Bacterial Diversity and Antibiotic Susceptibility of Sparus aurata from Aquaculture
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Preparation
2.2. Bacterial Isolation and Identification
2.3. Antibiotic Susceptibility Testing
2.4. Statistical Analyses
2.5. Detection of Antibiotic Resistance Genes
3. Results
3.1. Bacterial Diversity in S. aurata Samples
3.2. Phenotypic Characterization of the Bacterial Strains
3.3. Genotypic Characterization
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Ottinger, M.; Clauss, K.; Kuenzer, C. Aquaculture: Relevance, distribution, impacts and spatial assessments—A review. Ocean Coast. Manag. 2016, 119, 244–266. [Google Scholar] [CrossRef] [Scilit]
- FAO Fisheries and Aquaculture Departement Fishery and Aquaculture Country Profiles. Portugal (2005). Country Profile Fact Sheets. Available online: http://www.fao.org/fishery/ (accessed on 20 July 2020).
- Direção-Geral de Recursos Naturais Segurança e Serviços Marítimos. Plano Estratégico para a Aquicultura Portuguesa 2014-2020; Direção-Geral de Recursos Naturais Segurança e Serviços Marítimos: Lisbon, Portugal, 2013. [Google Scholar]
- Martins, R.; Carneiro, M. Manual de Identificação de Peixes Ósseos da costa Continental Portuguesa—Principais Característica Diagnosticantes; Portuguese Institute for the Sea and Atmosphere: Lisbon, Portugal, 2018; ISBN 9789729083198. [Google Scholar]
- Heather, F.J.; Childs, D.Z.; Darnaude, A.M.; Blanchard, J.L. Using an integral projection model to assess the effect of temperature on the growth of gilthead seabream Sparus aurata. PLoS ONE 2018, 13, e0196092. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cabello, F.C.; Godfrey, H.P.; Tomova, A.; Ivanova, L.; Dölz, H.; Millanao, A.; Buschmann, A.H. Antimicrobial use in aquaculture re-examined: Its relevance to antimicrobial resistance and to animal and human health. Environ. Microbiol. 2013, 15, 1917–1942. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rodgers, C.J.; Furones, M.D. Antimicrobial agents in aquaculture: Practice, needs and issues. Options Méditerranéennes Série A Séminaires Méditerranéens 41–59. [CrossRef]
- Santos, L.; Ramos, F. Antimicrobial resistance in aquaculture: Current knowledge and alternatives to tackle the problem. Int. J. Antimicrob. Agents 2018, 52, 135–143. [Google Scholar] [CrossRef] [Scilit]
- Adeogun, A.O.; Ibor, O.R.; Onoja, A.B.; Arukwe, A. Fish condition factor, peroxisome proliferator activated receptors and biotransformation responses in Sarotherodon melanotheron from a contaminated freshwater dam (Awba Dam) in Ibadan, Nigeria. Mar. Environ. Res. 2016, 121, 74–86. [Google Scholar] [CrossRef] [Scilit]
- International Standard. Microbiology of the Food Chain—Preparation of Test Samples, Initial Suspension and Decimal Dilutions for Microbiological Examination—Part 1: General Rules for the Preparation of the Initial Suspension and Decimal Dilutions, 2nd ed.; ISO copyright office: Geneva, Switzerland, 2017. [Google Scholar]
- International Standard. Microbiology of the Food Chain—Preparation of Test Samples, Initial Suspension and Decimal Dilutions for Microbiological Examination—Part 3: Specific Rules for the Preparation of Fish and Fishery Products, 2nd ed.; ISO copyright office: Geneva, Switzerland, 2017. [Google Scholar]
- Jones-Dias, D.; Manageiro, V.; Caniça, M. Influence of agricultural practice on mobile bla genes: IncI1-bearing CTX-M, SHV, CMY and TEM in Escherichia coli from intensive farming soils. Environ. Microbiol. 2016, 18, 260–272. [Google Scholar] [CrossRef] [Scilit]
- EFSA Panel on Biological Hazards (BIOHAZ). Scientific Opinion on the public health risks of bacterial strains producing extended-spectrum β-lactamases and/or AmpC β-lactamases in food and food-producing animals. EFSA J. 2011, 9, 2322. [Google Scholar] [CrossRef] [Scilit]
- EFSA Panel on Biological Hazards (BIOHAZ). Scientific Opinion on Carbapenem resistance in food animal ecosystems. EFSA J. 2013, 11, 3501. [Google Scholar] [CrossRef] [Scilit]
- Schwarz, S.; Silley, P.; Simjee, S.; Woodford, N.; van Duijkeren, E.; Johnson, A.P.; Gaastra, W. Assessing the antimicrobial susceptibility of bacteria obtained from animals. Vet. Microbiol. 2010, 141, 1–4. [Google Scholar] [CrossRef] [Scilit]
- Dean, A.G.; Sullivan, K.M.; Soe, M.M. OpenEpi: Open Source Epidemiologic Statistics for Public Health. Available online: www.OpenEpi.com (accessed on 29 July 2020).
- Dallenne, C.; Da Costa, A.; Decre, D.; Favier, C.; Arlet, G. Development of a set of multiplex PCR assays for the detection of genes encoding important beta-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010, 65, 490–495. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mendonça, N.; Leitão, J.; Manageiro, V.; Ferreira, E.; Caniça, M. Spread of extended-spectrum β-lactamase CTX-M-producing Escherichia coli clinical isolates in community and nosocomial environments in Portugal. Antimicrob. Agents Chemother. 2007, 51, 1946–1955. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fallah, F.; Borhan, R.S.; Hashemi, A. Detection of bla(IMP) and bla(VIM) metallo-β-lactamases genes among Pseudomonas aeruginosa strains. Int. J. Burns Trauma 2013, 3, 122–124. [Google Scholar] [PubMed]
- Khudhair, A.M.; Saadallah, S.; Al-faham, M. Isolation of Multi Antibiotic Resistance Serratia marcescens and the Detection of AmpC & GESβL Genes by Polymerase Chain Reaction Technique. Int. Assoc. Jungian Stud. 2011, 22, 329–346. [Google Scholar]
- Manageiro, V.; Ferreira, E.; Caniça, M.; Manaia, C. GES-5 among the beta-lactamases detected in ubiquitous bacteria isolated from aquatic environment samples. FEMS Microbiol. Lett. 2014, 351, 64–69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rodríguez-Martínez, J.-M.; Poirel, L.; Nordmann, P. Molecular Epidemiology and Mechanisms of Carbapenem Resistance in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 2009, 53, 4783–4788. [Google Scholar] [CrossRef] [Scilit]
- Shoja, S.; Moosavian, M.; Peymani, A.; Tabatabaiefar, M.A. Genotyping of carbapenem resistant Acinetobacter baumannii isolated from tracheal tube discharge of hospitalized patients in intensive care. Iran. J. Microbiol. 2013, 5, 315–322. [Google Scholar]
- Chen, X.; Zhang, W.; Pan, W.; Yin, J.; Pan, Z.; Gao, S.; Jiao, X. Prevalence of qnr, aac(6’)-Ib-cr, qepA, and oqxAB in Escherichia coli Isolates from Humans, Animals, and the Environment. Antimicrob. Agents Chemother. 2012, 56, 3423–3427. [Google Scholar] [CrossRef] [Scilit]
- Ellington, M.J.; Hope, R.; Turton, J.F.; Warner, M.; Woodford, N.; Livermore, D.M. Detection of qnrA among Enterobacteriaceae from South-East England with extended-spectrum and high-level AmpC beta-lactamases. J. Antimicrob. Chemother. 2007, 60, 1176–1178. [Google Scholar] [CrossRef] [Scilit]
- Jones-dias, D.; Manageiro, V.; Francisco, A.P.; Martins, A.P.; Domingues, G.; Louro, D.; Ferreira, E.; Caniça, M. Assessing the molecular basis of transferable quinolone resistance in Escherichia coli and Salmonella spp. from food-producing animals and food products. Vet. Microbiol. 2013, 167, 523–531. [Google Scholar] [CrossRef] [Scilit]
- Robicsek, A.; Strahilevitz, J.; Sahm, D.F.; Jacoby, G.; Hooper, D.C. qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob. Agents Chemother. 2006, 50, 2872–2874. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, J.J.; Ko, W.C.; Tsai, S.H.; Yan, J.J. Prevalence of plasmid-mediated quinolone resistance determinants QnrA, QnrB, and QnrS among clinical isolates of Enterobacter cloacae in a Taiwanese hospital. Antimicrob. Agents Chemother. 2007, 51, 1223–1227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ahmed, A.M.; Miyoshi, S.; Shinoda, S.; Shimamoto, T. Molecular characterization of a multidrug-resistant strain of enteroinvasive Escherichia coli O164 isolated in Japan. J. Med. Microbiol. 2005, 54, 273–278. [Google Scholar] [CrossRef] [Scilit]
- Everett, M.J.; Jin, Y.U.F.; Ricci, V.; Piddock, L.J. V Contributions of Individual Mechanisms to Fluoroquinolone Resistance in 36 Escherichia coli Strains Isolated from Humans and Animals. Antimicrob. Agents Chemother. 1996, 40, 2380–2386. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mammeri, H.; Van De Loo, M.; Poirel, L.; Martinez-martinez, L.; Nordmann, P. Emergence of Plasmid-Mediated Quinolone Resistance in Escherichia coli in Europe. Antimicrob. Agents Chemother. 2005, 49, 71–76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rebelo, A.R.; Bortolaia, V.; Kjeldgaard, J.S.; Pedersen, S.K.; Leekitcharoenphon, P.; Hansen, I.M.; Guerra, B.; Malorny, B.; Borowiak, M.; Hammerl, J.A. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. Eurosurveillance 2018, 23, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Pajić, M.J.; Rašić, Z.B.; Velebit, B.M.; Boboš, S.F.; Mihajlović-ukropina, M.M.; Radinović, M.Ž.; Galfi, A.L.; Petković, J.M.; Trojačanec, S.I. The prevalence of methicillin resistance and Panton-Valentine leukocidin synthesis genes in Staphylococcus aureus isolates of bovine and human origin. Vet. Arch. 2014, 84, 205–214. [Google Scholar]
- Han, Q.F.; Zhao, S.; Zhang, X.R.; Wang, X.L.; Song, C.; Wang, S.G. Distribution, combined pollution and risk assessment of antibiotics in typical marine aquaculture farms surrounding the Yellow Sea, North China. Environ. Int. 2020, 138, 105551. [Google Scholar] [CrossRef] [Scilit]
- Kang, C.; Shin, Y.; Kim, W.; Kim, Y.; Song, K.; Oh, E.; Kim, S.; Yu, H.; So, J. Prevalence and antimicrobial susceptibility of Vibrio parahaemolyticus isolated from oysters in Korea. Environ. Sci. Pollut. Res. 2016, 23, 918–926. [Google Scholar] [CrossRef] [Scilit]
- Ng, C.; Chen, H.; Goh, S.G.; Haller, L.; Wu, Z.; Charles, F.R.; Trottet, A.; Gin, K. Microbial water quality and the detection of multidrug resistant E. coli and antibiotic resistance genes in aquaculture sites of Singapore. Mar. Pollut. Bull. 2018, 135, 475–480. [Google Scholar] [CrossRef] [Scilit]
- Pereira, A.M.P.T.; Silva, L.J.G.; Meisel, L.M.; Pena, A. Fluoroquinolones and Tetracycline Antibiotics in a Portuguese Aquaculture System and Aquatic Surroundings: Occurrence and Environmental Impact. J. Toxicol. Environ. Heal. Part A Curr. Issues 2015, 78, 959–975. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Scarano, C.; Piras, F.; Virdis, S.; Ziino, G.; Nuvoloni, R.; Dalmasso, A.; De Santis, E.P.L.; Spanu, C. Antibiotic resistance of Aeromonas ssp. strains isolated from Sparus aurata reared in Italian mariculture farms. Int. J. Food Microbiol. 2018, 284, 91–97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tajbakhsh, E.; Khamesipour, F.; Ranjbar, R.; Ugwu, I.C. Prevalence of class 1 and 2 integrons in multi—Drug resistant Escherichia coli isolated from aquaculture water in Chaharmahal Va Bakhtiari province, Iran. Ann. Clin. Microbiol. Antimicrob. 2015, 14, 2–6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Bruijn, I.; Liu, Y.; Wiegertjes, G.F.; Raaijmakers, J.M. Exploring fish microbial communities to mitigate emerging diseases in aquaculture. FEMS Microbiol. Ecol. 2018, 94, fix161. [Google Scholar] [CrossRef] [Scilit]
- Pujalte, M.J.; Sitjà-Bobadilla, A.; Álvarez-Pellitero, P.; Garay, E. Carriage of potentially fish-pathogenic bacteria in Sparus aurata cultured in Mediterranean fish farms. Dis. Aquat. Organ. 2003, 54, 119–126. [Google Scholar] [CrossRef] [Scilit]
- Pȩkala-Safińska, A. Contemporary threats of bacterial infections in freshwater fish. J. Vet. Res. 2018, 62, 261–267. [Google Scholar] [CrossRef] [Scilit]
- Lalucat, J.; Bennasar, A.; Bosch, R.; Garcia-Valdes, E.; Palleroni, N.J. Biology of Pseudomonas stutzeri. Microbiol. Mol. Biol. Rev. 2006, 70, 510–547. [Google Scholar] [CrossRef] [Scilit]
- Cho, C.H.; Lee, S.B. Comparison of clinical characteristics and antibiotic susceptibility between Pseudomonas aeruginosa and P. putida keratitis at a tertiary referral center: A retrospective study. BMC Ophthalmol. 2018, 18, 3–9. [Google Scholar] [CrossRef] [Scilit]
- Halabi, Z.; Mocadie, M.; El Zein, S.; Kanj, S.S. Pseudomonas stutzeri prosthetic valve endocarditis: A case report and review of the literature. J. Infect. Public Health 2019, 12, 434–437. [Google Scholar] [CrossRef] [Scilit]
- Ouchenir, L.; Renaud, C.; Khan, S.; Bitnun, A.; Boisvert, A.A.; McDonald, J.; Bowes, J.; Brophy, J.; Barton, M.; Ting, J.; et al. The epidemiology, management, and outcomes of bacterial meningitis in infants. Pediatrics 2017, 140. [Google Scholar] [CrossRef] [Scilit]
- Raphael, E.; Riley, L.W. Infections caused by antimicrobial drug-resistant saprophytic Gram-negative bacteria in the environment. Front. Med. 2017, 4, 183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoshino, Y.; Kitazawa, T.; Kamimura, M.; Tatsuno, K.; Ota, Y.; Yotsuyanagi, H. Pseudomonas putida bacteremia in adult patients: Five case reports and a review of the literature. J. Infect. Chemother. 2011, 17, 278–282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adrian, T.-G.-S.; Tan, P.-W.; Chen, J.-W.; Yin, W.-F.; Chan, K.-G. Draft Genome Sequence of Kocuria rhizophila strain TPW45, an Actinobacterium Isolated from Freshwater. J. Genom. 2016, 4, 16–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Purty, S.; Saranathan, R.; Prashanth, K.; Narayanan, K.; Asir, J.; Devi, C.S.; Amarnath, S.K. The expanding spectrum of human infections caused by Kocuria species: A case report and literature review. Emerg. Microbes Infect. 2013, 2, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Yuan, M.; Yu, Y.; Li, H.R.; Dong, N.; Zhang, X.H. Phylogenetic diversity and biological activity of actinobacteria isolated from the chukchi shelf marine sediments in the arctic ocean. Mar. Drugs 2014, 12, 1281–1297. [Google Scholar] [CrossRef] [Scilit]
- Yun, J.H.; Roh, S.W.; Jung, M.J.; Kim, M.S.; Park, E.J.; Shin, K.S.; Nam, Y.-D.; Bae, J.W. Kocuria salsicia sp. nov., isolated from salt-fermented seafood. Int. J. Syst. Evol. Microbiol. 2011, 61, 286–289. [Google Scholar] [CrossRef] [Scilit]
- Mehrabadi, J.F.; Mirzaie, A.; Ahangar, N.; Rahimi, A.; Rokni-zadeh, H. Draft Genome Sequence of Kocuria rhizophila RF, a Radiation-Resistant Soil Isolate. Genome 2016, 4, 4–5. [Google Scholar] [CrossRef] [Scilit]
- Moissenet, D.; Becker, K.; Mérens, A.; Ferroni, A.; Dubern, B.; Vu-Thien, H. Persistent bloodstream infection with Kocuria rhizophila related to a damaged central catheter. J. Clin. Microbiol. 2012, 50, 1495–1498. [Google Scholar] [CrossRef] [Scilit]
- Das, A.; Behera, B.K.; Acharya, S.; Paria, P.; Chakraborty, H.J.; Parida, P.K.; Das, B.K. Genetic diversity and multiple antibiotic resistance index study of bacterial pathogen, Klebsiella pneumoniae strains isolated from diseased Indian major carps. Folia Microbiol. 2019, 64, 875–887. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rahman, M.; Rahman, M.; Deb, S.C.; Alam, S. Molecular Identification of Multiple Antibiotic Resistant Fish Pathogenic Enterococcus faecalis and their Control by Medicinal Herbs. Sci. Rep. 2017, 7, 1–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Regecová, I.; Pipová, M.; Jevinová, P.; Marušková, K.; Kmeť, V.; Popelka, P. Species identification and antimicrobial resistance of coagulase-negative staphylococci isolated from the meat of sea fish. J. Food Sci. 2014, 79, M898–M902. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thillai Sekar, V.; Santiago, T.C.; Vijayan, K.K.; Alavandi, S.V.; Stalin Raj, V.; Rajan, J.J.S.; Sanjuktha, M.; Kalaimani, N. Involvement of Enterobacter cloacae in the mortality of the fish, Mugil cephalus. Lett. Appl. Microbiol. 2008, 46, 667–672. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Walczak, N.; Puk, K.; Guz, L. Bacterial flora associated with diseased freshwater ornamental fish. J. Vet. Res. 2017, 61, 445–449. [Google Scholar] [CrossRef] [Scilit]
- Akbari, M.; Bakhshi, B.; Peerayeh, S.N. Particular Distribution of Enterobacter cloacae Strains Isolated from Urinary Tract Infection within Clonal Complexes. Iran. Biomed. J. 2016, 20, 49–55. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McCoy, E.; Morrison, J.; Cook, V.; Johnston, J.; Eblen, D.; Guo, C. Foodborne Agents Associated with the Consumption of Aquaculture Catfish. J. Food Prot. 2011, 74, 500–516. [Google Scholar] [CrossRef] [Scilit]
- Savini, V.; Catavitello, C.; Bianco, A.; Balbinot, A.; Antonio, D.D. Epidemiology, Pathogenicity and Emerging Resistances in Staphylococcus pasteuri: From Mammals and Lampreys, to Man. Recent Pat. Antiinfect. Drug Discov. 2009, 4, 123–129. [Google Scholar] [CrossRef] [Scilit]
- Anderson, A.C.; Jonas, D.; Huber, I.; Karygianni, L.; Wölber, J.; Hellwig, E.; Arweiler, N.; Vach, K.; Wittmer, A.; Al-ahmad, A. Enterococcus faecalis from Food, Clinical Specimens, and Oral Sites: Prevalence of Virulence Factors in Association with Biofilm Formation. Front. Microbiol. 2016, 6, 1534. [Google Scholar] [CrossRef] [Scilit]
- Delshad, S.T.; Soltanian, S.; Sharifiyazdi, H.; Haghkhah, M.; Bossier, P. Identification of N-acyl homoserine lactone-degrading bacteria isolated from rainbow trout (Oncorhynchus mykiss). J. Appl. Microbiol. 2018, 125, 356–369. [Google Scholar] [CrossRef] [Scilit]
- Sousa, M.; Torres, C.; Barros, J.; Somalo, S.; Igrejas, G.; Poeta, P. Gilthead seabream (Sparus aurata) as carriers of SHV-12 and TEM-52 extended-spectrum beta-lactamases-containing Escherichia coli isolates. Foodborne Pathog. Dis. 2011, 8, 1139–1141. [Google Scholar] [CrossRef] [Scilit]
- Srisapoome, P.; Areechon, N. Efficacy of viable Bacillus pumilus isolated from farmed fish on immune responses and increased disease resistance in Nile tilapia (Oreochromis niloticus): Laboratory and on-farm trials. Fish Shellfish Immunol. 2017, 67, 199–210. [Google Scholar] [CrossRef] [Scilit]
- Bottone, E.J. Bacillus cereus, a Volatile Human Pathogen. Clin. Microbiol. Rev. 2010, 23, 382–398. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clements, A.; Young, J.C.; Constantinou, N.; Frankel, G. Infection strategies of enteric pathogenic Escherichia coli. Gut Microbes 2012, 3, 71–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dyabi, F.Z.; Bennaoui, F.; Slitine, N.E.I.; Soraa, N.; Maoulainine, F.M. Enterobacter hormaechei: New Neonatal Infection in Morocco. Open Infect. Dis. J. 2018, 10, 147–150. [Google Scholar] [CrossRef] [Scilit]
- Interaminense, J.A.; Nascimento, D.C.O.; Ventura, R.F.; Batista, J.E.C.; Souza, M.M.C.; Hazin, F.H.V.; Pontes-Filho, N.T.; Lima-Filho, J. V Recovery and screening for antibiotic susceptibility of potential bacterial pathogens from the oral cavity of shark species involved in attacks on humans in Recife, Brazil. J. Med. Microbiol. 2010, 59, 941–947. [Google Scholar] [CrossRef] [Scilit]
- Keren, Y.; Keshet, D.; Eidelman, M.; Geffen, Y.; Raz-pasteur, A.; Hussein, K. Is Leclercia adecarboxylata a New and Unfamiliar Marine Pathogen? J. Clin. Microbiol. 2014, 52, 1775–1776. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tam, V.; Nayak, S. Isolation of Leclercia adecarboxylata from a wound infection after exposure to hurricane-related floodwater. BMJ Case Rep. 2012, 1–3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Di Lodovico, S.; Cataldi, V.; Di Campli, E.; Ancarani, E.; Cellini, L.; Giulio, M.D. Enterococcus hirae biofilm formation on hospital material surfaces and effect of new biocides. Environ. Health Prev. Med. 2017, 22, 63. [Google Scholar] [CrossRef] [Scilit]
- Ccorahua-Santo, R.; Cervantes, M.; Duran, Y.; Aguirre, M.; Marin, C.; Ramírez, P. Draft genome sequence of Klebsiella michiganensis 3T412C, harboring an arsenic resistance genomic island, isolated from mine tailings in Peru. Genome Announc. 2017, 5, 5–6. [Google Scholar] [CrossRef] [Scilit]
- Heinle, C.E.; Junqueira, A.C.M.; Uchida, A.; Purbojati, R.W.; Houghton, J.N.I.; Chénard, C.; Drautz-Moses, D.I.; Wong, A.; Kolundžija, S.; Clare, M.E.; et al. Complete genome sequence of Lelliottia nimipressuralis type strain SGAir0187, isolated from tropical air collected in Singapore. Genome Announc. 2018, 6, 1–2. [Google Scholar] [CrossRef] [Scilit]
- Kämpfer, P.; Glaeser, S.P.; Packroff, G.; Behringer, K.; Exner, M.; Chakraborty, T.; Schmithausen, R.M.; Doijad, S. Lelliottia aquatilis sp. Nov., isolated from drinking water. Int. J. Syst. Evol. Microbiol. 2018, 68, 2454–2461. [Google Scholar] [CrossRef] [Scilit]
- Mitra, S.; Pramanik, K.; Ghosh, P.K.; Soren, T.; Sarkar, A.; Dey, R.S.; Pandey, S.; Maiti, T.K. Characterization of Cd-resistant Klebsiella michiganensis MCC3089 and its potential for rice seedling growth promotion under Cd stress. Microbiol. Res. 2018, 210, 12–25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Palmer, M.; de Maayer, P.; Poulsen, M.; Steenkamp, E.T.; van Zyl, E.; Coutinho, T.A.; Venter, S.N. Draft genome sequences of Pantoea agglomerans and Pantoea vagans isolates associated with termites. Stand. Genom. Sci. 2016, 11. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.S.; Liu, J.M.; Sun, J.; Sun, Y.F.; Liu, J.N.; Jia, N.; Fan, B.; Dai, X.F. Diversity of culture-independent bacteria and antimicrobial activity of culturable endophytic bacteria isolated from different Dendrobium stems. Sci. Rep. 2019, 9, 1–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qiao, Y.; Peng, Q.; Yan, J.; Wang, H.; Ding, H.; Shi, B. Gene cloning and enzymatic characterization of alkali-tolerant type I pullulanase from Exiguobacterium acetylicum. Lett. Appl. Microbiol. 2014, 60, 52–59. [Google Scholar] [CrossRef] [Scilit]
- Keynan, Y.; Weber, G.; Sprecher, H. Molecular identification of Exiguobacterium acetylicum as the aetiological agent of bacteraemia. J. Med. Microbiol. 2007, 56, 563–564. [Google Scholar] [CrossRef] [Scilit]
- Seiffert, S.N.; Wüthrich, D.; Gerth, Y.; Egli, A. First clinical case of KPC-3—Producing Klebsiella michiganensis in Europe. New Microbes New Infect. 2019, 29, 100516. [Google Scholar] [CrossRef] [Scilit]
- Sekyere, J.O.; Amoako, D.G. Genomic and phenotypic characterisation of fluoroquinolone resistance mechanisms in Enterobacteriaceae in Durban, South Africa. PLoS ONE 2017, 12, e0178888. [Google Scholar] [CrossRef] [Scilit]
- Zheng, B.; Xu, H.; Yu, X.; Lv, T.; Jiang, X.; Cheng, H.; Zhang, J.; Chen, Y.; Huang, C.; Xiao, Y. Identification and genomic characterization of a KPC-2-, NDM-1- and NDM-5-producing Klebsiella michiganensis isolate. J. Antimicrob. Chemother. 2018, 73, 536–538. [Google Scholar] [CrossRef] [Scilit]
- Leal-Negredo, Á.; Castelló-Abietar, C.; Leiva, P.S.; Fernández, J. Infección urinaria por Lelliottia amnigena (Enterobacter amnigenus): Un patógeno infrecuente. Rev. Española Quimioter. 2017, 30, 483–484. [Google Scholar]
- Xu, L.; Yin, M.; Zhu, T.; Liu, Y.; Ying, Y.; Lu, J.; Lin, C.; Ying, J.; Xu, T.; Ni, L.; et al. Comparative Genomics Analysis of Plasmid pPV989-94 from a Clinical Isolate of Pantoea vagans PV989. Int. J. Genom. 2018, 2018, 1242819. [Google Scholar] [CrossRef] [Scilit]
- Barros, J.; Andrade, M.; Radhouani, H.; López, M.; Igrejas, G.; Poeta, P.; Torres, C. Detection of vanA-containing Enterococcus species in faecal microbiota of gilthead seabream (Sparus aurata). Microbes Environ. 2012, 27, 509–511. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cardozo, M.V.; Borges, C.A.; Beraldo, L.G.; Maluta, R.P.; Pollo, A.S.; Borzi, M.M.; dos Santos, L.F.; Kariyawasam, S.; Ávila, F.A. de Shigatoxigenic and atypical enteropathogenic Escherichia coli in fish for human consumption. Braz. J. Microbiol. 2018, 49, 936–941. [Google Scholar] [CrossRef] [Scilit]
- Adnan, M.; Patel, M.; Hadi, S. Functional and health promoting inherent attributes of Enterococcus hirae F2 as a novel probiotic isolated from the digestive tract of the freshwater fish Catla catla. PeerJ 2017, 2017, e3085. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jinendiran, S.; Boopathi, S.; Sivakumar, N.; Selvakumar, G. Functional Characterization of Probiotic Potential of Novel Pigmented Bacterial Strains for Aquaculture Applications. Probiotics Antimicrob. Proteins 2019, 11, 186–197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adelowo, O.O.; Caucci, S.; Banjo, O.A.; Nnanna, O.C.; Awotipe, E.O.; Peters, F.B.; Fagade, O.E.; Berendonk, T.U. Extended Spectrum Beta-Lactamase (ESBL)-producing bacteria isolated from hospital wastewaters, rivers and aquaculture sources in Nigeria. Environ. Sci. Pollut. Res. 2018, 25, 2744–2755. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Almeida, M.V.A.; Cangussú, Í.M.; Carvalho, A.L.S.; Brito, I.L.P.; Costa, R.A. Drug resistance, AmpC-β-lactamase and ESBL producing Enterobacteriaceae isolated from fish and shrimp. Rev. Inst. Med. Trop. Sao Paulo 2017, 59, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Cheng, H.; Jiang, H.; Fang, J.; Zhu, C. Antibiotic Resistance and Characteristics of Integrons in Escherichia coli Isolated from Penaeus vannamei at a Freshwater Shrimp Farm in Zhejiang Province, China. J. Food Prot. 2019, 82, 470–478. [Google Scholar] [CrossRef] [Scilit]
- Resende, J.A.; Silva, V.L.; Fontes, C.O.; Souza-Filho, J.A.; Oliveira, T.L.R.; Coelho, C.M.; César, D.E.; Diniz, C.G. Multidrug-Resistance and Toxic Metal Tolerance of Medically Important Bacteria Isolated from an Aquaculture System. Microbes Environ. 2012, 27, 449–455. [Google Scholar] [CrossRef] [Scilit]
- Codjoe, F.; Donkor, E. Carbapenem Resistance: A Review. Med. Sci. 2017, 6, 1. [Google Scholar] [CrossRef] [Scilit]
- Jacoby, G.A. AmpC Beta-Lactamases. Clin. Microbiol. Rev. 2009, 22, 161–182. [Google Scholar] [CrossRef] [Scilit]
- Papp-Wallace, K.M.; Endimiani, A.; Taracila, M.A.; Bonomo, R.A. Carbapenems: Past, present, and future. Antimicrob. Agents Chemother. 2011, 55, 4943–4960. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nordkvist, E.; Zuidema, T.; Herbes, R.G.; Berendsen, B.J.A. Occurrence of chloramphenicol in cereal straw in north-western Europe. Food Addit. Contam. Part A Chem. Anal. Control. Expo. Risk Assess. 2016, 33, 798–803. [Google Scholar] [CrossRef] [Scilit]
- Nguyen, H.N.K.; Van, T.T.H.; Nguyen, H.T.; Smooker, P.M.; Shimeta, J.; Coloe, P.J. Molecular characterization of antibiotic resistance in Pseudomonas and Aeromonas isolates from catfish of the Mekong Delta, Vietnam. Vet. Microbiol. 2014, 171, 397–405. [Google Scholar] [CrossRef] [Scilit]
- Adewoye, L.; Topp, E.; Li, X.-Z. Antimicrobial Drug Efflux Genes and Pumps in Bacteria of Animal and Environmental Origin. In Efflux-Mediated Antimicrobial Resistance in Bacteria; Li, X., Elkins, C., Zgurskaya, H., Eds.; Adis: Cham, Switzerland, 2016; pp. 561–593. ISBN 978-3-319-39658-3. [Google Scholar]
- Muziasari, W.I.; Pärnänen, K.; Johnson, T.A.; Lyra, C.; Karkman, A.; Stedtfeld, R.D.; Tamminen, M.; Tiedje, J.M.; Virta, M. Aquaculture changes the profile of antibiotic resistance and mobile genetic element associated genes in Baltic Sea sediments. FEMS Microbiol. Ecol. 2016, 92, fiw052. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miranda, C.D.; Godoy, F.A.; Lee, M.R. Current status of the use of antibiotics and the antimicrobial resistance in the chilean salmon farms. Front. Microbiol. 2018, 9, 1284. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Higuera-Llantén, S.; Vásquez-Ponce, F.; Barrientos-Espinoza, B.; Mardones, F.O.; Marshall, S.H.; Olivares-Pacheco, J. Extended antibiotic treatment in salmon farms select multiresistant gut bacteria with a high prevalence of antibiotic resistance genes. PLoS ONE 2018, 13, e0203641. [Google Scholar] [CrossRef] [Scilit]
- Syrova, E.; Kohoutova, L.; Dolejska, M.; Papezikova, I.; Kutilova, I.; Cizek, A.; Navratil, S.; Minarova, H.; Palikova, M. Antibiotic resistance and virulence factors in mesophilic Aeromonas spp. from Czech carp fisheries. J. Appl. Microbiol. 2018, 125, 1702–1713. [Google Scholar] [CrossRef] [Scilit]
- Mata, W.; Putita, C.; Dong, H.T.; Kayansamruaj, P.; Senapin, S.; Rodkhum, C. Quinolone-resistant phenotype of Flavobacterium columnare isolates harbouring point mutations both in gyrA and parC but not in gyrB or parE. J. Glob. Antimicrob. Resist. 2018, 15, 55–60. [Google Scholar] [CrossRef] [Scilit]
- Hossain, S.; De Silva, B.C.J.; Wickramanayake, M.V.K.S.; Dahanayake, P.S.; Wimalasena, S.H.M.P.; Heo, G.J. Incidence of antimicrobial resistance genes and class 1 integron gene cassettes in multidrug-resistant motile Aeromonas sp. isolated from ornamental guppy (Poecilia reticulata). Lett. Appl. Microbiol. 2019, 69, 2–10. [Google Scholar] [CrossRef] [Scilit]
- Jiang, H.; Tang, D.; Liu, Y.; Zhang, X.; Zeng, Z.; Xu, L.; Hawkey, P.M. Prevalence and characteristics of beta-lactamase and plasmid-mediated quinolone resistance genes in Escherichia coli isolated from farmed fish in China. J. Antimicrob. Chemother. 2012, 67, 2350–2353. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chenia, H.Y. Prevalence and characterization of plasmid-mediated quinolone resistance genes in Aeromonas spp. isolated from South African freshwater fish. Int. J. Food Microbiol. 2016, 231, 26–32. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hordijk, J.; Bosman, A.B.; van Essen-Zandbergen, A.; Veldman, K.; Dierikx, C.; Wagenaar, J.A.; Mevius, D. qnrB19 Gene Bracketed by IS26 on a 40-Kilobase IncR Plasmid from an Escherichia coli Isolate from a Veal Calf. Antimicrob. Agents Chemother. 2011, 55, 453–454. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martins, W.M.B.S.; Almeida, A.C.S.; Nicoletti, A.G.; Cayô, R.; Gales, A.C.; Alves, L.C.; Brayner, F.B.; Vilela, M.A.; Morais, M.M.C. Coproduction of KPC-2 and QnrB19 in Klebsiella pneumoniae ST340 isolate in Brazil. Diagn. Microbiol. Infect. Dis. 2015, 83, 375–376. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Richter, S.N.; Frasson, I.; Bergo, C.; Manganelli, R.; Cavallaro, A.; Palù, G. Characterisation of qnr plasmid-mediated quinolone resistance in Enterobacteriaceae from Italy: Association of the qnrB19 allele with the integron element ISCR1 in Escherichia coli. Int. J. Antimicrob. Agents 2012, 35, 578–583. [Google Scholar] [CrossRef] [Scilit]
- Moreno-Switt, A.I.; Pezoa, D.; Sepúlveda, V.; González, I.; Rivera, D.; Retamal, P.; Navarrete, P.; Reyes-Jara, A.; Toro, M. Transduction as a Potential Dissemination Mechanism of a Clonal qnrB19 -Carrying Plasmid Isolated From Salmonella of Multiple Serotypes and Isolation Sources. Front. Microbiol. 2019, 10, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Araújo, B.F.; De Campos, P.A.; Royer, S.; Ferreira, M.L.; Gonçalves, I.R.; Resende, D.S.; De Brito, C.S.; Gontijo-filho, P.P.; Ribas, R.M. High frequency of the combined presence of QRDR mutations and PMQR determinants in multidrug-resistant Klebsiella pneumoniae and Escherichia coli isolates from nosocomial and community-acquired infections. J. Med. Microbiol. 2017, 66, 1144–1150. [Google Scholar] [CrossRef] [Scilit]
- Minarini, L.A.R.; Darini, A.L.C. Mutations in the quinolone resistance-determining regions of gyrA and parC in Enterobacteriaceae isolates from Brazil. Braz. J. Microbiol. 2012, 43, 1309–1314. [Google Scholar] [CrossRef]
- Bisicchia, P.; Bui, N.K.; Aldridge, C.; Vollmer, W.; Devine, K.M. Acquisition of VanB-type vancomycin resistance by Bacillus subtilis: The impact on gene expression, cell wall composition and morphology. Mol. Microbiol. 2011, 81, 157–178. [Google Scholar] [CrossRef] [Scilit]
- Patel, J.B.; Gorwitz, R.J.; Jernigan, J.A. Mupirocin Resistance. Clin. Infect. Dis. 2009, 49, 935–941. [Google Scholar] [CrossRef] [Scilit]
- World Health Organization. WHO Guidelines on Use of Medically Important Antimicrobials in Food-Producing Animals; World Health Organization: Geneva, Switzerland, 2017; ISBN 9241550139. [Google Scholar]
- World Health Organization. Critically Important Antimicrobials for Human Medicine; World Health Organization: Geneva, Switzerland, 2018; ISBN 978-92-4-151552-8. [Google Scholar]
| S. aurata | Weight (g) | Furcal Length (cm) | Total Length (cm) | Condition Index 1 | Water Temperature |
|---|---|---|---|---|---|
| Fish 1 | 1303 | 37.7 | 42.3 | 1.72 | 17.5 °C |
| Fish 2 | 1201 | 34.4 | 38.9 | 2.04 | |
| Fish 3 | 977 | 35.6 | 39.7 | 1.56 | |
| Fish 4 | 1076 | 36.2 | 40.1 | 1.67 | |
| Fish 5 | 1197 | 37.4 | 41.1 | 1.72 |
| Family | Method | Antibiotics Tested (Concentration) | Breakpoints |
|---|---|---|---|
| Bacillaceae | MIC by E-test® | VA (0.016–256 µg/mL) | CLSI M45 |
| Enterobacteriaceae Erwiniaceae | Disk diffusion | AMC (20 + 10 µg), AZT (30 µg), FEP (30 µg), CTX (5 µg), FOX (30 µg), CAZ (10 µg), ERT (10 µg), IMP (10 µg), MEM (10 µg), PTZ (36 µg), CIP (5 µg) SXT (25 µg), GEN (10 µg) | EUCAST |
| MIC by broth microdilution | CHL, FLO, OTC FMQ | CLSI VET08 CASFM VET 2019 | |
| Enterococcaceae | Disk diffusion | AMP (2 µg), GEN HC (30 µg), STR HC (300 µg) | EUCAST |
| MIC by E-test® | LNZ, TP, VA | ||
| Pseudomonadaceae | Disk diffusion | AZT (30 µg), FEP (30 µg), CAZ (10 µg), DOR (10 µg), ERT (10 µg), IMP (10 µg), MEM (10 µg), PTZ (36 µg), CIP (5 µg), LEV (5 µg), AN (30 µg), GEN (10 µg), NET (10 µg), TMN (10 µg) | EUCAST |
| MIC by broth microdilution | CHL, FLO, FMQ, OTC | CLSI M100 1 | |
| Staphylococcaceae | Disk diffusion | FOX (30 µg), CIP (5 µg), LEV (5 µg), MOX (5 µg), RIF (5 µg), MUP (200 µg), FUS (10 µg) | EUCAST |
| MIC by E-test® | DPC (0.016–256 µg/mL), LNZ (0.016–256 µg/mL), TP (0.016–256 µg/mL), VA (0.016–256 µg/mL) |
| Gene | Forward Primer Sequence (5’ → 3’) | Reverse Primer Sequence (5’ → 3’) | AT 2 | PCR 3 |
|---|---|---|---|---|
| blaOXA-48 | GACTATATTATTCGGGCTAA | ACCACTTCTAGGGAATAATT | 58 °C | 140 pb |
| blaNDM | GTTTGATCGTCAGGGATGGC | AACGGTGATATTGTCACTGGT | 56 °C | 359 pb |
| blaGES | AAAGCAGCTCAGATCGGTGT | TCTCTCCAACAACCCAATC | 56 °C | 707 pb |
| blaSME | CAGATGAGCGGTTCCCTTTA | AACCCAATCAGCAGGAACAC | 56 °C | 509 pb |
| qnrB1 | ATGACGCCATTACTGTATAA | CTAACCAATCACCGCGATGC | 49 °C | 697 pb |
| qnrC | AACGTACGATCAAATTG | TCCACTTTACGAGGTTCT | 55 °C | 560 pb |
| gyrB | GGACAAAGAAGGCTACAGCA | CGTCGCGTTGTACTCAGATA | 55 °C | 880 pb |
| vanA | AAGGTCTGTTTGAATTGTCCG | CGACTTCCTGATGAATACGA | 55 °C | 417 bp |
| vanB | CCATACTCTCCCCGGATAGG | TTGACCTCATTTAGAACGATGC | 55 °C | 721 bp |
| vanD | ATTGGAATCACAAAATCCG | GGCTGTGCTTCCTGATG | 55 °C | 626 bp |
| Bacterial Family | Fish Farm | |||
|---|---|---|---|---|
| Muscle (n = 5) | Gills, Intestine and Skin (n = 1) 1 | |||
| No. of Strains | % | No. of Strains | % | |
| Bacillaceae | 9 | 10% | 7 | 17% |
| BacillalesFamily XII. Incertae Sedis | 1 | 1% | 0 | 0% |
| Comamonadaceae | 2 | 2% | 0 | 0% |
| Enterobacteriaceae | 52 | 55% | 25 | 60% |
| Enterococcaceae | 4 | 4% | 2 | 5% |
| Erwiniaceae | 0 | 0% | 1 | 2% |
| Micrococcaceae | 4 | 4% | 0 | 0% |
| Pseudomonadaceae | 7 | 7% | 1 | 2% |
| Staphylococcaceae | 15 | 16% | 6 | 14% |
| Total (No. of strains/%) | 94 | 100% | 42 | 100% |
| Fish Sample | Bacterial Species 1 | Antibiotic’s Class 2 | OR 3 | 95% CI | p Value |
|---|---|---|---|---|---|
| Muscle | ALL | Phenicols | 0.3921 (P) | 0.1701–0.912 | ≤0.01 |
| Gills, intestine and skin | ALL | Phenicols | 2.55 | 1.096–5.879 | ≤0.01 |
| Muscle | Enterobacter sp. | - | 0.1648 (P) | 0.02645–0.7834 | ≤0.01 |
| Gills, intestine and skin | Enterobacter sp. | - | 6.067 | 1.277–37.8 | ≤0.01 |
| Antibiotic’s Class | Fish Farm | |||
|---|---|---|---|---|
| Muscle (n = 94) | Gills, Intestine and Skin (n = 42) | |||
| R/I (%) | S (%) | R/I (%) | S (%) | |
| Aminoglycosides | 0 (0) | 94 (100) | 0 (0) | 42 (100) |
| Fusidanes | 0 (0) | 94 (100) | 0 (0) | 42 (100) |
| Glycopeptides 1 | 3 (3) | 91 (97) | 0 (0) | 42 (100) |
| Lipopeptides | 0 (0) | 94 (100) | 0 (0) | 42 (100) |
| Mupirocin | 1 (1) | 93 (99) | 0 (0) | 42 (100) |
| Oxazolidinones | 0 (0) | 94 (100) | 0 (0) | 42 (100) |
| Phenicols 2 | 23 (24) | 71 (76) | 19 (45) | 23 (55) |
| Quinolones 3 | 7 (7) | 87 (93) | 2 (5) | 40 (95) |
| Rifampicin | 0 (0) | 94 (100) | 0 (0) | 42 (100) |
| Tetracyclines | 0 (0) | 94 (100) | 0 (0) | 42 (100) |
| Trimethoprim/sulfamethoxazole | 0 (0) | 94 (100) | 0 (0) | 42 (100) |
| β-lactams 4 | 12 (13) | 82 (87) | 4 (10) | 38 (90) |
| Antibiotic | Enterobacteriaceae | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Muscle (n = 52) | Gills, Intestine and Skin (n = 25) | |||||||||||
| MIC50 | MIC90 | Range | S% | I% | R% | MIC50 | MIC90 | Range | S% | I% | R% | |
| Flumequine | 0.5 | 1 | 0.125–2 | 100 | NA | 0 | 0.5 | 1 | 0.25–4 | 100 | NA | 0 |
| Chloramphenicol | 4 | 8 | 1–32 | 96 | 2 | 2 | 4 | 8 | 2–32 | 92 | 4 | 4 |
| Florfenicol | 8 | 16 | 1–32 | 56 | 37 | 7 | 8 | 16 | 1–32 | 24 | 60 | 16 |
| Oxytetracycline | 2 | 4 | 0.5–4 | 100 | 0 | 0 | 2 | 4 | 0.5–4 | 100 | 0 | 0 |
| Family | Species | Decreased Susceptibility Profile | No. of Strains |
|---|---|---|---|
| Bacillaceae | Bacillus cereus | VA | 1 |
| Bacillus sp. | VA | 2 | |
| Enterobacteriaceae | Citrobacter freundii | AMC, FOX, FLO | 1 |
| Citrobacter freundii complex | AMC, FOX, FLO | 1 | |
| Enterobacter cloacae | AMC, FOX, CHL, FLO | 2 | |
| AMC, FOX, FLO | 4 | ||
| AMC, AZT, FEP, CTX, FOX, CAZ, ERT, FLO, PTZ | 1 | ||
| AMC, AZT, CAZ, ERT, FOX | 1 | ||
| Enterobacter hormaechei | AMC, FOX, FLO | 12 | |
| AMC, FOX | 5 | ||
| AMC, AZT, FEP, CTX, FOX, CAZ, ERT, FLO, PTZ | 1 | ||
| AMC, AZT, FEP, CTX, FOX, CAZ, ERT, FLO, PTZ | 1 | ||
| Enterobacter sp. | AMC, FOX, FLO | 6 | |
| AMC, FOX, FLO, ERT | 1 | ||
| AMC, FOX, CAZ | 1 | ||
| AMC, AZT, FEP, CTX, FOX, CAZ, CHL, ERT, FLO, PTZ | 1 | ||
| AMC, AZT, CTX, FOX, CAZ, ERT, FLO | 1 | ||
| Escherichia coli | AMC, CHL, FLO | 1 | |
| AMC, FLO | 2 | ||
| Klebsiella pneumoniae | CIP, FLO | 1 | |
| FLO | 5 | ||
| Leclercia adecarboxylata | CIP, FLO | 1 | |
| Pseudomonadaceae | Pseudomonas putida | AZT, ERT, MEM | 2 |
| AZT, CHL, ERT, FLO, FMQ, MEM | 2 | ||
| Pseudomonas stutzeri | AZT, CHL, ERT, FLO, FMQ | 3 | |
| AZT, CIP, ERT, FLO, FMQ, MEM | 1 | ||
| Staphylococcaceae | Staphylococcus petrasii | CIP, LEV, MUP | 1 |
| Total | 61 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Salgueiro, V.; Manageiro, V.; Bandarra, N.M.; Reis, L.; Ferreira, E.; Caniça, M. Bacterial Diversity and Antibiotic Susceptibility of Sparus aurata from Aquaculture. Microorganisms 2020, 8, 1343. https://doi.org/10.3390/microorganisms8091343
Salgueiro V, Manageiro V, Bandarra NM, Reis L, Ferreira E, Caniça M. Bacterial Diversity and Antibiotic Susceptibility of Sparus aurata from Aquaculture. Microorganisms. 2020; 8(9):1343. https://doi.org/10.3390/microorganisms8091343
Chicago/Turabian StyleSalgueiro, Vanessa, Vera Manageiro, Narcisa M. Bandarra, Lígia Reis, Eugénia Ferreira, and Manuela Caniça. 2020. "Bacterial Diversity and Antibiotic Susceptibility of Sparus aurata from Aquaculture" Microorganisms 8, no. 9: 1343. https://doi.org/10.3390/microorganisms8091343
APA StyleSalgueiro, V., Manageiro, V., Bandarra, N. M., Reis, L., Ferreira, E., & Caniça, M. (2020). Bacterial Diversity and Antibiotic Susceptibility of Sparus aurata from Aquaculture. Microorganisms, 8(9), 1343. https://doi.org/10.3390/microorganisms8091343

