Molecular Characterization of Giardia duodenalis in Children and Adults Sampled in Algeria
Abstract
1. Introduction
2. Materials and Methods
2.1. Stool Sample Collection and Participants’ Demographic Characteristics
2.2. Genomic DNA Extraction and Purification
2.3. Real-Time PCR
2.4. Molecular Typing
2.5. Sequence Analysis
2.6. Statistical Analysis
3. Results
3.1. Confirmation of Microscopy Results by Giardia-Specific Real-Time PCR
3.2. Assemblage-Specific Analysis
3.3. Allelic Sequence Heterozygosity (ASH)
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ryan, U.; Paparini, A.; Oskam, C. New Technologies for Detection of Enteric Parasites. Trends Parasitol. 2017, 33, 532–546. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feng, Y.; Xiao, L. Zoonotic potential and molecular epidemiology of Giardia species and giardiasis. Clin. Microbiol. Rev. 2011, 24, 110–140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoder, J.S.; Gargano, J.W.; Wallace, R.M.; Beach, M.J. Giardiasis Surveillance—United States, 2009–2010. MMWR Surveill. Summ. 2012, 61, 13–23. [Google Scholar] [PubMed]
- Ryan, U.; Cacciò, S.M. Zoonotic potential of Giardia. Int. J. Parasitol. 2013, 43, 943–956. [Google Scholar] [CrossRef] [Scilit]
- Einarsson, E.; Ma’ayeh, S.; Svärd, S.G. An up-date on Giardia and giardiasis. Curr. Opin. Microbiol. 2016, 34, 47–52. [Google Scholar] [CrossRef] [Scilit]
- Colli, C.M.; Bezagio, R.C.; Nishi, L.; Bignotto, T.S.; Ferreira, É.C.; Falavigna-Guilherme, A.L.; Gomes, M.L. Identical assemblage of Giardia duodenalis in humans, animals and vegetables in an urban area in Southern Brazil indicates a relationship among them. PLoS ONE 2015, 10, e0118065. [Google Scholar] [CrossRef] [Scilit]
- Andrews, R.H.; Adams, M.; Boreham, P.F.L.; Melonis, B.P. Giardia intestinalis: Electrophoretic Evidence for a Species Complex. Int. J. Parasitol. 1989, 19, 183–190. [Google Scholar] [CrossRef] [Scilit]
- Monis, P.T.; Caccio, S.M.; Thompson, R.C.A. Variation in Giardia: Towards a taxonomic revision of the genus. Trends Parasitol. 2009, 25, 93–100. [Google Scholar] [CrossRef] [Scilit]
- Helmy, Y.A.; Spierling, N.G.; Schmidt, S.; Rosenfeld, U.M.; Reil, D.; Imholt, C.; Jacob, J.; Ulrich, R.G.; Aebischer, T.; Klotz, C. Occurrence and distribution of Giardia species in wild rodents in Germany. Parasites Vectors 2018, 11, 213. [Google Scholar] [CrossRef] [Scilit]
- Ankarklev, J.; Svärd, S.G.; Lebbad, M. Allelic sequence heterozygosity in single Giardia parasites. BMC Microbiol. 2012, 12, 65. [Google Scholar] [CrossRef] [Scilit]
- Thompson, R.C.A.; Ash, A. Molecular epidemiology of Giardia and Cryptosporidium infections. Infect. Genet. Evol. 2016, 40, 315–323. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wegayehu, T.; Karim, M.R.; Erko, B.; Zhang, L.; Tilahun, G. Multilocus genotyping of Giardia duodenalis isolates from calves in Oromia Special Zone, Central Ethiopia. Infect. Genet. Evol. 2016, 43, 281–288. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zahedi, A.; Field, D.; Ryan, U. Molecular typing of Giardia duodenalis in humans in Queensland—First report of assemblage E. Parasitology 2017, 114, 1154–1161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cacciò, S.M.; Beck, R.; Lalle, M.; Marinculic, A.; Pozio, E. Multilocus genotyping of Giardia duodenalis reveals striking differences between assemblages A and B. Int. J. Parasitol. 2008, 38, 1523–1531. [Google Scholar] [CrossRef] [Scilit]
- Cacciò, S.M.; Thompson, R.C.A.; McLauchlin, J.; Smith, H.V. Unravelling Cryptosporidium and Giardia epidemiology. Trends Parasitol. 2005, 21, 430–437. [Google Scholar] [CrossRef] [Scilit]
- Koehler, A.V.; Jex, A.R.; Haydon, S.R.; Stevens, M.A.; Gasser, R.B. Giardia/giardiasis—A perspective on diagnostic and analytical tools. Biotechnol. Adv. 2014, 32, 280–289. [Google Scholar] [CrossRef] [Scilit]
- Sulaiman, I.M.; Fayer, R.; Bern, C.; Gilman, R.H.; Trout, J.M.; Schantz, P.M.; Das, P.; Lal, A.A.; Xiao, L. Triosephosphate Isomerase Gene Characterization and Potential Zoonotic Transmission of Giardia duodenalis. Emerg. Infect. Dis. 2003, 9, 1444–1452. [Google Scholar] [CrossRef] [Scilit]
- Vanni, I.; Cacciò, S.M.; van Lith, L.; Lebbad, M.; Svärd, S.G.; Pozio, E.; Tosini, F. Detection of Giardia duodenalis Assemblages A and B in Human Feces by Simple, Assemblage-Specific PCR Assays. PLoS Negl. Trop. Dis. 2012, 6, e1776. [Google Scholar] [CrossRef] [Scilit]
- Squire, S.A.; Ryan, U. Cryptosporidium and Giardia in Africa: Current and future challenges. Parasites Vectors 2017, 10, 195. [Google Scholar] [CrossRef] [Scilit]
- Lalle, M.; Bruschi, F.; Castagna, B.; Campa, M.; Pozio, E.; Cacciò, S.M. High genetic polymorphism among Giardia duodenalis isolates from Sahrawi children. Trans. R. Soc. Trop. Med. Hyg. 2009, 103, 834–838. [Google Scholar] [CrossRef] [Scilit]
- Rebih, N.; Boutaiba, S.; Aboualchamat, G.; Souttou, K.; Hakem, A.; Al Nahhas, S. Molecular and epidemiological characterization of Giardia intestinalis assemblages detected in Djelfa, Algeria. J. Parasit. Dis. 2020, 44, 281–288. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pipiková, J.; Papajová, I.; Majláthová, V.; Šoltys, J.; Bystrianska, J.; Schusterová, I.; Vargová, V. First report on Giardia duodenalis assemblage F in Slovakian children living in poor environmental conditions. J. Microbiol. Immunol. Infect. 2018, 53, 148–156. [Google Scholar] [CrossRef] [Scilit]
- Júlio, C.; Vilares, A.; Oleastro, M.; Ferreira, I.; Gomes, S.; Monteiro, L.; Nunes, B.; Tenreiro, R.; Ngelo, H. Prevalence and risk factors for Giardia duodenalis infection among children: A case study in Portugal. Parasites Vectors 2012, 5, 22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rudohradská, P.; Halánová, M.; Ravaszová, P.; Goldová, M.; Valenčáková, A.; Halán, M.; Papajová, I.; Pohorencová, A.; Valko, J.; Čisláková, L.; et al. Prevalence of intestinal parasites in children from minority group with low hygienic standards in Slovakia. Helminthologia 2012, 49, 63–66. [Google Scholar] [CrossRef] [Scilit]
- Belkessa, S.; Ait-Salem, E.; Laatamna, A.; Houali, K.; Sönksen, U.W.; Hakem, A.; Bouchene, Z.; Ghalmi, F.; Stensvold, C.R. Prevalence and Clinical Manifestations of Giardia intestinalis and Other Intestinal Parasites in Children and Adults in Algeria. Am. J. Trop. Med. Hyg. 2020. [Google Scholar] [CrossRef] [Scilit]
- Andersen, L.O.B.; Röser, D.; Nejsum, P.; Nielsen, H.V.; Stensvold, C.R. Is Supplementary Bead Beating for DNA Extraction from Nematode Eggs by Use of the NucliSENS easyMag Protocol Necessary? J. Clin. Microbiol. 2013, 51, 1345–1347. [Google Scholar] [CrossRef] [Scilit]
- Budding, A.E.; Grasman, M.E.; Lin, F.; Bogaards, J.A.; Soeltan-Kaersenhout, D.J.; Vandenbroucke-Grauls, C.M.J.E.; Van Bodegraven, A.A.; Savelkoul, P.H.M. IS-pro: High-throughput molecular fingerprinting of the intestinal microbiota. FASEB J. 2010, 24, 4556–4564. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Verweij, J.J.; Blange, R.A.; Templeton, K.; Schinkel, J.; Brienen, E.A.T.; Van Rooyen, M.A.A.; Van Lieshout, L.; Polderman, A.M. Simultaneous Detection of Entamoeba histolytica, Giardia lamblia, and Cryptosporidium parvum in Fecal Samples by Using Multiplex Real-Time PCR. J. Clin. Microbiol. 2004, 42, 1220–1223. [Google Scholar] [CrossRef] [Scilit]
- Akinkuotu, O.A.; Takeet, M.I.; Otesile, E.B.; Olufemi, F.; Greenwood, S.J.; McClure, J.T. Prevalence and mulilocus genotypes of Giardia duodenalis infecting pigs in Ogun state, Nigeria. Infect. Genet. Evol. 2019, 70, 53–60. [Google Scholar] [CrossRef] [Scilit]
- Akinkuotu, O.A.; Takeet, M.I.; Otesile, E.B.; Olufemi, F.; Greenwood, S.J.; McClure, J.T. Multi-locus genotyping and phylogenetic analyses of Giardia intestinalis isolates from indigenous goats in Ogun State, Nigeria. Acta Trop. 2019, 195, 15–22. [Google Scholar] [CrossRef] [Scilit]
- Xiao, L.; Feng, Y. Molecular epidemiologic tools for waterborne pathogens Cryptosporidium spp. and Giardia duodenalis. Food Waterborne Parasitol. 2017, 8, 14–32. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beyhan, Y.E.; Taş Cengız, Z. Comparison of microscopy, ELISA, and real-time PCR for detection of Giardia intestinalis in human stool specimens. Turkish J. Med. Sci. 2017, 47, 1295–1299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stensvold, C.R.; Nielsen, H.V. Comparison of microscopy and PCR for detection of intestinal parasites in Danish patients supports an incentive for molecular screening platforms. J. Clin. Microbiol. 2012, 50, 540–541. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Coppenraet, L.E.S.B.; Wallinga, J.A.; Ruijs, G.J.H.M.; Bruins, M.J.; Verweij, J.J. Parasitological diagnosis combining an internally controlled real-time PCR assay for the detection of four protozoa in stool samples with a testing algorithm for microscopy. Clin. Microbiol. Infect. 2009, 15, 869–874. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schuurman, T.; Lankamp, P.; van Belkum, A.; Kooistra-Smid, M.; van Zwet, A. Comparison of microscopy, real-time PCR and a rapid immunoassay for the detection of Giardia lamblia in human stool specimens. Clin. Microbiol. Infect. 2007, 13, 1186–1191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lebbad, M.; Petersson, I.; Karlsson, L.; Botero-Kleiven, S.; Andersson, J.O.; Svenungsson, B.; Svärd, S.G. Multilocus genotyping of human Giardia isolates suggests limited zoonotic transmission and association between assemblage B and flatulence in children. PLoS Negl. Trop. Dis. 2011, 5, e1262. [Google Scholar] [CrossRef] [Scilit]
- Sprong, H.; Cacciò, S.M.; Van Der Giessen, J.W.B. Identification of zoonotic genotypes of Giardia duodenalis. PLoS Negl. Trop. Dis. 2009, 3, e558. [Google Scholar] [CrossRef] [Scilit]
- Aguiar, J.M.; Silva, S.O.; dos Santos, V.A.; Taniwaki, S.A.; de Oliveira, T.M.F.S.; Ferreira, H.L.; Keid, L.B.; Gregori, F.; Soares, R.M. Evidence of heterozygosity and recombinant alleles in single cysts of Giardia duodenalis. Rev. Bras. Parasitol. Veterinária 2016, 25, 187–195. [Google Scholar] [CrossRef] [Scilit]
- Wielinga, C.M.; Thompson, R.C.A. Comparative evaluation of Giardia duodenalis sequence data. Parasitology 2007, 134, 1795–1821. [Google Scholar] [CrossRef] [Scilit]
- Wegayehu, T.; Karim, M.R.; Li, J.; Adamu, H.; Erko, B.; Zhang, L.; Tilahun, G. Multilocus genotyping of Giardia duodenalis isolates from children in Oromia Special Zone, central Ethiopia. BMC Microbiol. 2016, 16, 89. [Google Scholar] [CrossRef] [Scilit]
- Wielinga, C.; Ryan, U.; Andrew Thompson, R.C.; Monis, P. Multi-locus analysis of Giardia duodenalis intra-Assemblage B substitution patterns in cloned culture isolates suggests sub-Assemblage B analyses will require multi-locus genotyping with conserved and variable genes. Int. J. Parasitol. 2011, 41, 495–503. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lebbad, M.; Ankarklev, J.; Tellez, A.; Leiva, B.; Andersson, J.O.; Svärd, S. Dominance of Giardia assemblage B in León, Nicaragua. Acta Trop. 2008, 106, 44–53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gasparinho, C.; Ferreira, F.S.; Mayer, A.C.; Mirante, M.C.; Nery, S.V.; Santos-Reis, A.; Portugal-Calisto, D.; Brito, M. Molecular characterization of Giardia lamblia in children less than 5 years of age with diarrhoea attending the Bengo General Hospital, Angola. Trans. R. Soc. Trop. Med. Hyg. 2017, 111, 497–503. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ferreira, F.S.; Centeno-Lima, S.; Gomes, J.; Rosa, F.; Rosado, V.; Parreira, R.; Cravo, L.; Atouguia, J.; Távora Tavira, L. Molecular characterization of Giardia duodenalis in children from the Cufada Lagoon Natural Park, Guinea-Bissau. Parasitol. Res. 2012, 111, 2173–2177. [Google Scholar] [CrossRef] [Scilit] [PubMed]

| Assay | Oligonucleotides (Primer/Probe) | Assemblage | Primer and Probe Sequences (5′-3′) | PCR Product Size (bp) | Reference |
|---|---|---|---|---|---|
| Real-time PCR | Giardia-80F Giardia-127R | NA | For GACGGCTCAGGACAACGGTT Rev TTGCCAGCGGTGTCCG | 62 | [28] |
| Probe Giardia-105T | NA | FAM-CCCGCGGCGGTCCCTGCTAG-BHQ-1 | |||
| Assemblage-specific PCR | 4E1-HP | A B | For AAAGAGATAGTTCGCGATGTC Rev ATTAACAAACAGGGAGACGTATG For GAAGTCATCTCTGGGGCAAG Rev GAAGTCTAGATAAACGTGTCGG | 165 272 | [18] |
| tpi gene analysis | Giardia AL3543 Giardia AL3546 Giardia AL3544 Giardia AL3545 | All assemblages | For AAATIATGCCTGCTCGTCG Rev CAAACCTTITCCGCAAACC For CCCTTCATCGGIGGTAACTT Rev GTGGCCACCACICCCGTGCC | 605 530 | [17] |
| Study Population (N = 119) | Giardia-Positive (Real-Time PCR) | Assemblage A Positive/Typed Samples 1 | Assemblage B Positive/Typed Samples 1 |
|---|---|---|---|
| Children (N = 55) | 45/55 (82%) | 10/25 (40%) | 15/25 (60%) |
| Boys (n = 30) | 24/30 (80%) | 5/14 (36%) | 9/14 (64%) |
| Girls (n = 25) | 21/25 (84%) | 5/11 (45%) | 6/11 (55%) |
| Adults (N = 37) | 11/37 (30%) | 6/7 (86%) | 1/7 (14%) |
| Males (n = 23) | 5/23 (22%) | 3/3 (100%) | 0/3 (00%) |
| Females (n = 14) | 6/14 (43%) | 3/4 (75%) | 1/4 (25%) |
| Undetermined age (N = 27) | 24/27 (89%) | 6/16 (37%) | 10/16 (63%) |
| Males (n = 13) | 12/13 (92%) | 4/8 (50%) | 4/8 (50%) |
| Females (n = 9) | 9/9 (100%) | 1/6 (17%) | 5/6 (83%) |
| Unknown (n = 5) | 3/5 (60%) | 1/2 (50%) | 1/2 (50%) |
| TOTAL | 80/119 (67%) | 22/48 (46%) | 26/48 (54%) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Belkessa, S.; Thomas-Lopez, D.; Houali, K.; Ghalmi, F.; Stensvold, C.R. Molecular Characterization of Giardia duodenalis in Children and Adults Sampled in Algeria. Microorganisms 2021, 9, 54. https://doi.org/10.3390/microorganisms9010054
Belkessa S, Thomas-Lopez D, Houali K, Ghalmi F, Stensvold CR. Molecular Characterization of Giardia duodenalis in Children and Adults Sampled in Algeria. Microorganisms. 2021; 9(1):54. https://doi.org/10.3390/microorganisms9010054
Chicago/Turabian StyleBelkessa, Salem, Daniel Thomas-Lopez, Karim Houali, Farida Ghalmi, and Christen Rune Stensvold. 2021. "Molecular Characterization of Giardia duodenalis in Children and Adults Sampled in Algeria" Microorganisms 9, no. 1: 54. https://doi.org/10.3390/microorganisms9010054
APA StyleBelkessa, S., Thomas-Lopez, D., Houali, K., Ghalmi, F., & Stensvold, C. R. (2021). Molecular Characterization of Giardia duodenalis in Children and Adults Sampled in Algeria. Microorganisms, 9(1), 54. https://doi.org/10.3390/microorganisms9010054

