Comparative Transcriptomic and Molecular Pathway Analyses of HL-CZ Human Pro-Monocytic Cells Expressing SARS-CoV-2 Spike S1, S2, NP, NSP15 and NSP16 Genes
Abstract
1. Introduction
2. Materials and Methods
2.1. Expression Plasmids and Vector Controls
2.2. HL-CZ Cell Culture
2.3. Antibodies
2.4. Plasmid DNA Transfection and RNA Extraction
2.5. Protein Extraction, SDS-PAGE, and Western Blotting
2.6. Confocal Microscopy
2.7. RNA-Sequencing
2.8. Data Processing
2.9. Gene Set Enrichment Analysis (GSEA)
2.10. Validation by Real-Time Reverse Transcription and Quantitative Polymerase Chain Reaction (RT-qPCR)
3. Results
3.1. Successful Transfection of HL-CZ Cells
3.2. RNA-Sequencing
3.3. Identification of the Most Up-Regulated and Down-Regulated Genes
3.4. Hierarchical Clustering of DEGs
3.5. Volcano Plots
3.6. Functional Enrichment Analysis
3.6.1. Enriched GO Terms for Key Functional Categories
3.6.2. Enriched KEGG Pathways
3.7. Validation of Expression of Selected Genes via RT-qPCR
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhu, N.; Zhang, D.; Wang, W.; Li, X.; Yang, B.; Song, J.; Zhao, X.; Huang, B.; Shi, W.; Lu, R.; et al. A novel coronavirus from patients with pneumonia in China, 2019. N. Engl. J. Med. 2020, 382, 727–733. [Google Scholar] [CrossRef]
- Wilder-Smith, A.; Osman, S. Public health emergencies of international concern: A historic overview. J. Travel Med. 2020, 27, taaa227. [Google Scholar] [CrossRef]
- Gorbalenya, A.E.; Baker, S.C.; Baric, R.S.; de Groot, R.J.; Drosten, C.; Gulyaeva, A.A.; Haagmans, B.L.; Lauber, C.; Leontovich, A.M.; Neuman, B.W.; et al. The species Severe acute respiratory syndrome-related coronavirus: Classifying 2019-nCoV and naming it SARS-CoV-2. Nat. Microbiol. 2020, 5, 536–544. [Google Scholar]
- Sharma, A.; Ahmad Farouk, I.; Lal, S.K. COVID-19: A review on the novel coronavirus disease evolution, transmission, detection, control and prevention. Viruses 2021, 13, 202. [Google Scholar] [CrossRef] [PubMed]
- Center for Systems Science and Engineering at Johns Hopkins University. COVID-19 Dashboard. 2021. Available online: https://coronavirus.jhu.edu/map.html (accessed on 15 May 2021).
- Wu, F.; Zhao, S.; Yu, B.; Chen, Y.-M.; Wang, W.; Song, Z.-G.; Hu, Y.; Tao, Z.-W.; Tian, J.-H.; Pei, Y.-Y.; et al. A new coronavirus associated with human respiratory disease in China. Nature 2020, 579, 265–269. [Google Scholar] [CrossRef] [PubMed]
- Von Brunn, A.; Teepe, C.; Simpson, J.C.; Pepperkok, R.; Friedel, C.C.; Zimmer, R.; Roberts, R.; Baric, R.; Haas, J. Analysis of intraviral protein-protein interactions of the SARS coronavirus ORFeome. PLoS ONE 2007, 2, e459. [Google Scholar] [CrossRef]
- Ter Meulen, J.; van den Brink, E.N.; Poon, L.L.; Marissen, W.E.; Leung, C.S.; Cox, F.; Cheung, C.Y.; Bakker, A.Q.; Bogaards, J.A.; van Deventer, E.; et al. Human monoclonal antibody combination against SARS coronavirus: Synergy and coverage of escape mutants. PLoS Med. 2006, 3, e237. [Google Scholar] [CrossRef]
- Poh, W.P.; Narasaraju, T.; Pereira, N.A.; Zhong, F.; Phoon, M.C.; Macary, P.A.; Wong, S.H.; Lu, J.; Koh, D.R.; Chow, V.T. Characterization of cytotoxic T-lymphocyte epitopes and immune responses to SARS coronavirus spike DNA vaccine expressing the RGD-integrin-binding motif. J. Med. Virol. 2009, 81, 1131–1139. [Google Scholar] [CrossRef]
- Zheng, Z.; Monteil, V.M.; Maurer-Stroh, S.; Yew, C.W.; Leong, C.; Mohd-Ismail, N.K.; Cheyyatraivendran Arularasu, S.; Chow, V.T.K.; Lin, R.T.P.; Mirazimi, A.; et al. Monoclonal antibodies for the S2 subunit of spike of SARS-CoV-1 cross-react with the newly-emerged SARS-CoV-2. Eurosurveillance 2020, 25, 2000291. [Google Scholar] [CrossRef]
- Bertram, S.; Dijkman, R.; Habjan, M.; Heurich, A.; Gierer, S.; Glowacka, I.; Welsch, K.; Winkler, M.; Schneider, H.; Hofmann-Winkler, H.; et al. TMPRSS2 activates the human coronavirus 229E for cathepsin-independent host cell entry and is expressed in viral target cells in the respiratory epithelium. J. Virol. 2013, 87, 6150–6160. [Google Scholar] [CrossRef]
- Cong, Y.; Ulasli, M.; Schepers, H.; Mauthe, M.; V’kovski, P.; Kriegenburg, F.; Thiel, V.; de Haan, C.A.M.; Reggiori, F. Nucleocapsid protein recruitment to replication-transcription complexes plays a crucial role in coronaviral life cycle. J. Virol. 2020, 94, e01925-19. [Google Scholar] [CrossRef] [PubMed]
- Hackbart, M.; Deng, X.; Baker, S.C. Coronavirus endoribonuclease targets viral polyuridine sequences to evade activating host sensors. Proc. Natl. Acad. Sci. USA 2020, 117, 8094–8103. [Google Scholar] [CrossRef]
- Decroly, E.; Debarnot, C.; Ferron, F.; Bouvet, M.; Coutard, B.; Imbert, I.; Gluais, L.; Papageorgiou, N.; Sharff, A.; Bricogne, G.; et al. Crystal structure and functional analysis of the SARS-coronavirus RNA cap 2’-O-methyltransferase nsp10/nsp16 complex. PLoS Pathog. 2011, 7, e1002059. [Google Scholar] [CrossRef] [PubMed]
- Narasaraju, T.; Soong, P.L.; ter Meulen, J.; Goudsmit, J.; Chow, V.T.K. SARS Coronavirus Spike Protein Expression in HL-CZ Human Promonocytic Cells: Monoclonal Antibody and Cellular Transcriptomic Analyses. In Molecular Biology of the SARS-Coronavirus; Springer: Berlin/Heidelberg, Germany, 2009; pp. 289–304. [Google Scholar]
- Merad, M.; Martin, J.C. Pathological inflammation in patients with COVID-19: A key role for monocytes and macrophages. Nat. Rev. Immunol. 2020, 20, 355–362. [Google Scholar] [CrossRef]
- Wang, S.F.; Tseng, S.P.; Yen, C.H.; Yang, J.Y.; Tsao, C.H.; Shen, C.W.; Chen, K.H.; Liu, F.T.; Liu, W.T.; Chen, Y.M.; et al. Antibody-dependent SARS coronavirus infection is mediated by antibodies against spike proteins. Biochem. Biophys. Res. Commun. 2014, 451, 208–214. [Google Scholar] [CrossRef]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef]
- Liao, Y.; Smyth, G.K.; Shi, W. featureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 2014, 30, 923–930. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Blighe, K.; Rana, S.; Lewis, M. EnhancedVolcano: Publication-Ready Volcano Plots with Enhanced Colouring and Labeling. 2021. Available online: https://github.com/kevinblighe/EnhancedVolcano (accessed on 30 November 2020).
- Metsalu, T.; Vilo, J. ClustVis: A web tool for visualizing clustering of multivariate data using Principal Component Analysis and heatmap. Nucleic Acids Res. 2015, 43, W566–W570. [Google Scholar] [CrossRef]
- Yu, G.; Wang, L.G.; Han, Y.; He, Q.Y. clusterProfiler: An R package for comparing biological themes among gene clusters. OMICS 2012, 16, 284–287. [Google Scholar] [CrossRef]
- Luo, W.; Brouwer, C. Pathview: An R/Bioconductor package for pathway-based data integration and visualization. Bioinformatics 2013, 29, 1830–1831. [Google Scholar] [CrossRef] [PubMed]
- Nal, B.; Chan, C.; Kien, F.; Siu, L.; Tse, J.; Chu, K.; Kam, J.; Staropoli, I.; Crescenzo-Chaigne, B.; Escriou, N.; et al. Differential maturation and subcellular localization of severe acute respiratory syndrome coronavirus surface proteins S, M and E. J. Gen. Virol. 2005, 86, 1423–1434. [Google Scholar] [CrossRef] [PubMed]
- Liao, Y.; Yuan, Q.; Torres, J.; Tam, J.P.; Liu, D.X. Biochemical and functional characterization of the membrane association and membrane permeabilizing activity of the severe acute respiratory syndrome coronavirus envelope protein. Virology 2006, 349, 264–275. [Google Scholar] [CrossRef]
- Chan, C.P.; Siu, K.L.; Chin, K.T.; Yuen, K.Y.; Zheng, B.; Jin, D.Y. Modulation of the unfolded protein response by the severe acute respiratory syndrome coronavirus spike protein. J. Virol. 2006, 80, 9279–9287. [Google Scholar] [CrossRef] [PubMed]
- Schröder, M.; Kaufman, R.J. The mammalian unfolded protein response. Annu. Rev. Biochem. 2005, 74, 739–789. [Google Scholar] [CrossRef]
- Xu, C.; Bailly-Maitre, B.; Reed, J.C. Endoplasmic reticulum stress: Cell life and death decisions. J. Clin. Investig. 2005, 115, 2656–2664. [Google Scholar] [CrossRef]
- Boyce, M.; Yuan, J. Cellular response to endoplasmic reticulum stress: A matter of life or death. Cell Death Differ. 2006, 13, 363–373. [Google Scholar] [CrossRef]
- Mamoor, S. The activating transcription factor ATF3 is differentially expressed and transcriptionally induced in multiple models of coronavirus infection. OSF Prepr. 2020. [Google Scholar] [CrossRef]
- Mamoor, S. The DNA Damage Inducible Transcript DDIT3 is differentially expressed and transcriptionally induced in models of coronavirus infection. OSF Prepr. 2020. [Google Scholar] [CrossRef]
- Mamoor, S. Coronaviruses induce the expression of the dual specificity phosphatase DUSP1/MKP1. OSF Prepr. 2020. [Google Scholar] [CrossRef]
- Ku, H.C.; Cheng, C.F. Master regulator activating transcription factor 3 (ATF3) in metabolic homeostasis and cancer. Front. Endocrinol. 2020, 14, 556. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Hou, P.; Pan, W.; He, W.; He, D.C.; Wang, H.; He, H. DDIT3 targets innate immunity via the DDIT3-OTUD1-MAVS pathway to promote bovine viral diarrhea virus replication. J. Virol. 2021, 95, e02351-20. [Google Scholar] [PubMed]
- Robitaille, A.C.; Caron, E.; Zucchini, N.; Mukawera, E.; Adam, D.; Mariani, M.K.; Gélinas, A.; Fortin, A.; Brochiero, E.; Grandvaux, N. DUSP1 regulates apoptosis and cell migration, but not the JIP1-protected cytokine response, during Respiratory Syncytial Virus and Sendai Virus infection. Sci. Rep. 2017, 7, 17388. [Google Scholar] [CrossRef]
- Blanco-Melo, D.; Nilsson-Payant, B.E.; Liu, W.C.; Uhl, S.; Hoagland, D.; Møller, R.; Jordan, T.X.; Oishi, K.; Panis, M.; Sacsh, D.; et al. Imbalanced host response to SARS-CoV-2 drives development of COVID-19. Cell 2020, 181, 1036–1045.e9. [Google Scholar] [CrossRef]
- Cox, L.S.; Bellantuono, I.; Lord, J.M.; Sapey, E.; Mannick, J.B.; Partridge, L.; Gordon, A.L.; Steves, C.J.; Witham, M.D. Tackling immunosenescence to improve COVID-19 outcomes and vaccine response in older adults. Lancet Healthy Longev. 2020, 1, e55–e57. [Google Scholar] [CrossRef]
- Deane, C.A.S.; Brown, I.R. Differential targeting of Hsp70 heat shock proteins HSPA6 and HSPA1A with components of a protein disaggregation/refolding machine in differentiated human neuronal cells following thermal stress. Front. Neurosci. 2017, 11, 227. [Google Scholar] [CrossRef]
- Kennedy, D.; Mnich, K.; Samali, A. Heat shock preconditioning protects against ER stress-induced apoptosis through the regulation of the BH3-only protein BIM. FEBS Open Bio. 2014, 4, 813–821. [Google Scholar] [CrossRef]
- Lee, K.J.; Kim, Y.M.; Kim, D.Y.; Jeoung, D.; Han, K.; Lee, S.T.; Lee, Y.S.; Park, K.H.; Park, J.H.; Kim, D.J.; et al. Release of heat shock protein 70 (Hsp70) and the effects of extracellular Hsp70 on matrix metalloproteinase-9 expression in human monocytic U937 cells. Exp. Mol. Med. 2006, 38, 364–374. [Google Scholar] [CrossRef]
- Krause, M.; Heck, T.G.; Bittencourt, A.; Scomazzon, S.P.; Newsholme, P.; Curi, R.; Homem de Bittencourt, P.I., Jr. The chaperone balance hypothesis: The importance of the extracellular to intracellular HSP70 ratio to inflammation-driven type 2 diabetes, the effect of exercise, and the implications for clinical management. Mediat. Inflamm. 2015, 2015, 249205. [Google Scholar] [CrossRef]
- Li, C.; Chu, H.; Liu, X.; Chiu, M.C.; Zhao, X.; Wang, D.; Wei, Y.; Hou, Y.; Shuai, H.; Cai, J.; et al. Human coronavirus dependency on host heat shock protein 90 reveals an antiviral target. Emerg. Microbes Infect. 2020, 9, 2663–2672. [Google Scholar] [CrossRef]
- Leong, W.F.; Tan, H.C.; Ooi, E.E.; Koh, D.R.; Chow, V.T. Microarray and real-time RT-PCR analyses of differential human gene expression patterns induced by severe acute respiratory syndrome (SARS) coronavirus infection of Vero cells. Microbes Infect. 2005, 7, 248–259. [Google Scholar] [CrossRef]
- Nguyen, H.; Ramana, C.V.; Bayes, J.; Stark, G.R. Roles of phosphatidylinositol 3-kinase in interferon-gamma-dependent phosphorylation of STAT1 on serine 727 and activation of gene expression. J. Biol. Chem. 2001, 276, 33361–33368. [Google Scholar] [CrossRef]
- Zhang, Q.; Bastard, P.; Liu, Z.; Le Pen, J.; Moncada-Velez, M.; Chen, J.; Ogishi, M.; Sabli, I.K.D.; Hodeib, S.; Korol, C. Inborn errors of type I IFN immunity in patients with life-threatening COVID-19. Science 2020, 370, eabd4570. [Google Scholar] [CrossRef] [PubMed]
- Babon, J.J.; Varghese, L.N.; Nicola, N.A. Inhibition of IL-6 family cytokines by SOCS3. Semin. Immunol. 2014, 26, 13–19. [Google Scholar] [CrossRef]
- Matsuyama, T.; Kubli, S.P.; Yoshinaga, S.K.; Pfeffer, K.; Mak, T.W. An aberrant STAT pathway is central to COVID-19. Cell Death Differ. 2020, 27, 3209–3225. [Google Scholar] [CrossRef]
- Leth-Larsen, R.; Zhong, F.; Chow, V.T.; Holmskov, U.; Lu, J. The SARS coronavirus spike glycoprotein is selectively recognized by lung surfactant protein D and activates macrophages. Immunobiology 2007, 212, 201–211. [Google Scholar] [CrossRef] [PubMed]
- Ouwendijk, W.J.D.; Raadsen, M.P.; van Kampen, J.J.A.; Verdijk, R.M.; von der Thusen, J.H.; Guo, L.; Hoek, R.A.S.; van den Akker, J.P.C.; Endeman, H.; Langerak, T.; et al. High levels of neutrophil extracellular traps persist in the lower respiratory tract of critically ill patients with coronavirus disease 2019. J. Infect. Dis. 2021, 223, 1512–1521. [Google Scholar] [CrossRef] [PubMed]
- Narasaraju, T.; Tang, B.M.; Herrmann, M.; Muller, S.; Chow, V.T.K.; Radic, M. Neutrophilia and NETopathy as key pathologic drivers of progressive lung impairment in patients with COVID-19. Front. Pharmacol. 2020, 11, 870. [Google Scholar] [CrossRef]
- Chu, H.; Chan, J.F.; Wang, Y.; Yuen, T.T.; Chai, Y.; Hou, Y.; Shuai, H.; Yang, D.; Hu, B.; Huang, X.; et al. Comparative replication and immune activation profiles of SARS-CoV-2 and SARS-CoV in human lungs: An ex vivo study with implications for the pathogenesis of COVID-19. Clin. Infect. Dis. 2020, 71, 1400–1409. [Google Scholar] [CrossRef]
- Szabo, P.A.; Dogra, P.; Gray, J.I.; Wells, S.B.; Connors, T.J.; Weisberg, S.P.; Krupska, I.; Matsumoto, R.; Poon, M.M.L.; Idzikowski, E.; et al. Longitudinal profiling of respiratory and systemic immune responses reveals myeloid cell-driven lung inflammation in severe COVID-19. Immunity 2021, 54, 797–814. [Google Scholar] [CrossRef]
- Gamage, A.M.; Tan, K.S.; Chan, W.O.Y.; Liu, J.; Tan, C.W.; Ong, Y.K.; Thong, M.; Andiappan, A.K.; Anderson, D.E.; Wang, Y.; et al. Infection of human Nasal Epithelial Cells with SARS-CoV-2 and a 382-nt deletion isolate lacking ORF8 reveals similar viral kinetics and host transcriptional profiles. PLoS Pathog. 2020, 16, e1009130. [Google Scholar] [CrossRef] [PubMed]
- Grant, R.A.; Morales-Nebreda, L.; Markov, N.S.; Swaminathan, S.; Querrey, M.; Guzman, E.R.; Abbott, D.A.; Donnelly, H.K.; Donayre, A.; Goldberg, I.A.; et al. Circuits between infected macrophages and T cells in SARS-CoV-2 pneumonia. Nature 2021, 590, 635–641. [Google Scholar] [CrossRef]
- Park, M.D. Macrophages: A Trojan horse in COVID-19? Nat. Rev. Immunol. 2020, 20, 351. [Google Scholar] [CrossRef]
- Ng, W.H.; Tipih, T.; Makoah, N.A.; Vermeulen, J.G.; Goedhals, D.; Sempa, J.B.; Burt, F.J.; Taylor, A.; Mahalingam, S. Comorbidities in SARS-CoV-2 patients: A systematic review and meta-analysis. mBio 2021, 12, e03647-20. [Google Scholar] [CrossRef] [PubMed]
- Méry, G.; Epaulard, O.; Borel, A.L.; Toussaint, B.; Le Gouellec, A. COVID-19: Underlying adipokine storm and angiotensin 1-7 umbrella. Front. Immunol. 2020, 11, 1714. [Google Scholar] [CrossRef]
- Krause, M.; Gerchman, F.; Friedman, R. Coronavirus infection (SARS-CoV-2) in obesity and diabetes comorbidities: Is heat shock response determinant for the disease complications? Diabetol. Metab. Syndr. 2020, 12, 63. [Google Scholar] [CrossRef]
- Leng, L.; Cao, R.; Ma, J.; Mou, D.; Zhu, Y.; Li, W.; Lv, L.; Gao, D.; Zhang, S.; Gong, F.; et al. Pathological features of COVID-19-associated lung injury: A preliminary proteomics report based on clinical samples. Signal Transduct. Target Ther. 2020, 5, 240. [Google Scholar] [CrossRef]
- Bar-On, Y.M.; Flamholz, A.; Phillips, R.; Milo, R. SARS-CoV-2 (COVID-19) by the numbers. Elife 2020, 9, e57309. [Google Scholar] [CrossRef]
- Atyeo, C.; Fischinger, S.; Zohar, T.; Slein, M.D.; Burke, J.; Loos, C.; McCulloch, D.J.; Newman, K.L.; Wolf, C.; Yu, J.; et al. Distinct early serological signatures track with SARS-CoV-2 survival. Immunity 2020, 53, 524–532.e4. [Google Scholar] [CrossRef] [PubMed]
- Gordon, D.E.; Jang, G.M.; Bouhaddou, M.; Xu, J.; Obernier, K.; White, K.M.; O’Meara, M.J.; Rezelj, V.V.; Guo, J.Z.; Swaney, D.L.; et al. A SARS-CoV-2 protein interaction map reveals targets for drug repurposing. Nature 2020, 583, 459–468. [Google Scholar] [CrossRef] [PubMed]
- Surjit, M.; Liu, B.; Jameel, S.; Chow, V.T.; Lal, S.K. The SARS coronavirus nucleocapsid protein induces actin reorganization and apoptosis in COS-1 cells in the absence of growth factors. Biochem. J. 2004, 383, 13–18. [Google Scholar] [CrossRef] [PubMed]
- Surjit, M.; Liu, B.; Chow, V.T.; Lal, S.K. The nucleocapsid protein of severe acute respiratory syndrome-coronavirus inhibits the activity of cyclin-cyclin-dependent kinase complex and blocks S phase progression in mammalian cells. J. Biol. Chem. 2006, 281, 10669–10681. [Google Scholar] [CrossRef]
- Zhou, B.; Liu, J.; Wang, Q.; Liu, X.; Li, X.; Li, P.; Ma, Q.; Cao, C. The nucleocapsid protein of severe acute respiratory syndrome coronavirus inhibits cell cytokinesis and proliferation by interacting with translation elongation factor 1alpha. J. Virol. 2008, 82, 6962–6971. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.T.; Jhao, P.Y.; Hung, C.T.; Wu, Y.F.; Lin, S.J.; Chiang, W.C.; Lin, S.L.; Yang, K.C. Endoplasmic reticulum protein TXNDC5 promotes renal fibrosis by enforcing TGFβ signaling in kidney fibroblasts. J. Clin. Investig. 2021, 131, e143645. [Google Scholar] [CrossRef]
- Yuen, C.K.; Lam, J.Y.; Wong, W.M.; Mak, L.F.; Wang, X.; Chu, H.; Cai, J.P.; Jin, D.Y.; To, K.K.; Chan, J.F.; et al. SARS-CoV-2 nsp13, nsp14, nsp15 and orf6 function as potent interferon antagonists. Emerg. Microbes Infect. 2020, 9, 1418–1428. [Google Scholar] [CrossRef]
- Menachery, V.D.; Debbink, K.; Baric, R.S. Coronavirus non-structural protein 16: Evasion, attenuation, and possible treatments. Virus Res. 2014, 194, 191–199. [Google Scholar] [CrossRef] [PubMed]
- Bojkova, D.; Klann, K.; Koch, B.; Widera, M.; Krause, D.; Ciesek, S.; Cinatl, J.; Münch, C. Proteomics of SARS-CoV-2-infected host cells reveals therapy targets. Nature 2020, 583, 469–472. [Google Scholar] [CrossRef] [PubMed]
- Vavougios, G.D. Human coronaviruses in idiopathic Parkinson’s disease: Implications of SARS-CoV-2’s modulation of the host’s transcriptome. Infect. Genet. Evol. 2021, 89, 104733. [Google Scholar] [CrossRef]
- Young, M.J.; O’Hare, M.; Matiello, M.; Schmahmann, J.D. Creutzfeldt-Jakob disease in a man with COVID-19: SARS-CoV-2-accelerated neurodegeneration? Brain Behav. Immun. 2020, 89, 601–603. [Google Scholar] [CrossRef]
- Gu, T.; Zhao, S.; Jin, G.; Song, M.; Zhi, Y.; Zhao, R.; Ma, F.; Zheng, Y.; Wang, K.; Liu, H.; et al. Cytokine signature induced by SARS-CoV-2 spike protein in a mouse model. Front. Immunol. 2021, 11, 621441. [Google Scholar] [CrossRef] [PubMed]
- Tandon, R.; Mitra, D.; Sharma, P.; McCandless, M.G.; Stray, S.J.; Bates, J.T.; Marshall, G.D. Effective screening of SARS-CoV-2 neutralizing antibodies in patient serum using lentivirus particles pseudotyped with SARS-CoV-2 spike glycoprotein. Sci. Rep. 2020, 10, 19076. [Google Scholar] [CrossRef] [PubMed]
- Mishra, T.; Sreepadmanabh, M.; Ramdas, P.; Sahu, A.K.; Kumar, A.; Chande, A. SARS CoV-2 nucleoprotein enhances the infectivity of lentiviral spike particles. Front. Cell. Infect. Microbiol. 2021, 11, 663688. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer (5’–3’) | Reverse Primer (5’–3’) |
---|---|---|
GAPDH (reference) | ACCCACTCCTCCACCTTTGAC | TCCACCACCCTGTTGCTGTAG |
SOCS3 | CGCCTCAAGACCTTCAGCTC | TGAAGAAGTGGCGCTGGTC |
HSPA1 | GAGCGCAACGTGCTCATCT | ACCTCGAAGATGCCGTCGT |
HSPA6 | TGGCTGCCAAAAACTCGCTG | CAGGCAAGGACTTCCCGACA |
NSP15 | TTGTGCACCACTCACTGTCT | GAACCTGTTTGCGCATCTGTT |
NSP16 | AAGACAGTGGTTGCCTACGG | TCGCGTGGTTTGCCAAGATA |
Transfection Group | Up-Regulated DEGs | Down-Regulated DEGs | Total Number |
---|---|---|---|
S1 | 77 | 5 | 82 |
S2 | 27 | 15 | 42 |
NSP15 | 36 | 14 | 50 |
NSP16 | 15 | 23 | 38 |
NP | 4 | 0 | 4 |
Log2 Fold Change (Adjusted p-Value) | |||||||||
---|---|---|---|---|---|---|---|---|---|
Gene | S1 vs. PCMV | S2 vs. PCMV | NSP15 vs. PCMVF | NSP16 vs. PCMVF | NP vs. PCMVF | S1 vs. S2 | NSP16 vs. NSP15 | NP vs. NSP15 | NP vs. NSP15 |
ATF3 | 0.41 (1.45 × 10−5) | 0.43 (5.20 × 10−6) | NS | NS | NS | NS | NS | 0.65 (6.10 × 10−15) | 0.61 (4.90 × 10−13) |
CHCHD10 | NS | NS | 0.90 (1.22 × 10−21) | 0.61 (5.36 × 10−9) | NS | NS | −0.29 (0.014) | −0.80 (1.10 × 10−16) | −0.50 (1.63 × 10−6) |
DDIT3 | 0.44 (1.75 × 10−10) | 0.39 (6.53 × 10−8) | NS | NS | NS | NS | NS | NS | NS |
DNAJB1 | 0.53 (1.18 × 10−21) | 0.80 (4.30 × 10−50) | NS | 0.26 (2.71 × 10−7) | 0.47 (1.12 × 10−27) | 0.26 (4.97 × 10−5) | 0.16 (0.0027) | 0.37 (1.10 × 10−16) | 0.21 (2.40 × 10−5) |
DUSP1 | 0.57 (5.21 × 10−5) | 0.60 (2.84 × 10−5) | NS | NS | NS | NS | NS | NS | 0.32 (0.026) |
HSPA1A | 1.67 (2.48 × 10−74) | 1.88 (2.10 × 10−196) | NS | 0.42 (9.64 × 10−10) | 0.44 (1.75 × 10−10) | 0.71 (1.36 × 10−27) | 0.26 (0.0006) | 0.47 (3.28 × 10−13) | 0.22 (0.0075) |
HSPA1B | 1.14 (6.91 × 10−80) | 1.44 (1.76 × 10−131) | NS | 0.40 (1.38 × 10−11) | 0.63 (2.88 × 10−25) | 0.31 (1.17 × 10−5) | 0.39 (8.66 × 10−11) | 0.27 (5.84 × 10−5) | NS |
HSPA6 | 1.91 (1.36 × 10−24) | 1.11 (1.16 × 10−6) | NS | 0.53 (0.043) | NS | −0.80 (7.75 × 10−5) | NS | 0.54 (0.019) | NS |
IER5 | 0.42 (6.31 × 10−6) | 0.44 (5.20 × 10−6) | NS | NS | NS | NS | NS | NS | NS |
KLF10 | −0.28 (0.0013) | −0.37 (2.24 × 10−6) | −0.44 (8.37 × 10−9) | −0.23 (0.032) | NS | NS | 0.21 (0.015) | 0.35 (1.26 × 10−5) | NS |
TXNDC5 | NS | NS | 0.15 (0.0002) | 0.74 (0.0002) | NS | NS | NS | −0.98 (5.05 × 10−8) | −0.98 (2.91 × 10−8) |
RNA-Seq | Real-Time RT-qPCR | ||
---|---|---|---|
Gene | Sample | Log2 Fold Change (p-Value) | Log2 Fold Change (p-Value) |
SOCS3 | S1 | −0.261 (p ≥ 0.05) | −0.263 (p ≥ 0.05) |
S2 | −1.028 (p < 0.001) * | −1.379 (p < 0.001) * | |
HSPA1A | S1 | 1.168 (p < 0.001) * | - |
S2 | 1.876 (p < 0.001) * | - | |
HSPA1B | S1 | 1.139 (p < 0.001) * | - |
S2 | 1.446 (p < 0.001) * | - | |
HSPA1 | S1 | - | 1.356 (p = 0.001) * |
S2 | - | 1.367 (p = 0.004) * | |
HSPA6 | S1 | 1.909 (p < 0.001) * | 1.1506 (p = 0.035) * |
S2 | 1.109 (p < 0.001) * | 0.379 (p ≥ 0.05) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sharma, A.; Ong, J.W.; Loke, M.F.; Chua, E.G.; Lee, J.J.; Choi, H.W.; Tan, Y.J.; Lal, S.K.; Chow, V.T. Comparative Transcriptomic and Molecular Pathway Analyses of HL-CZ Human Pro-Monocytic Cells Expressing SARS-CoV-2 Spike S1, S2, NP, NSP15 and NSP16 Genes. Microorganisms 2021, 9, 1193. https://doi.org/10.3390/microorganisms9061193
Sharma A, Ong JW, Loke MF, Chua EG, Lee JJ, Choi HW, Tan YJ, Lal SK, Chow VT. Comparative Transcriptomic and Molecular Pathway Analyses of HL-CZ Human Pro-Monocytic Cells Expressing SARS-CoV-2 Spike S1, S2, NP, NSP15 and NSP16 Genes. Microorganisms. 2021; 9(6):1193. https://doi.org/10.3390/microorganisms9061193
Chicago/Turabian StyleSharma, Anshika, Joe W. Ong, Mun Fai Loke, Eng Guan Chua, Joseph J. Lee, Hyung Won Choi, Yee Joo Tan, Sunil K. Lal, and Vincent T. Chow. 2021. "Comparative Transcriptomic and Molecular Pathway Analyses of HL-CZ Human Pro-Monocytic Cells Expressing SARS-CoV-2 Spike S1, S2, NP, NSP15 and NSP16 Genes" Microorganisms 9, no. 6: 1193. https://doi.org/10.3390/microorganisms9061193
APA StyleSharma, A., Ong, J. W., Loke, M. F., Chua, E. G., Lee, J. J., Choi, H. W., Tan, Y. J., Lal, S. K., & Chow, V. T. (2021). Comparative Transcriptomic and Molecular Pathway Analyses of HL-CZ Human Pro-Monocytic Cells Expressing SARS-CoV-2 Spike S1, S2, NP, NSP15 and NSP16 Genes. Microorganisms, 9(6), 1193. https://doi.org/10.3390/microorganisms9061193