorganisms9071541
Submission received: 4 June 2021 / Revised: 14 July 2021 / Accepted: 17 July 2021 / Published: 20 July 2021
(This article belongs to the Special Issue Fungicide Resistance in Plant Pathogens)
Versions Notes

Abstract

:
Grapevine powdery mildew is a principal fungal disease of grapevine worldwide. Even though it usually does not cause plant death directly, heavy infections can lead to extensive yield losses, and even low levels of the disease can negatively affect the quality of the wine. Therefore, intensive spraying programs are commonly applied to control the disease, which often leads to the emergence and spread of powdery mildew strains resistant to different fungicides. In this review, we describe major fungicide classes used for grapevine powdery mildew management and the most common single nucleotide mutations in target genes known to confer resistance to different classes of fungicides. We searched the current literature to review the development of novel molecular methods for quick detection and monitoring of resistance to commonly used single-site fungicides against Erysiphe necator. We analyze and compare the developed methods. From our investigation it became evident that this research topic has been strongly neglected and we hope that effective molecular methods will be developed also for resistance monitoring in biotroph pathogens.

1. Introduction

Grapevine powdery mildew is a major disease of cultivated and wild grapevine species worldwide causing substantial yield and economic losses [1]. It is caused by Erysiphe necator Schwein (previously Uncinula necator (Schwein.) Burrill; anamorph Oidium tuckeri Berk.), an obligate biotrophic fungus belonging to ascomycetes, family Erysiphaceae. The epiphytically growing mildew colonies can be observed as whitish, roughly circular spots, later assuming a typical powdery appearance due to abundant production of asexual conidia. The pathogen can infect all green tissues of the plant including leaves, shoots, flowers, and bunches, but the most economically important damage is due to flower and berry infections [1,2]. Early and severe infections can cause flower drop resulting in bunches with fewer berries, or as infected epidermal tissues of the berries stop growing, powdery mildew infection may cause berry splitting and facilitate the entrance of other grapevine pathogens. Moreover, apart from direct damage to the bunches, the infection can reduce photosynthesis and lower the sugar and anthocyanin content in the grape juice, leading to a lower content of total soluble solids and a less intense juice color and, on the other side, increase the acidity and the concentration of phenylacetic and acetic acid, which altogether causes inferior wine quality [2,3,4,5,6].
The vast majority of the cultivated grape varieties belonging to Vitis vinifera species have no genetic resistance to Erysiphe necator and result in being moderately to highly susceptible to grapevine powdery mildew [7,8,9]. Therefore, extensive fungicide programs are applied worldwide to keep the disease levels at a minimum. Fungicides are usually applied in a preventive manner, requiring multiple sprays per season, with 10–20 applications during the years favorable for epidemic development [10,11,12]. In fact, viticulture is a sector with one of the highest use of fungicides, with an average yearly application of 19.5 kg/ha of active ingredients [13]. Such extensive and repeated applications of fungicides increase the risk of resistance development in E. necator populations in different cultivation areas.
The situation is further complicated by the complex population structure of E. necator. High genetic diversity was observed in the Eastern North America, the presumed center of grapevine powdery mildew origin [14,15]. From here, it was most probably introduced in Europe and Australia, where two distinct genetic groups A and B (previously I and III) were repeatedly identified based on different molecular markers [16,17]. Some studies suggested that the group A is mostly clonal, associated with flag shoots, and can be recovered early in the growing season, while the group B is reproducing sexually, overwinters as chasmothecia and becomes dominant towards the end of the season [18,19]. Other studies, however, found high genetic variability in both genetic groups and approximately 1:1 mating-type ratios, not confirming the spatial and temporal diversification of the two groups [16,20]. However, higher sensitivity of the genetic group A was observed towards some fungicides, in particular triadimenol (DMI) and azoxystrobin (QoI), and it was hypothesized that this might be the reason for their precocious disappearance in vineyards [21,22].
In the following chapters, we briefly describe the different fungicide classes used for grapevine powdery mildew management and survey the presence of resistance to these classes. In case the molecular mechanisms of action are known, we describe the most common mutations responsible for the resistance in E. necator and other fungal plant pathogens, and finally, we discuss the advancements in the development of highly sensitive molecular methods for the detection of resistant strains and their implementation in practice.

2. Fungicides Used for Grapevine Powdery Mildew Management and Resistance in E. necator

A detailed overview of fungicides used against powdery mildews in different crop systems has been published recently [23]; here we will shortly describe those applied specifically for E. necator management. Currently, more than 20 fungicides belonging to different chemical classes are registered in the EU for powdery mildew management in vineyards (Table 1). Among them, the most numerous are fungicides targeting enzymes involved in electron transport within the mitochondrial membrane (FRAC classes 7, 11, and 29) and sterol biosynthesis (FRAC 3 and 5). Several classes, such as MBC-fungicides, SDHI, QoI, or SBI, encompass fungicides with a broad spectrum of activity used against different groups of pathogens, others such as hydroxy-(2-amino-) pyrimidines, aryl-phenyl-ketones, azanaphthalenes, and phenyl-acetamides target predominantly or are specific against powdery mildews.

2.1. Hydroxy-(2-Amino-)Pyrimidines

Hydroxypyrimidine fungicides belonging to FRAC 8 have specific activity against powdery mildews of different crops. They were introduced in the late 1960s, but nowadays, only bupirimate is registered in the EU against powdery mildews. Bupirimate is a systemic fungicide with translaminar mobility able to penetrate also woody tissues [24]. Moreover, its high vapor phase may contribute to good disease control properties [25]. Hydroxypyrimidines interfere at several stages of powdery mildew development, including germination, appressorium and haustorium formation, hyphal growth and sporulation, but the appressorium stage seems to be the most affected [26]. In particular, they act on the adenosine-deaminase enzyme involved in nucleic acid metabolism, catalyzing the deamination of adenosine. Synthesis of inosine and adenosine nucleotides is blocked by hydroxypyrimidines suggesting the inhibition of purine salvage pathway by these fungicides [24]. Shortly after their introduction in practice, resistance was observed in several powdery mildew species, including Blumeria graminis f. sp. hordei [27], and Podosphaera xanthii [28]. A gradual decrease in sensitivity of barley powdery mildew indicates a quantitative type of resistance [29]. It was hypothesized that resistance is not controlled by a single major gene but by the complex heritable system involving multiple genes with additive effect [30], however, the exact resistance mechanism is still unknown. Until now, no resistance has been described in E. necator. Due to pronounced resistance problems in powdery mildews of other principal crops such as cereals or cucurbits, this class of fungicides is nowadays of limited market importance [31].

2.2. MBC-Fungicides

Methyl benzimidazole carbamates (MBC) or benzimidazoles, classified as FRAC 1, were introduced in the late 1960s and represent an important class of fungicides. They were the first broad-spectrum systemic fungicides, also showing post-infection action, used mainly for foliar diseases or for seed dressing, and were characterized by low use rates [32,33]. Even though initially they were classified as having low toxicity to mammals and human, later negative effects on their reproduction and development were demonstrated [34,35], and in consequence, they were withdrawn from the EU agriculture, with the last active ingredient, thiophanate-methyl, having expired on 19 October 2020 [36]. The mode of action of MBC fungicides was elucidated in 1973 [37]; they inhibit microtubule assembly in diverse fungal species by binding to β-tubulin subunit and interfering with the polymerization, with subsequent disruption of the nuclear division, polarized growth, germ tube elongation, and mycelium growth. Only two years after their introduction in practice, field resistance was detected in multiple pathogens [38]. Currently, resistance to MBC was described in more than 100 fungal species, including different powdery mildew species [23,39]. A variety of single point mutations in the β-tubulin gene were described in laboratory-induced and field mutants, but the most important are E198A/G/K/Q and F200Y [39]. Interestingly, the mutations in the β-tubulin gene are not directly involved in binding with the benzimidazole fungicides but induce changes in the secondary structure of β-tubulin which prevent the binding of the fungicide [40]. Even though the MBC resistance was also detected in grapevine powdery mildew in the US [41,42], the underlying mutations were not investigated, presumably also due to lower importance of MBC fungicides in grapevine powdery mildew management.
Table
Table 1. Fungicides used in grapevine powdery mildew management, their classification based on Fungicide Resistance Action Committee (FRAC) [43] and resistance in E. necator.
Table 1. Fungicides used in grapevine powdery mildew management, their classification based on Fungicide Resistance Action Committee (FRAC) [43] and resistance in E. necator.
Mode of ActionTarget Site and CodeGroup NameFRAC CodeExample A.I. aResistance
A: Nucleic acid metabolismA2: Adenosin-deaminaseHydroxy-(2-amino-) pyrimidines8BupirimateND c
B: Cytoskeleton and motor proteinB1: β-tubulin assembly in mitosisMBC-fungicides1Thiophanate-methyl b[41,42]
B6: Actin/myosin/fimbrin functionAryl-phenyl-ketones50Metrafenone, Pyriofenone[11]
C: RespirationC2: Complex II: succinate dehydrogenaseSDHI (Succinate-dehydrogenase inhibitors)7Boscalid, Fluopyram, Fluxa-pyroxad[44,45,46]
C3: Complex III: cytochrome bc1 (ubiquinol oxidase) at Qo site (cyt b gene)QoI-fungicides (Quinone outside Inhibitors)11Azoxystrobin, Kresoxim-methyl, Pyraclostrobin, Trifloxystrobin[47,48]
C5: Uncouplers of oxidative phosphorylation29MeptyldinocapND
E: Signal transductionE1: Signal transduction (mechanism unknown)Azanaphthalenes13Proquinazid[49]
G: Sterol biosynthesis in membranesG1: C14-demethylase in sterol biosynthesis (erg11/cyp51)DMI-fungicides
SBI: Class I		3Difeconazole, Fenbuconazole, Myclobutanil, Penconazole, Tebuconazole, Tetraconazole, Triadimefon[50,51,52]
G2: Δ14-reductase and Δ8→Δ7- isomerase in sterol biosynthesis (erg24, erg2)Amines (morpholines)
SBI: Class II		5Spiroxamine[48]
U: Unknown UnknownPhenyl-acetamideU06CyflufenamidND
M: Multi-site Multi-site contact activityInorganicM02SulphurND
a active ingredient; b registration expired on 19 October 2020 in the EU [36]; c not described yet. Letter codes of Mode of Action and Target site, and numerical FRAC codes are highlighted in bold.

2.3. Aryl-Phenyl-Ketones

Aryl-phenyl ketones (FRAC 50) are new-generation fungicides used almost exclusively for powdery mildew management. Currently, this group contains two fungicides; metrafenone was approved in the EU in 2007, followed by pyriofenone in 2014 [36]. Their exact mechanism of action has not been completely elucidated, but the studies on cereal powdery mildews suggested the disruption of the actin cytoskeleton and the interference with hyphal morphogenesis, polarized hyphal growth, and cell polarity [53,54]. Again, several years after their introduction, resistance was observed, first in B. graminis f. sp. tritici [55], followed by E. necator [11] and P. xanthii [56]. Interestingly, in grapevine powdery mildew, moderately- and highly-resistant isolates were observed; while both grew and sporulated at field dose of metrafenone, highly resistant strains were able to grow and sporulate similarly to control also at the concentration 1250 mg/L (10-times higher than the recommended field application) [11]. Resistant strains are nowadays distributed in different European countries at fluctuating frequencies and are not homogeneously distributed [45].

2.4. Succinate-Dehydrogenase Inhibitors

SDHI, or complex II inhibitors of mitochondrial respiration, belong to FRAC group 7. The first SDHI fungicides were discovered in the 1960s, however, they controlled only a narrow spectrum of plant pathogens [57]. In the 2000s, the second-generation, broad-spectrum SDHI were introduced, able to control a wide range of diseases. SDHI inhibit succinate dehydrogenase, an enzyme on the interface between the tricarboxylic acid cycle (TCA) and the mitochondrial respiratory chain, which couples the oxidation of succinate to fumarate in TCA with the reduction of ubiquinone to ubiquinol in the electron transfer chain. SDH is a complex, four-subunit enzyme and SDHI target the ubiquinone-binding pocket located at the interface between SdhB, SdhC, and SdhD subunits [44,58]. Various mutations in the three subunits involved in the formation of the ubiquinone-binding pocket have been described to be responsible for resistance to SDHI in different pathogens. In E. necator, a single isolate from a single vineyard in Italy with decreased sensitivity to fluxapyroxad was described during the European monitoring study in 2014 [45,59], a year later extensive resistance in French populations of grapevine powdery mildew to boscalid was described [44]. SDHI resistance was detected sporadically in different European countries, and in 2020, the monitoring detected only single sites in Hungary, France, and Germany [59]. In E. necator, two mutations in the SdhB subunit were identified: H242R/Y and I244V, and one in SdhC, G169D/S [44,45,59]. Of these, the substitutions in the SdhB subunit are homologous to known mutations from other plant pathogens, while SdhC-G169D/S substitution was described until now only in E. necator [45]. Interestingly, these mutations have a different impact on resistance to different SDHI fungicides. While H242R mutation confers resistance to boscalid (resistance factor RF > 100), it has no or little impact on the effectiveness of fluopyram and fluxapyroxad [44,45,46]. Instead, isolates carrying G169S mutation showed cross-resistance to both fluopyram and fluxapyroxad with RF > 10 [46].

2.5. Quinone Outside Inhibitors (Strobilurins)

Strobilurins, or quinone outside inhibitors (QoI, FRAC 11), represented a revolution in fungicide discovery and marketing, and they are still among the best-selling fungicides. They are derived from natural products, namely strobilurin A and oudemansin A produced by some basidiomycetes, which were further optimized to overcome the photo-liability and toxicity to mammals [60,61]. Azoxystrobin and kresoxim-methyl were put on the market in 1996, and currently, 18 QoI fungicides are registered for use in agriculture [43]. Their molecular mode of action has been studied in detail; they act within the inner mitochondrial membrane, in particular on complex III by binding to the quinol oxidation site (Qo) of cytochrome b [62]. This results in the disruption of electron transfer between cytochrome b and cytochrome c1, and in consequence, halts the ATP synthesis. Therefore, strobilurins are very effective in inhibiting energy-requiring processes of the pathogen development, in particular spore germination or zoospore mobility of a variety of plant pathogens [63]. Differences in sensitivity of E. necator to different strobilurin fungicides was observed, with the highest specific activity of pyraclostrobin (ED50 = 0.0044 mg/L), followed by azoxystrobin (ED50 = 0.013 mg/L), trifloxystrobin (ED50 = 0.015 mg/L), and relatively low activity of kresoxim-methyl [64]. Additionally, for QoI, resistance evolved very quickly in E. necator [47]. Among the three mutations known to confer QoI-resistance in different pathogens (F129L, G137R, and G143A), only the most common G143A was described in E. necator, and also in this case it is responsible for a high level of resistance with an RF > 1000 [65,66]. Nowadays, QoI-resistance is widespread in different parts of the world, including the US [66], Europe [67], or Australia [68,69]. Moreover, it seems that the G143A mutation does not confer a significant fitness penalty in E. necator, as resistance was described to persist for several years even in the absence of fungicide applications [65].

2.6. Uncouplers of Oxidative Phosphorylation

Uncouplers of oxidative phosphorylation are yet another class of fungicides targeting the complex pathway of mitochondrial respiration, classified as FRAC 29. In particular, this group of compounds increases the permeability of the membrane to small molecules and thus disrupts the proton gradient across the inner mitochondrial membrane necessary for the synthesis of ATP [60]. Dinocap, registered in the 1950s, was an important fungicide for powdery mildew management, discontinued due to its high eco-toxicity to non-target organisms and teratogenicity. Currently, meptyldinocap is the only fungicide in this class registered for powdery mildew management. It is the most potent isomer of dinocap, showing a much more favorable toxicological profile [70]. It was registered in 2007 and has both preventive and post-infectional activity inhibiting spore germination and mycelium growth and sporulation [70]. Despite the long use of this class, no resistance in E. necator and other powdery mildews has been described up until now, probably due to its nonspecific activity on the membrane permeability, and therefore, it remains a key fungicide in resistance management [71].

2.7. Azanaphthalenes

Azanaphthalenes, similarly to aryl-phenyl ketones, are a novel group of fungicides with specific activity against powdery mildews. They are classified as FRAC 13 group and currently only proquinazid, approved in 2010, is registered for use in agriculture. The registration of the other compound belonging to this class, quinoxyfen, was not renewed due to its high bioaccumulation and long persistence and was definitely withdrawn in March 2020 [36]. Proquinazid has strictly protectant activity with locally systemic and vapor phase redistribution and inhibits early stages of powdery mildew development such as spore germination and appressorium formation [72]. The exact mode of action of azanaphthalenes is not known, but the studies from barley powdery mildew suggest that they interfere with the appressorium development and perception of host-derived signals required for correct differentiation of the germinating spore [73,74]. Moreover, proquinazid induced the expression of Arabidopsis thaliana genes associated with resistance responses such as ethylene-mediated response pathway, phytoalexin biosynthesis, ROS generation, and induction of pathogenesis-related genes [49]. Gene-expression analysis of several genes involved in signal transduction evidenced differences in the mode of action between quinoxyfen and proquinazid, which indicates that, even though both interfere with signal transduction, their molecular targets might be different [23,74]. Erysiphe necator isolates collected in Europe, South Africa [75], and the US [76,77], with lower sensitivity to quinoxyfen were described, and a strong correlation (r = 0.874) between the sensitivity to proquinazid and quinoxyfen was observed [49]. The presence of such strains in vineyards does not seem to give problems in disease management, presumably due to a fitness penalty, as also observed in B. graminis f. sp. hordei [77,78].

2.8. Demethylation Inhibitors

Sterol biosynthesis inhibitors acting on the cytochrome P450 C14α-demethylase (CYP51) in the ergosterol biosynthetic pathway, classified as FRAC 3, are one of the most successful synthetic fungicide groups. The first DMI fungicides were registered in the 1970s, and currently there are seven compounds used in viticulture [43]. They are characterized by a broad spectrum of activity and are registered for use on diverse vegetables, crops, and fruit plants [61]. They usually do not affect conidia germination, but very efficiently inhibit the fungal growth by affecting the membrane integrity and functionality [4]. Their molecular mechanism of action has been studied in detail; DMIs bind to the heme iron of CYP51 with a nitrogen atom and inhibit the O2 binding and its transfer to lanosterol C14-methyl group, which is the main step in the lanosterol C14-demethylation process [79]. Despite their site-specific mode of action, the resistance to DMI has a quantitative character and is probably under polygenic control, and therefore, they still retain most of their activity [79]. Due to their extensive and repeated use, a shift in sensitivity to different DMI fungicides was observed in diverse countries, including the US and Chile [51,80], Europe and India [81], South Africa [52], and Australia [69]. Several mechanisms of resistance to DMI were described, such as single-point mutations in the CYP51 gene, overexpression and/or copy-number variation of CYP51, and overexpression of efflux pumps [79]. A single-point mutation A495T leading to the amino acid substitution Y136F in the CYP51 gene of E. necator was among the first described in 1997 and was characterized by the RF > 5 [80,81]. Additional non-synonymous mutations in the target gene have been described in other fungal pathogens, but only Y136F was detected in E. necator until now [82]. Moreover, a mutation A1119C leading to synonymous substitution in the CYP51 sequence was associated with its overexpression and the azole resistance in E. necator [80]. This mutation does not change the amino acid sequence, and it was speculated that it could affect the mRNA stability, or it could be an unrelated marker in linkage disequilibrium with an unknown mutation, possibly in the promoter region, responsible for the overexpression. Interestingly, also a copy-number variation of CYP51 together with the Y136F mutation was associated with fungicide resistance [4]. The authors hypothesized that an increase in copy number becomes advantageous when the CYP51 gene is present in its fungicide-tolerant allelic form and can be adaptive in the development of resistance to DMI fungicides in E. necator. On the contrary, the overexpression of efflux pumps such as ATP-binding cassette (ABC) or major facilitator superfamily (MFS) transporters, known from other pathogens, has not been described in E. necator [79].
Apart from the detoxification mechanism due to the overexpression of ABC and MFS transporters and associated with multi-fungicide resistance [83,84], resistance to DMI is correlated with different mechanisms in a single target gene, CYP51, which makes the hypothesis of polygenic resistance quite controversial [85,86]. It was hypothesized, that apart from the major resistance gene, several additional genetic components might exist which, however, confer increased resistance to DMI only if the single major gene for resistance is already present, and their presence alone would not result in increased fungicide resistance [85]. Therefore, in-depth studies filling this knowledge gap are needed.

2.9. Amines (Morpholines)

Amines, or morpholines, belong to class II of sterol biosynthesis inhibitors (FRAC 5), their main target is Δ14 reductase, but they inhibit also squalene epoxidase, epoxysqualene cyclase, and sterol Δ8–Δ7 isomerase [87]. Currently, the only fungicide registered against grapevine powdery mildew is spiroxamine. Spiroxamine was registered in 1999 and is used especially on cereals and grapes. It has a protective, curative, and eradicative activity against powdery mildews and some rusts and spot fungi of cereals [87]. Morpholine fungicides show cross-resistance to their own members, but no cross-resistance to DMI or other fungicide classes has been observed [48]. Similarly to DMI, the resistance to amines is presumed to be multigenic and of quantitative type. The shift in sensitivity to triadimefon was observed in the Californian populations of E. necator [48], but regular monitoring in Europe reported a stable situation in the European countries with low resistance factors towards amines and only with small regional fluctuations close to the baseline [88]. The molecular basis of the reduced sensitivity in E. necator and other pathogens to amines has not yet been elucidated.

2.10. Cyflufenamid

Cyflufenamid, a more recent benzamidoxime fungicide registered in Japan in 2002 and the EU in 2005, has an excellent preventive and curative activity against powdery mildews in cereals and specialty crops, as well as brown rot on stone fruits [72,89]. Its exact mode of action is still unknown, and therefore it remains classified as a class FRAC U06 [43]. It is redistributed also in the vapor phase and has a good translaminar activity [72]. Early studies on B. graminis f. sp. tritici established that cyflufenamid does not inhibit the spore germination and appressorium formation, but strongly inhibits haustorium formation and further development of the fungus [90]. Also in the case of cyflufenamid, resistance developed only a few years after its introduction in practice, it was described in cucurbit powdery mildew in 2006 in Japan [91], followed by signalizations from Italy [92] and the US [93]. However, until now, no resistance was observed in grapevine powdery mildew.
To summarize, out of eleven FRAC classes currently employed for grapevine powdery mildew management, resistance in E. necator has been detected against fungicides belonging to seven classes (Table 1 and Table 2). However, also for bupirimate (FRAC 8) and cyflufenamid (FRAC U06), resistance has been observed in other powdery mildews such as B. graminis or P. fusca, and it is therefore possible that resistant E. necator will be identified shortly. Sulphur (FRAC M02) and meptyldinocap (FRAC 29), characterized by a non-specific and/or multi-site mode of action, remain the only fungicides where resistance has not been observed despite their prolonged and repeated use, and remain essential for resistance management strategies.

3. Molecular Detection Methods of Fungicide Resistance in Erysiphe necator

Resistance monitoring in grapevine powdery mildew remains challenging due to the fact that it is an obligate biotrophic pathogen. Currently, the most commonly used method for monitoring sensitivity to fungicides in E. necator and to detect resistance is the detached leaf or leaf-disk assay [71,94]. However, the use of these bioassays has several well-known drawbacks connected to working with obligate pathogens, such as constant availability of susceptible host plants, purification and difficult maintenance of individual strains of the pathogen, presence of sporulating colonies of the pathogen, etc. Detection and monitoring of resistance by conventional methods in most cases requires the isolation and purification of single-conidial isolates and evaluation of their response to one or several increasing concentrations of the fungicide, which is very laborious and time-consuming [95].
Therefore, the development of innovative and highly sensitive molecular methods is desirable for improved resistance management. They are, in general, faster, more sensitive, and more accurate, and often can be applied on a population scale and not only to single individuals. The detection of resistant individuals at low rates, before the resistance can be detected by traditional methods or before the failure of the fungicide treatments in the vineyard, could help in applying appropriate anti-resistance strategies and prolong the efficacy of the available fungicides.
However, the development and implementation of molecular methods requires knowledge of the genetic bases of fungicide resistance mechanisms in the fungal pathogen. Moreover, molecular monitoring can be more easily developed if only one or a few single-nucleotide mutations are associated with resistance; it becomes more challenging if multiple mutations in the target gene are known, or if different mechanisms contribute to resistance, e.g., SHDI or DMI. It is also important to stress that, on the contrary to bioassays which directly detect the resistant phenotype, i.e., the response of the pathogen to the applied fungicide in terms of conidia germination, growth, or sporulation, molecular methods detect the genetic markers—most often single-nucleotide polymorphisms (SNPs)—associated with resistance.
Despite resistance problems to many compounds, in-depth studies of the molecular mechanisms at the basis of resistance are often neglected, especially in obligate biotrophs such as E. necator. This in turn hinders the development of fast, accurate, and sensitive methods for resistance detection essential for supporting correct implementation of anti-resistance strategies. Indeed, mutations associated with resistance to fungicides in grapevine powdery mildew have been identified and studied in more detail only for SDHI, QoI, and DMI fungicides. Sequencing of target genes was performed to confirm known/discover new mutations [44,45,80,96,97]. Indeed, this approach led to the identification of the novel G169D/S mutation in the SdhC subunit of E. necator [45] and the synonymous mutation A1119C in the CYP51 gene [80]. Until now, no specific assays for rapid detection of mutations in the SDH subunits have been developed. It would be important to understand the distribution, frequency, and overall importance of the novel mutation in SdhC in comparison with the mutations in the SdhB subunit.
qPCR-based methods have been developed in E. necator only for the most common Y136F mutation for the detection and monitoring of DMI resistance and G143A for the monitoring of strobilurin resistance (Table 3). In both cases, two different approaches were employed–allele-specific/amplification-refractory mutation system (ARMS) using wild-type (WT) and mutation (MUT) specific primers [81,96], or TaqMAN qPCR/ddPCR (digital droplet PCR) assays exploiting WT- and MUT- specific probes [65,97]. ARMS-qPCR utilize generally the cheaper SYBR Green technology, but two sets of PCRs are needed to assess the presence/absence of specific signals. Moreover, often, lower specificity is observed with non-specific detection of the fluorescence at high cycle levels, which might result in false-positive detection. On the other side, TaqMAN technology, even though considered more expensive, can detect both WT and MUT alleles in a single PCR, and is characterized with higher specificity.
Miles and coworkers [97] compared the specificity and ARMS-SYBR Green method developed by Baudoin et al. [96] with the TaqMAN qPCR and ddPCR for the detection of the G143A mutation in the cytochrome b gene of E. necator. They demonstrated higher specificity of the TaqMAN assay with the limit of detection (LOD) 0.05 ng/mL compared to the ARMS-SYBR Green assay. However, the qPCR assay was able to detect the WT or MUT allele in mixed samples only when the allele concentration in the mixed sample reached 10%, while ddPCR assay was able to detect either allele if it was present in 1% of the sample [97].
Different qPCR assays were developed also for the marker A495T in the CYP51 gene coding for Y136F mutation associated with DMI resistance, exploiting both SYBR Green [98,99] and TaqMAN technology [65,100]. Employing the SYBR Green technology, LOQ (limit of quantification) of the mutant allele in the mixture was 2.85% [98], and for the TaqMAN assay the authors did not provide the data on the assay development such as the sensitivity and specificity of the assay.
As mentioned before, different molecular mechanisms are responsible for DMI resistance and, apart from assays for the detection of A495T marker, development of quantitative methods to detect CYP51 overexpression and copy number would be needed. The combination of such methods would contribute to elucidating the impact of each mechanism on field resistance development and maintenance.
Table
Table 3. Molecular methods developed for the detection of the SNP markers of the fungicide resistance in Erysiphe necator.
Table 3. Molecular methods developed for the detection of the SNP markers of the fungicide resistance in Erysiphe necator.
Target GeneMutationMolecular MethodPrimer DescriptionPrimer Sequence (5′->3′)Ref
Succinate dehydrogenaseSdhB-H242R/Y,I244VPCR-sequencingForwardAGACGAAGCTGTAGAGAGGGT[44]
ReverseGCTGGAGAAAAACGCCTTTCAA
SdhC-G169D/SPyrosequencingForwardBiotin-ACATGGGAAAGGCTTTTACAAAT[45]
ReverseACCAAAGCTACCAAAGCTAATGC
Sequencing primerATCCAACTACCATCCAG
Cytochrome bG143AARMS a-qPCRForward-WT bTACGGGCAGATGAGCCTATGCGG[65,96]
Forward-Mut cTACGGGCAGATGAGCCTATGCGC
ReverseACCTACTTAAAGCTTTAGAAGTTTCC
TaqMAN-qPCRForwardCGCTACAGACTGGGTCACTG[97]
ReverseAGTCTCTTAGGGCCCCCATT
Probe-WTAGCCTATGGGGTGCAACCGT
Probe-MutAGCCTATGGGCTGCAACCGT
C14-demethylaseY136FPCR-SequencingForwardTCATCTCTTTTCCCAGCCTATC[101]
Reverse-MutGTATTGAGGCGGGTAAATCG
Allele-specific PCRForwardATGTACATTGCTGACATTTTGTCGG[81]
Reverse-MutAATTTGGACAATCAA
Allele-specific qPCRForwardTGGGAAGTTAAAAGATGTCAACG[98]
Reverse-MutTGAGTTTGGAATTTGGACAATCAA
Allele-specific qPCRForwardCGCCGAAGAGATTTACACTA[99]
Reverse-MutTGAGTTTGGAATTTGGACAATCAA
TaqMAN-qPCRForwardACTAATTTAACAACTCCGGTCTTTGGA[65,100]
ReverseACTCGACCATTTACGGACCTTTTT
Probe-WTVIC-TTGGACAATCAAATACAAC
Probe-MutFAM-TTTGGACAATCATATACAAC-3
A1119CPCR-SequencingForwardTTCTGATGGCTGGACAACAC[80]
ReverseAACCCTAACACCTGCCATAAA
Different methods used for the detection of single nucleotide mutations in the target genes and primers used are described. a Amplification Refractory Mutation System, b Wild type, c Mutant (resistant).

4. Conclusions

The resistance of grapevine powdery mildew to different fungicide classes is an extensive problem common to all grapevine growing regions, but the development of novel sensitive techniques that could be routinely used for early detection of resistant isolates and improve resistance management is still slow. This is further aggravated by the fact that E. necator is an obligate biotroph, which makes the research even more challenging. In this review, we summarized the recent advances in the development of molecular methods for the detection of resistance in E. necator, and from our investigation it is clear that this research topic has been strongly neglected. We hope that this review will contribute to making the investigation of resistance mechanisms in biotroph pathogens such as E. necator more attractive.

Author Contributions

Conceptualization, A.K. and P.C.; investigation, A.K. and C.P.; resources, A.K., C.P., M.P. and M.S.; data curation, A.K.; writing—original draft preparation, A.K., C.P., M.P. and M.S.; writing—review and editing, A.K., C.P., M.P., M.S. and P.C.; visualization, A.K., C.P. and M.P.; supervision, P.C.; project administration, A.K. and P.C.; funding acquisition, A.K. and P.C. All authors have read and agreed to the published version of the manuscript.

Funding

The article processing charge (APC) was supported by the University of Milan—Linea 2 project ELUCIDATE.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Gadoury, D.M.; Cadle-Davidson, L.; Wilcox, W.F.; Dry, I.B.; Seem, R.C.; Milgroom, M.G. Grapevine powdery mildew (Erysiphe necator): A fascinating system for the study of the biology, ecology and epidemiology of an obligate biotroph. Mol. Plant Pathol. 2012, 13, 1–16. [Google Scholar] [CrossRef] [PubMed]
  2. Calonnec, A.; Cartolaro, P.; Poupot, C.; Dubourdieu, D.; Darriet, P. Effects of Uncinula necator on the yield and quality of grapes (Vitis vinifera) and wine. Plant Pathol. 2004, 53, 434–445. [Google Scholar] [CrossRef]
  3. Gadoury, D.M.; Seem, R.C.; Ficke, A.; Wilcox, W.F. The epidemiology of powdery mildew on concord grapes. Phytopathology 2001, 91, 948–955. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Jones, L.; Riaz, S.; Morales-Cruz, A.; Amrine, K.C.; McGuire, B.; Gubler, W.D.; Walker, M.A.; Cantu, D. Adaptive genomic structural variation in the grape powdery mildew pathogen, Erysiphe necator. BMC Genom. 2014, 15, 1081. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Rantsiou, K.; Giacosa, S.; Pugliese, M.; Englezos, V.; Ferrocino, I.; Río Segade, S.; Monchiero, M.; Gribaudo, I.; Gambino, G.; Gullino, M.L.; et al. Impact of chemical and alternative fungicides applied to grapevine cv Nebbiolo on microbial ecology and chemical-physical grape characteristics at harvest. Front. Plant Sci. 2020, 11, 700. [Google Scholar] [CrossRef]
  6. Stummer, B.E.; Francis, I.L.; Markides, A.J.; Scott, E.S. The effect of powdery mildew infection of grape berries on juice and wine composition and on sensory properties of Chardonnay wines. Aust. J. Grape Wine Res. 2003, 9, 28–39. [Google Scholar] [CrossRef]
  7. Gaforio, L.; García-Muñoz, S.; Cabello, F.; Muñoz-Organero, G. Evaluation of susceptibility to powdery mildew (Erysiphe necator) in Vitis vinifera varieties. Vitis 2011, 50, 123–126. [Google Scholar] [CrossRef]
  8. Staudt, G. Evaluation of resistance to grapevine powdery mildew (Uncinula necator [Schw.] Burr., anamorph Oidium tuckeri Berk.) in accessions of Vitis species. Vitis 1997, 36, 151–154. [Google Scholar] [CrossRef]
  9. Dry, I.B.; Feechan, A.; Anderson, C.; Jermakow, A.M.; Bouquet, A.; Adam-Blondon, A.-F.; Thomas, M.R. Molecular strategies to enhance the genetic resistance of grapevines to powdery mildew. Aust. J. Grape Wine Res. 2010, 16, 94–105. [Google Scholar] [CrossRef]
  10. Caffi, T.; Rossi, V.; Legler, S.E.; Bugiani, R. A mechanistic model simulating ascosporic infections by Erysiphe necator, the powdery mildew fungus of grapevine. Plant Pathol. 2011, 60, 522–531. [Google Scholar] [CrossRef]
  11. Kunova, A.; Pizzatti, C.; Bonaldi, M.; Cortesi, P. Metrafenone resistance in a population of Erysiphe necator in northern Italy. Pest Manag. Sci. 2016, 2, 398–404. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Pertot, I.; Caffi, T.; Rossi, V.; Mugnai, L.; Hoffmann, C.; Grando, M.S.; Gary, C.; Lafond, D.; Duso, C.; Thiery, D.; et al. A critical review of plant protection tools for reducing pesticide use on grapevine and new perspectives for the implementation of IPM in viticulture. Crop Prot. 2017, 97, 70–84. [Google Scholar] [CrossRef]
  13. Gianessi, L.; Williams, A. Fungicides have protected European wine grapes for 150 years. Int. Pestic. Benefits Case Study 2011, 19. [Google Scholar]
  14. Brewer, M.T.; Milgroom, M.G. Phylogeography and population structure of the grape powdery mildew fungus, Erysiphe necator, from diverse Vitis species. BMC Evol. Biol. 2010, 10, 268. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Frenkel, O.; Portillo, I.; Brewer, M.T.; Péros, J.P.; Cadle-Davidson, L.; Milgroom, M.G. Development of microsatellite markers from the transcriptome of Erysiphe necator for analysing population structure in North America and Europe. Plant Pathol. 2012, 61, 106–119. [Google Scholar] [CrossRef]
  16. Cortesi, P.; Mazzoleni, A.; Pizzatti, C.; Milgroom, M.G. Genetic similarity of flag shoot and ascospore subpopulations of Erysiphe necator in Italy. Appl. Environ. Microbiol. 2005, 71, 7788–7791. [Google Scholar] [CrossRef] [Green Version]
  17. Delye, C.; Ronchi, V.; Laigret, F.; Corio-Costet, M.-F. Nested allele-specific PCR primers distinguish genetic groups of Uncinula necator. Appl. Environ. Microbiol. 1999, 65, 3950–3954. [Google Scholar] [CrossRef] [Green Version]
  18. Délye, C.; Laigret, F.; Corio-Costet, M.-F. RAPD analysis provides insight into the biology and epidemiology of Uncinula necator. Phytopathology 1997, 87, 670–677. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  19. Délye, C.; Corio-Costet, M.F. Origin of primary infections of grape by Uncinula necator: RAPD analysis discriminates two biotypes. Mycol. Res. 1998, 102, 283–288. [Google Scholar] [CrossRef]
  20. Miazzi, M.; Hajjeh, H.; Faretra, F. Observations on the population biology of the grape powdery mildew fungus Uncinula necator. J. Plant Pathol. 2003, 85, 123–129. [Google Scholar] [CrossRef]
  21. Miazzi, M.; Hajjeh, H.R. Differential sensitivity to triadimenol of Erysiphe necator isolates belonging to different genetic groups. J. Plant Pathol. 2011, 93, 729–735. [Google Scholar]
  22. Ramadan Hajjeh, H. Observation on baseline sensitivity of Erysiphe necator genetic groups to azoxystrobin. Am. J. Plant Sci. 2012, 3, 1640–1645. [Google Scholar] [CrossRef] [Green Version]
  23. Vielba-Fernández, A.; Polonio, Á.; Ruiz-Jiménez, L.; de Vicente, A.; Pérez-García, A.; Fernández-Ortuño, D. Fungicide resistance in powdery mildew fungi. Microorganisms 2020, 8, 1431. [Google Scholar] [CrossRef] [PubMed]
  24. Hollomon, D.W. Target sites of hydroxypyrimidine fungicides. In Target Sites of Fungicide Action; Köller, W., Ed.; CRC Press: Boca Raton, FL, USA, 2018; pp. 31–41. [Google Scholar]
  25. Buchenauer, H. Physiological reactions in the inhibition of plant pathogenic fungi. In Controlled Release, Biochemical Effects of Pesticides, Inhibition of Plant Pathogenic Fungi; Haug, G., Hoffmann, H., Eds.; Springer: Berlin/Heidelberg, Germany, 1990; pp. 217–292. [Google Scholar]
  26. Hollomon, D.W. Fungicides, 2-Aminopyrimidines. In Encyclopedia of Agrochemicals; Plimmer, J.R., Gammon, D.W., Ragsdale, N.A., Eds.; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2003; ISBN 9780471263630. [Google Scholar]
  27. Hollomon, D.W. Behaviour of a barley powdery mildew strain tolerant to ethirimol. Proc. Br. Insectic. Fungic. Conf. 1975, 1, 51–58. [Google Scholar]
  28. Bent, K.J.; Cole, A.M.; Turner, J.A.Q.; Woolner, M. Resistance of cucumber powdery mildew to dimethirimol. Proc. 6th Br. Insectic. Fungic. Conf. 1971, 1, 274–282. [Google Scholar]
  29. Brent, K.J.; Hollomon, D.W. Fungicide Resistance in Crop Pathogens: How Can It Be Managed? Fungicide Resistance Action Committee (Croplife International): Brussels, Belgium, 2007. [Google Scholar]
  30. Hollomon, D.W. Genetic control of ethirimol resistance in a natural population of Erysiphe graminis f. sp. hordei. Phytopathology 1981, 71, 536. [Google Scholar] [CrossRef]
  31. Hermann, D.; Stenzel, K. FRAC Mode-of-action classification and resistance risk of fungicides. In Modern Crop Protection Compounds; Jeschke, P., Witschel, M., Krämer, W., Schirmer, U., Eds.; Wiley-VCH Verlag GmbH & Co. KGaA: Weinheim, Germany, 2019; pp. 589–608. [Google Scholar]
  32. Morton, V.; Staub, T. A short history of fungicides. Online. APSnet Feature Artic. 2008. [Google Scholar] [CrossRef]
  33. Klittich, C.J. Milestones in fungicide discovery: Chemistry that changed agriculture. Plant Health Prog. 2008. [Google Scholar] [CrossRef] [Green Version]
  34. Morinaga, H.; Yanase, T.; Nomura, M.; Okabe, T.; Goto, K.; Harada, N.; Nawata, H. A benzimidazole fungicide, benomyl, and its metabolite, carbendazim, induce aromatase activity in a human ovarian granulose-like tumor cell line (KGN). Endocrinology 2004, 145, 1860–1869. [Google Scholar] [CrossRef] [Green Version]
  35. Ilyushina, N.A. Cytogenetic effects of carbendazim on mouse bone marrow cells. Russ. J. Genet. 2020, 56, 1193–1202. [Google Scholar] [CrossRef]
  36. EU Pesticides Database | Food Safety. Available online: https://ec.europa.eu/food/plant/pesticides/eu-pesticides-db_en (accessed on 25 March 2021).
  37. Davidse, L.C. Antimitotic activity of methyl benzimidazol-2-yl carbamate (MBC) in Aspergillus nidulans. Pestic. Biochem. Physiol. 1973, 3, 317–325. [Google Scholar] [CrossRef]
  38. Lucas, J.A.; Hawkins, N.J.; Fraaije, B.A. The evolution of fungicide resistance. Adv. Appl. Microbiol. 2015, 90, 30–92. [Google Scholar]
  39. Ishii, H.; Hollomon, D.W. Fungicide Resistance in Plant Pathogens; Ishii, H., Hollomon, D.W., Eds.; Springer: Tokyo, Japan, 2015; ISBN 978-4-431-55641-1. [Google Scholar]
  40. Vela-Corcía, D.; Romero, D.; De Vicente, A.; Pérez-García, A. Analysis of β-tubulin-carbendazim interaction reveals that binding site for MBC fungicides does not include residues involved in fungicide resistance. Sci. Rep. 2018, 8, 1–12. [Google Scholar] [CrossRef] [Green Version]
  41. Pearson, R.C.; Taschenberg, E.F. Benomyl-resistant strains of Uncinula necator on grapes. Plant Dis. 1980, 64, 677–680. [Google Scholar] [CrossRef]
  42. Naegler, M.; Diaconu, V.; Alexandri, A.A. The resistance of powdery mildew of vine (Uncinula necator) and powdery mildew of cucumber (Sphaerotheca fuliginea) to benzimidazole systemic fungicides. An. Inst. Cercet. Pentru Prot. Plantelor 1977, 12, 345–352. [Google Scholar]
  43. FRAC. FRAC Code List ©* 2020: Fungal Control Agents Sorted by Cross Resistance Pattern and Mode of Action. Available online: www.frac.info (accessed on 17 May 2021).
  44. Cherrad, S.; Charnay, A.; Hernandez, C.; Steva, H.; Belbahri, L.; Vacher, S. Emergence of boscalid-resistant strains of Erysiphe necator in French vineyards. Microbiol. Res. 2018, 216, 79–84. [Google Scholar] [CrossRef]
  45. Graf, S. Characterisation of Metrafenone and Succinate Dehydrogenase Inhibitor Resistant Isolates of the Grapevine POWDERY Mildew Erysiphe necator. Ph.D. Thesis, Technische Universitat Kaiserslautern, Kaiserslautern, Germany, 2017. [Google Scholar]
  46. Graf, S.; Zito, R.; Re, G.; Stammler, G. Status of in vivo and molecular diagnosis of fungicide resistance in powdery mildews. In Modern Fungicides and Antifungal Compounds; Deising, H.B., Fraaije, B., Mehl, A., Oerke, E.C., Sierotzki, H., Stammler, G., Eds.; Deutsche Phytomedizinische Gesellschaft: Braunschweig, Germany, 2017; Volume VIII, pp. 243–248. ISBN 9783941261150. [Google Scholar]
  47. Wilcox, W.; Burr, J.; Riegel, D.; Wong, F. Practical resistance to QoI fungicides in New York populations of Uncinula necator associated with quantitative shifts in pathogen sensitivities. Phytopathology 2003, 93, S90. [Google Scholar]
  48. Miller, T.C.; Gubler, W.D. Sensitivity of California isolates of Uncinula necator to trifloxystrobin and spiroxamine, and update on triadimefon sensitivity. Plant Dis. 2004, 88, 1205–1212. [Google Scholar] [CrossRef] [Green Version]
  49. Genet, J.-L.; Jaworska, G. Baseline sensitivity to proquinazid in Blumeria graminis f. sp. tritici and Erysiphe necator and cross-resistance with other fungicides. Pest Manag. Sci. 2009, 65, 878–884. [Google Scholar] [CrossRef]
  50. Steva, H.; Cartolaro, P.; Silva, M. Tolerance of powdery mildew of SBI fungicides: Situation for 1989. Phytoma 1990, 419, 41–44. [Google Scholar]
  51. Gubler, W.D.; Ypema, H.L.; Ouimette, D.G.; Bettiga, L.J. Occurrence of resistance in Uncinula necator to triadimefon, myclobutanil, and fenarimol in California grapevines. Plant Dis. 1996, 80, 902–909. [Google Scholar] [CrossRef]
  52. Halleen, F.; Holz, G.; Pringle, K.L. Resistance in Uncinula necator to triazole fungicides in South African grapevines. South Afr. J. Enol. Vitic. 2000, 21, 71–80. [Google Scholar] [CrossRef] [Green Version]
  53. Opalski, K. Cell Polarity in Plant Defense and Fungal Pathogenesis in the Interaction of Barley with Powdery Mildew Fungi. Ph.D. Thesis, Justus-Liebig-University Giessen, Giessen, Germany, 2005. [Google Scholar]
  54. Schmitt, M.R.; Carzaniga, R.; Cotter, H.V.T.; O’Connell, R.; Hollomon, D. Microscopy reveals disease control through novel effects on fungal development: A case study with an early-generation benzophenone fungicide. Pest Manag. Sci. 2006, 62, 383–392. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Felsenstein, F.; Semar, M.; Stammler, G. Sensitivity of wheat powdery mildew (Blumeria graminis f. sp. tritici) towards metrafenone. Gesunde Pflanz. 2010, 62, 29–33. [Google Scholar] [CrossRef]
  56. Miyamoto, T.; Hayashi, K.; Ogawara, T. First report of the occurrence of multiple resistance to Flutianil and Pyriofenone in field isolates of Podosphaera xanthii, the causal fungus of cucumber powdery mildew. Eur. J. Plant Pathol. 2020, 156, 953–963. [Google Scholar] [CrossRef]
  57. Torriani, S.F.F.; Frey, R.; Buitrago, C.; Wullschleger, J.; Waldner, M.; Kuehn, R.; Scalliet, G.; Sierotzki, H. Succinate-dehydrogenase inhibitor (SDHI) resistance evolution in plant pathogens. In Modern Fungicides and Antifungal Compounds; Deising, H.B., Fraaije, B., Mehl, A., Oerke, E.C., Sierotzki, H., Stammler, G., Eds.; Deutsche Phytomedizinische Gesellschaft: Braunschweig, Germany, 2016; Volume VIII, pp. 89–94. ISBN 978-3-941261-15-0. [Google Scholar]
  58. Ruprecht, J.; Yankovskaya, V.; Maklashina, E.; Iwata, S.; Cecchini, G. Structure of Escherichia coli succinate: Quinone oxidoreductase with an occupied and empty quinone-binding site. J. Biol. Chem. 2009, 284, 29836–29846. [Google Scholar] [CrossRef] [Green Version]
  59. Klappach, K.; Stammler, G.; Bryson, R.; Semar, M.; Mehl, A.; Steiger, D.; Derpmann, J.; Genet, J.-L.; MBoup, M.; Sierotzki, H.; et al. Succinate Dehydrogenase Inhibitor (SDHI) Working Group. 2021. Available online: https://www.frac.info/docs/default-source/working-groups/sdhi-fungicides/sdhi-meeting-minutes/minutes-of-the-2021-sdhi-meeting-20-21th-of-january-2021-with-recommendations-for-2021.pdf (accessed on 20 April 2021).
  60. Jeschke, P.; Witschel, M.; Krämer, W.; Schirmer, U.; Earley, F. Fungicides acting on oxidative phosphorylation. In Modern Crop Protection Compounds; Wiley-VCH Verlag GmbH & Co. KGaA: Weinheim, Germany, 2019; pp. 609–747. [Google Scholar]
  61. Hirooka, T.; Ishii, H. Chemical control of plant diseases. J. Gen. Plant Pathol. 2013, 79, 390–401. [Google Scholar] [CrossRef]
  62. Balba, H. Review of strobilurin fungicide chemicals. J. Environ. Sci. Health Part B 2007, 42, 441–451. [Google Scholar] [CrossRef]
  63. Bartlett, D.W.; Clough, J.M.; Godwin, J.R.; Hall, A.A.; Hamer, M.; Parr-Dobrzanski, B. The strobilurin fungicides. Pest Manag. Sci. 2002, 58, 649–662. [Google Scholar] [CrossRef]
  64. Wong, F.P.; Wilcox, W.F. Sensitivity to azoxystrobin among isolates of Uncinula necator: Baseline distribution and relationship to myclobutanil sensitivity. Plant Dis. 2002, 86, 394–404. [Google Scholar] [CrossRef] [Green Version]
  65. Rallos, L.E.E.; Johnson, N.G.; Schmale, D.G.; Prussin, A.J.; Baudoin, A.B. Fitness of Erysiphe necator with G143A-based resistance to quinone outside inhibitors. Plant Dis. 2014, 98, 1494–1502. [Google Scholar] [CrossRef] [Green Version]
  66. Miles, L.A.; Miles, T.D.; Kirk, W.W.; Schilder, A.M.C. Strobilurin (QoI) resistance in populations of Erysiphe necator on grapes in Michigan. Plant Dis. 2012, 96, 1621–1628. [Google Scholar] [CrossRef] [Green Version]
  67. FRAC. Quinone “Outside” Inhibitor (QoI) Working Group; 2021. Available online: https://www.frac.info/docs/default-source/working-groups/qol-fungicides/qoi-meeting-minutes/minutes-of-the-2021-qoi-wg-meeting-and-recommendations-for-2021-(-january-march-2021).pdf?sfvrsn=28f0499a (accessed on 21 June 2021).
  68. Wicks, T.J.; Wilson, D.; Stammler, G.; Paton, S.; Hall, B.H. Development of grape powdery mildew strains resistant to QoI fungicides in Australia. In Modern Fungicides and Antifungal Compounds; Dehne, H.W., Deising, H.B., Fraaije, B., Gisi, U., Hermann, D., Mehl, A., Oerke, E.C., Russell, P.E., Stammler, G., Kuck, K.H., Eds.; Deutsche Phytomedizinische Gesellschaft: Braunschweig, Germany, 2013; Volume VII, pp. 253–256. [Google Scholar]
  69. Hall, B.; McKay, S.; Lopez, F.; Harper, L.; Savocchia, S.; Borneman, A.; Herderich, M. Fungicide resistance in Australian viticulture. In Modern Fungicides and Antifungal Compounds; Deising, H.B., Fraaije, B., Mehl, A., Oerke, E.C., Sierotzkin, H., Stammler, G., Eds.; Deutsche Phytomedizinische Gesellschaft: Braunschweig, Germany, 2016; Volume VIII, pp. 181–186. [Google Scholar]
  70. Bacci, L.; Bosco, V.; Alfarano, L.; Bradascio, R. Meptyldinocap: Un nuovo fungicida antioidico per impieghi su vite, fragola e cucurbitacee. Atti Giornate Fitopatol. 2008, 2, 141–148. [Google Scholar]
  71. Ouimette, D. Fungicide resistance in Erysiphe necator—Monitoring, detection and management strategies. In Fungicide Resistance in Crop Protection: Risk and Management; Thind, T.S., Ed.; CABI: Wallingford, UK, 2011; pp. 32–43. ISBN 978-1-84593-905-2. [Google Scholar]
  72. Dietz, J.; Winter, C. Recently introduced powdery mildew fungicides. In Modern Crop Protection Compounds; Wiley-VCH Verlag GmbH & Co. KGaA: Weinheim, Germany, 2019; pp. 933–947. [Google Scholar]
  73. Lee, S.; Gustafson, G.; Skamnioti, P.; Baloch, R.; Gurr, S. Host perception and signal transduction studies in wild-type Blumeria graminis f. sp. hordei and a quinoxyfen-resistant mutant implicate quinoxyfen in the inhibition of serine esterase activity. Pest Manag. Sci. 2008, 64, 544–555. [Google Scholar] [CrossRef]
  74. Gilbert, S.R.; Cools, H.J.; Fraaije, B.A.; Bailey, A.M.; Lucas, J.A. Impact of proquinazid on appressorial development of the barley powdery mildew fungus Blumeria graminis f. sp. hordei. Pestic. Biochem. Physiol. 2009, 94, 127–132. [Google Scholar] [CrossRef]
  75. Green, E.A.; Gustafson, G.D. Sensitivity of Uncinula necator to quinoxyfen: Evaluation of isolates selected using a discriminatory dose screen. Pest Manag. Sci. 2006, 62, 492–497. [Google Scholar] [CrossRef] [PubMed]
  76. Colcol, J.F.; Baudoin, A.B. Sensitivity of Erysiphe necator and Plasmopara viticola in Virginia to QoI fungicides, boscalid, quinoxyfen, thiophanate methyl, and mefenoxam. Plant Dis. 2016, 100, 337–344. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  77. Feng, X.; Nita, M.; Baudoin, A.B. Evaluation of quinoxyfen resistance of Erysiphe necator (grape powdery mildew) in a single Virginia vineyard. Plant Dis. 2018, 102, 2586–2591. [Google Scholar] [CrossRef] [Green Version]
  78. Wheeler, I.E.; Hollomon, D.W.; Gustafson, G.; Mitchell, J.C.; Longhurst, C.; Zhang, Z.; Gurr, S.J. Quinoxyfen perturbs signal transduction in barley powdery mildew (Blumeria graminis f. sp. hordei). Mol. Plant Pathol. 2003, 4, 177–186. [Google Scholar] [CrossRef] [PubMed]
  79. Ziogas, B.N.; Malandrakis, A.A. Sterol biosynthesis inhibitors: C14 demethylation (DMIs). In Fungicide Resistance in Plant Pathogens; Springer: Tokyo, Japan, 2015; pp. 199–216. [Google Scholar]
  80. Frenkel, O.; Cadle-Davidson, L.; Wilcox, W.F.; Milgroom, M.G. Mechanisms of resistance to an azole fungicide in the grapevine powdery mildew fungus, Erysiphe necator. Phytopathology 2015, 105, 370–377. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  81. Délye, C.; Laigret, F.; Corio-Costet, M.F. A mutation in the 14 alpha-demethylase gene of Uncinula necator that correlates with resistance to a sterol biosynthesis inhibitor. Appl. Environ. Microbiol. 1997, 63, 2966–2970. [Google Scholar] [CrossRef] [Green Version]
  82. Cools, H.J.; Hawkins, N.J.; Fraaije, B.A. Constraints on the evolution of azole resistance in plant pathogenic fungi. Plant Pathol. 2013, 62, 36–42. [Google Scholar] [CrossRef] [Green Version]
  83. Hayashi, K.; Schoonbeek, H.-j.; Sugiura, H.; De Waard, M.A. Multidrug resistance in Botrytis cinerea associated with decreased accumulation of the azole fungicide oxpoconazole and increased transcription of the ABC transporter gene BcatrD. Pestic. Biochem. Physiol. 2001, 70, 168–179. [Google Scholar] [CrossRef]
  84. Omrane, S.; Sghyer, H.; Audéon, C.; Lanen, C.; Duplaix, C.; Walker, A.-S.; Fillinger, S. Fungicide efflux and the MgMFS1 transporter contribute to the multidrug resistance phenotype in Zymoseptoria tritici field isolates. Environ. Microbiol. 2015, 17, 2805–2823. [Google Scholar] [CrossRef] [PubMed]
  85. Dyer, P.S.; Hansen, J.; Delaney, A.; Lucas, J.A. Genetic control of resistance to the sterol 14α-demethylase inhibitor fungicide prochloraz in the cereal eyespot pathogen Tapesia yallundae. Appl. Environ. Microbiol. 2000, 66, 4599. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  86. Peever, T.L.; Milgroom, M.G. Inheritance of triadimenol resistance in Pyrenophora teres. Phytopathology 1992, 82, 821. [Google Scholar] [CrossRef]
  87. Krämer, W.; Berg, D.; Dutzmann, S.; Etzel, W.A.; Gau, W.; Stelzer, U.; Weissmüller, J. Chemistry, stereochemistry and biological properties of KWG 4168. Pestic. Sci. 1999, 55, 610–614. [Google Scholar] [CrossRef]
  88. FRAC. Sterol Biosynthesis Inhibitor (SBI) Working Group: Minutes from Virtual Call Protocol of the Discussions and Recommendations of the SBI Working Group of the Fungicide Resistance Action Committee (FRAC). 2021. Available online: https://www.frac.info/docs/default-source/working-groups/sbi-fungicides/group/minutes-of-the-2021-sbi-telco-meeting-recommendations-for-2021-from-3rd-of-march-2021.pdf?sfvrsn=55f3499a (accessed on 4 May 2021).
  89. Sano, S.; Kasahara, I.; Yamanaka, H. Development of a novel fungicide, cyflufenamid. J. Pestic. Sci. Pestic. Sci. Soc. Jpn. 2007, 32, 137–138. [Google Scholar] [CrossRef] [Green Version]
  90. Haramoto, M.; Yamanaka, H.; Sano, H.; Sano, S.; Otani, H. Fungicidal activities of cyflufenamid against various plant-pathogenic fungi. J. Pestic. Sci. 2006, 31, 95–101. [Google Scholar] [CrossRef] [Green Version]
  91. FRAC. FRAC List of Plant Pathogenic Organisms Resistant to Disease Control Agents. Available online: www.frac.info (accessed on 4 May 2021).
  92. Pirondi, A.; Nanni, I.M.; Brunelli, A.; Collina, M. First report of resistance to cyflufenamid in Podosphaera xanthii, causal agent of powdery mildew, from melon and zucchini fields in Italy. Plant Dis. 2014, 98, 1581. [Google Scholar] [CrossRef]
  93. McGrath, M.T.; Sexton, Z.F. Poor control of cucurbit powdery mildew associated with first detection of resistance to cyflufenamid in the causal agent, Podosphaera xanthii, in the United States. Plant Health Prog. 2018, 19, 222–223. [Google Scholar] [CrossRef]
  94. Corio-Costet, M.-F. Monitoring resistance in obligate pathogens by bioassays relating to field use: Grapevine powdery and downy mildews. In Fungicide Resistance in Plant Pathogens; Ishii, H., Hollomon, D.W., Eds.; Springer: Tokyo, Japan, 2015; pp. 251–279. [Google Scholar]
  95. Ma, Z.; Michailides, T.J. Advances in understanding molecular mechanisms of fungicide resistance and molecular detection of resistant genotypes in phytopathogenic fungi. Crop Prot. 2005, 24, 853–863. [Google Scholar] [CrossRef]
  96. Baudoin, A.; Olaya, G.; Delmotte, F.; Colcol, J.F.; Sierotzki, H. QoI resistance of Plasmopara viticola and Erysiphe necator in the Mid-Atlantic United States. Plant Health Prog. 2008, 1–6. [Google Scholar] [CrossRef] [Green Version]
  97. Miles, T.D.; Neill, T.M.; Colle, M.; Warneke, B.; Robinson, G.; Stergiopoulos, I.; Mahaffee, W.F. Allele-specific detection methods for QoI fungicide-resistant Erysiphe necator in vineyards. Plant Dis. 2020, 105, 175–182. [Google Scholar] [CrossRef] [PubMed]
  98. Dufour, M.C.; Fontaine, S.; Montarry, J.; Corio-Costet, M.F. Assessment of fungicide resistance and pathogen diversity in Erysiphe necator using quantitative real-time PCR assays. Pest Manag. Sci. 2011, 67, 60–69. [Google Scholar] [CrossRef] [PubMed]
  99. Pintye, A.; Németh, M.Z.; Molnár, O.; Horváth, Á.N.; Spitzmüller, Z.; Szalóki, N.; Pál, K.; Váczy, K.Z.; Kovács, G.M. Improved DNA extraction and quantitative real-time PCR for genotyping Erysiphe necator and detecting the DMI fungicide resistance marker A495T, using single ascocarps. Phytopathol. Mediterr. 2020, 59, 97–106. [Google Scholar] [CrossRef]
  100. Rallos, L.E.E. Characterizing Resistance of Erysiphe necator to Fungicides Belonging to the Quinone Outside Inhibitors and Demethylation Inhibitors. Ph.D. Thesis, Virginia Tech, Blacksburg, Virginia, 2013. [Google Scholar]
  101. Colcol, J.F.; Rallos, L.E.; Baudoin, A.B. Sensitivity of Erysiphe necator to demethylation inhibitor fungicides in Virginia. Plant Dis. 2012, 96, 111–116. [Google Scholar] [CrossRef] [Green Version]
Table
Table 2. Molecular mechanisms of resistance to fungicides applied in grapevine powdery mildew management. Target gene and single-nucleotide mutations described in various fungal pathogens and grapevine powdery mildew.
Table 2. Molecular mechanisms of resistance to fungicides applied in grapevine powdery mildew management. Target gene and single-nucleotide mutations described in various fungal pathogens and grapevine powdery mildew.
FRAC CodeGroup NameTarget GeneMutations Associated with Resistance in
Various Fungal PathogensE. necator
8Hydroxy-(2-amino-)
pyrimidines		adenosin-deaminaseunknown anot detected b
1MBC-fungicidesβ-tubulinE198A/G/K/Q, F200Ynot investigated
50Aryl-phenyl-ketonesunknownunknownunknown
7SDHI (Succinate-dehydrogenase inhibitors)succinate dehydrogenasevarious mutations mostly in SdhB geneSdhB H242R/Y, I244V,
SdhC G169D/S
11QoI-fungicides (Quinone outside Inhibitors)cytochrome bF129L, G137R, G143A/S,
other mechanisms		G143A
29Uncouplers of oxidative phosphorylationunknownnot detectednot detected
13Azanaphthalenesunknownunknownunknown
3DMI-fungicides
SBI: Class I		C14-demethylaseV136A, Y137F, A379G,
other mechanisms		Y136F, A1119C
5Amines (morpholines)
SBI: Class II		Δ14-reductase, Δ8→Δ7- isomeraseunknownunknown
U06Phenyl-acetamideunknownunknownnot detected
M02Inorganicmulti-sitenot detectednot detected
a resistance detected but the molecular mechanism unknown; b resistance not detected. Numerical FRAC codes are highlighted in bold.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Kunova, A.; Pizzatti, C.; Saracchi, M.; Pasquali, M.; Cortesi, P. Grapevine Powdery Mildew: Fungicides for Its Management and Advances in Molecular Detection of Markers Associated with Resistance. Microorganisms 2021, 9, 1541. https://doi.org/10.3390/microorganisms9071541

AMA Style

Kunova A, Pizzatti C, Saracchi M, Pasquali M, Cortesi P. Grapevine Powdery Mildew: Fungicides for Its Management and Advances in Molecular Detection of Markers Associated with Resistance. Microorganisms. 2021; 9(7):1541. https://doi.org/10.3390/microorganisms9071541

Chicago/Turabian Style

Kunova, Andrea, Cristina Pizzatti, Marco Saracchi, Matias Pasquali, and Paolo Cortesi. 2021. "Grapevine Powdery Mildew: Fungicides for Its Management and Advances in Molecular Detection of Markers Associated with Resistance" Microorganisms 9, no. 7: 1541. https://doi.org/10.3390/microorganisms9071541

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop