The Aquatic Ecosystem, a Good Environment for the Horizontal Transfer of Antimicrobial Resistance and Virulence-Associated Factors Among Extended Spectrum β-lactamases Producing E. coli
Abstract
1. Introduction
2. Materials and Methods
2.1. Strain Collection
2.2. Virulence Factor Gen Detection and Sequence Analysis
2.3. Conjugation Assay
2.4. Statistical Analysis
2.5. Informed Consent and Ethical Statement
3. Results
3.1. Prevalence of Virulence Factors Genes
3.2. Distribution of Virulence Genes among the Phylogenetic Groups
3.3. Horizontal Transfer of ESBL Genes
4. Discussion
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Kaczmarek, A.; Skowron, K.; Budzyńska, A.; Gospodarek-Komkowska, E. Virulence-associated genes and antibiotic susceptibility among vaginal and rectal Escherichia coli isolates from healthy pregnant women in Poland. Folia Microbiol. (Praha) 2018, 63, 637–643. [Google Scholar] [CrossRef]
- Zogg, A.L.; Zurfluh, K.; Schmitt, S.; Nüesch-Inderbinen, M.; Stephan, R. Antimicrobial resistance, multilocus sequence types and virulence profiles of ESBL producing and non-ESBL producing uropathogenic Escherichia coli isolated from cats and dogs in Switzerland. Vet. Microbiol. 2018, 216, 79–84. [Google Scholar] [CrossRef] [PubMed]
- Von Wintersdorff, C.J.H.; Penders, J.; Van Niekerk, J.M.; Mills, N.D.; Majumder, S.; Van Alphen, L.B.; Savelkoul, P.H.M.; Wolffs, P.F.G. Dissemination of antimicrobial resistance in microbial ecosystems through horizontal gene transfer. Front. Microbiol. 2016, 7, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Ben Yahia, H.; Ben Sallem, R.; Tayh, G.; Klibi, N.; Ben Amor, I.; Gharsa, H.; Boudabbous, A.; Ben Slama, K. Detection of CTX-M-15 harboring Escherichia coli isolated from wild birds in Tunisia. BMC Microbiol. 2018, 18, 26. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.J.; Moon, J.S.; Oh, D.H.; Chon, J.W.; Song, B.R.; Lim, J.S.; Heo, E.J.; Park, H.J.; Wee, S.H.; Sung, K. Genotypic characterization of ESBL-producing E. coli from imported meat in South Korea. Food Res. Int. 2018, 107, 158–164. [Google Scholar] [CrossRef]
- Chapman, T.A.; Wu, X.Y.; Barchia, I.; Bettelheim, K.A.; Driesen, S.; Trott, D.; Wilson, M.; Chin, J.J.C. Comparison of virulence gene profiles of Escherichia coli strains isolated from healthy and diarrheic swine. Appl. Environ. Microbiol. 2006, 72, 4782–4795. [Google Scholar] [CrossRef]
- Lüthje, P.; Brauner, A. Virulence Factors of Uropathogenic E. coli and Their Interaction with the Host. Adv. Microb. Physiol. 2014, 65, 337–372. [Google Scholar]
- Farfán-García, A.E.; Ariza-Rojas, S.C.; Vargas-Cárdenas, F.A.; Vargas-Remolina, L.V. Mecanismos de virulencia de Escherichia coli enteropatógena. Rev. Chil. Infectología 2016, 33, 438–450. [Google Scholar] [CrossRef]
- Karami, N.; Wold, A.E.; Adlerberth, I. Antibiotic resistance is linked to carriage of papC and iutA virulence genes and phylogenetic group D background in commensal and uropathogenic Escherichia coli from infants and young children. Eur. J. Clin. Microbiol. Infect. Dis. 2017, 36, 721–729. [Google Scholar] [CrossRef]
- Fabbri, A.; Travaglione, S.; Fiorentini, C. Escherichia coli cytotoxic necrotizing factor 1 (CNF1): Toxin biology, in Vivo applications and therapeutic potential. Toxins (Basel) 2010, 2, 283–296. [Google Scholar] [CrossRef]
- Bielaszewska, M.; Aldick, T.; Bauwens, A.; Karch, H. Hemolysin of enterohemorrhagic Escherichia coli: Structure, transport, biological activity and putative role in virulence. Int. J. Med. Microbiol. 2014, 304, 521–529. [Google Scholar] [CrossRef] [PubMed]
- Ojer-Usoz, E.; González, D.; Vitas, A.I.; Leiva, J.; García-Jalón, I.; Febles-Casquero, A.; de la Soledad Escolano, M. Prevalence of extended-spectrum β-lactamase-producing Enterobacteriaceae in meat products sold in Navarra, Spain. Meat Sci. 2013, 93, 316–321. [Google Scholar] [CrossRef] [PubMed]
- Ojer-Usoz, E.; González, D.; García-Jalón, I.; Vitas, A.I. High dissemination of extended-spectrum β-lactamase-producing Enterobacteriaceae ineffluents from wastewater treatment plants. Water Res. 2014, 56, 37–47. [Google Scholar] [CrossRef] [PubMed]
- Vitas, A.I.; Naik, D.; Pérez-Etayo, L.; González, D. Increased exposure to extended-spectrum β-lactamase-producing multidrug-resistant Enterobacteriaceae through the consumption of chicken and sushi products. Int. J. Food Microbiol. 2018, 269, 80–86. [Google Scholar] [CrossRef]
- González, D.; Gallagher, E.; Zúñiga, T.; Leiva, J.; Vitas, A.I. Prevalence and characterization of β-lactamase-producing Enterobacteriaceae in healthy human carriers. Int. Microbiol. 2019. [Google Scholar] [CrossRef]
- Pérez-Etayo, L.; Berzosa, M.; González, D.; Vitas, A.I. Prevalence of integrons and insertion sequences in ESBL-producing E. coli isolated from different sources in Navarra, Spain. Int. J. Environ. Res. Public Health 2018, 15, 2308. [Google Scholar] [CrossRef]
- Ojer-Usoz, E.; González, D.; Vitas, A.I. Clonal diversity of ESBL-producing Escherichia coli isolated from environmental, human and food samples. Int. J. Environ. Res. Public Health 2017, 14, 676. [Google Scholar] [CrossRef]
- Clermont, O.; Christenson, J.K.; Denamur, E.; Gordon, D.M. The Clermont Escherichia coli phylo-typing method revisited: Improvement of specificity and detection of new phylo-groups. Environ. Microbiol. Rep. 2013, 5, 58–65. [Google Scholar] [CrossRef]
- Wirth, T.; Falush, D.; Lan, R.; Colles, F.; Mensa, P.; Wieler, L.H.; Karch, H.; Reeves, P.R.; Maiden, M.C.J.; Ochman, H.; et al. Sex and virulence in Escherichia coli: An evolutionary perspective. Mol. Microbiol. 2006, 60, 1136–1151. [Google Scholar] [CrossRef]
- Yamamoto, S.; Terai, A.; Yuri, K.; Kurazono, H.; Takeda, Y.; Yoshida, O. Detection of urovirulence factors in Escherichia coli by multiplex polymerase chain reaction. FEMS Immunol. Med. Microbiol. 1995, 12, 85–90. [Google Scholar] [CrossRef]
- Ruiz, J.; Simon, K.; Horcajada, J.P.; Velasco, M.; Barranco, M.; Roig, G.; Moreno-Martínez, A.; Martínez, J.A.; Jiménez de Anta, T.; Mensa, J.; et al. Differences in virulence factors among clinical isolates of Escherichia coli causing cystitis and pyelonephritis in women and prostatitis in men. J. Clin. Microbiol. 2002, 40, 4445–4449. [Google Scholar] [CrossRef] [PubMed]
- Vaidya, V. Horizontal transfer of antimicrobial resistance by extended-spectrum β Lactamase-producing Enterobacteriaceae. J. Lab. Physicians 2011, 3, 37. [Google Scholar] [CrossRef] [PubMed]
- Woodford, N.; Fagan, E.J.; Ellington, M.J. Multiplex PCR for rapid detection of genes encoding CTX-M extended-spectrum β-lactamases. J. Antimicrob. Chemother. 2006, 57, 154–155. [Google Scholar] [CrossRef] [PubMed]
- Colom, K.; Pérez, J.; Alonso, R.; Fernández-Aranguiz, A.; Lariño, E.; Cisterna, R. Simple and reliable multiplex PCR assay for detection of blaTEM, bla(SHV) and blaOXA-1 genes in Enterobacteriaceae. FEMS Microbiol. Lett. 2003, 223, 147–151. [Google Scholar] [CrossRef]
- Alonso, C.A.; González-Barrio, D.; Ruiz-Fons, F.; Ruiz-Ripa, L.; Torres, C. High frequency of B2 phylogroup among non-clonally related fecal Escherichia coli isolates from wild boars, including the lineage ST131. FEMS Microbiol. Ecol. 2017, 93, 1–7. [Google Scholar] [CrossRef]
- Nicolas-Chanoine, M.H.; Bertrand, X.; Madec, J.Y. Escherichia coli ST131, an intriguing clonal group. Clin. Microbiol. Rev. 2014, 27, 543–574. [Google Scholar] [CrossRef]
- Connell, H.; Agace, W.; Klemm, P.; Schembri, M.; Mårild, S.; Svanborg, C. Type 1 fimbrial expression enhances Escherichia coli virulence for the urinary tract. Proc. Natl. Acad. Sci. USA 1996, 93, 9827–9832. [Google Scholar] [CrossRef]
- Tiba, M.R.; Yano, T.; da Silva Leite, D. Genotypic characterization of virulence factors in Escherichia coli strains from patients with cystitis. Rev. Inst. Med. Trop. Sao Paulo 2008, 50, 255–260. [Google Scholar] [CrossRef]
- Waksman, G.; Hultgren, S.J. Structural biology of the chaperone-usher pathway of pilus biogenesis. Nat. Rev. Microbiol. 2009, 7, 765–774. [Google Scholar] [CrossRef]
- Wullt, B.; Bergsten, G.; Connell, H.; Röllano, P.; Gebretsadik, N.; Hull, R.; Svanborg, C. P fimbriae enhance the early establishment of Escherichia coli in the human urinary tract. Mol. Microbiol. 2000, 38, 456–464. [Google Scholar] [CrossRef]
- Féria, C.; Machado, J.; Correia, J.D.; Gonçalves, J.; Gaastra, W. Distribution of papG alleles among uropathogenic Escherichia coli isolated from different species. FEMS Microbiol. Lett. 2001, 202, 205–208. [Google Scholar] [CrossRef]
- Hussain, A.; Shaik, S.; Ranjan, A.; Suresh, A.; Sarker, N.; Semmler, T.; Wieler, L.H.; Alam, M.; Watanabe, H.; Chakravortty, D.; et al. Genomic and Functional Characterization of Poultry Escherichia coli From India Revealed Diverse Extended-Spectrum β-Lactamase-Producing Lineages With Shared Virulence Profiles. Front. Microbiol. 2019, 10, 2766. [Google Scholar] [CrossRef]
- Vagrali, M. Siderophore production by uropathogenic Escherichia coli. Indian J. Pathol. Microbiol. 2009, 52, 126–127. [Google Scholar] [CrossRef] [PubMed]
- Raeispour, M.; Ranjbar, R. Antibiotic resistance, virulence factors and genotyping of Uropathogenic Escherichia coli strains. Antimicrob. Resist. Infect. Control 2018, 7, 118. [Google Scholar] [CrossRef] [PubMed]
- Jalali, H.R.; Pourbakhsh, A.; Fallah, F.; Eslami, G. Genotyping of Virulence Factors of Uropathogenic Escherichia coli by PCR. Nov. Biomed. 2015, 3, 177–181. [Google Scholar]
- Abe, C.M.; Salvador, F.A.; Falsetti, I.N.; Vieira, M.A.M.; Blanco, J.; Blanco, J.E.; Blanco, M.; MacHado, A.M.O.; Elias, W.P.; Hernandes, R.T.; et al. Uropathogenic Escherichia coli (UPEC) strains may carry virulence properties of diarrhoeagenic E. coli. FEMS Immunol. Med. Microbiol. 2008, 52, 397–406. [Google Scholar] [CrossRef]
- Arisoy, M.; Aysev, D.; Ekim, M.; Özel, D.; Köse, S.K.; Özsoy, E.D.; Akar, N. Detection of virulence factors of Escherichia coli from children by multiplex polymerase chain reaction. Int. J. Clin. Pract. 2006, 60, 170–173. [Google Scholar] [CrossRef]
- Searle, L.J.; Méric, G.; Porcelli, I.; Sheppard, S.K.; Lucchini, S. Variation in siderophore biosynthetic gene distribution and production across environmental and faecal populations of Escherichia coli. PLoS ONE 2015, 10, e0117906. [Google Scholar] [CrossRef]
- Chen, Y.M.M.; Wright, P.J.; Lee, C.S.; Browning, G.F. Uropathogenic virulence factors in isolates of Escherichia coli from clinical cases of canine pyometra and feces of healthy bitches. Vet. Microbiol. 2003, 94, 57–69. [Google Scholar] [CrossRef]
- Johnson, J.R.; Delavari, P.; Kuskowski, M.; Stell, A.L. Phylogenetic Distribution of Extraintestinal Virulence-Associated Traits in Escherichia coli. J. Infect. Dis. 2001, 183, 78–88. [Google Scholar] [CrossRef]
- Cortés, P.; Blanc, V.; Mora, A.; Dahbi, G.; Blanco, J.E.; Blanco, M.; López, C.; Andreu, A.; Navarro, F.; Alonso, M.P.; et al. Isolation and Characterization of Potentially Pathogenic Antimicrobial-Resistant Escherichia coli Strains from Chicken and Pig Farms in Spain. Appl. Environ. Microbiol. 2010, 76, 2799–2805. [Google Scholar] [CrossRef] [PubMed]
- Müller, A.; Stephan, R.; Nüesch-Inderbinen, M. Distribution of virulence factors in ESBL-producing Escherichia coli isolated from the environment, livestock, food and humans. Sci. Total Environ. 2016, 541, 667–672. [Google Scholar] [CrossRef] [PubMed]
- Calhau, V.; Mendes, C.; Pena, A.; Mendonça, N.; Da Silva, G.J. Virulence and plasmidic resistance determinants of Escherichia coli isolated from municipal and hospital wastewater treatment plants. J. Water Health 2015, 13, 311–318. [Google Scholar] [CrossRef] [PubMed]
- Müller, H.; Sib, E.; Gajdiss, M.; Klanke, U.; Lenz-Plet, F.; Barabasch, V.; Albert, C.; Schallenberg, A.; Timm, C.; Zacharias, N.; et al. Dissemination of multi-resistant Gram-negative bacteria into German wastewater and surface waters. FEMS Microbiol. Ecol. 2018, 94, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Hausner, M.; Wuertz, S. High Rates of Conjugation in Bacterial Biofilms as Determined by Quantitative In Situ Analysis. Appl. Environ. Microbiol. 1999, 65, 3710–3713. [Google Scholar] [CrossRef]
- WHO. Critically Important Antimicrobials for Human Medicine 5th Revision 2016 Ranking of Medically Important Antimicrobials for Risk Management of Antimicrobial Resistance due to Non-Human Use; WHO: Geneva, Switzerland, 2016. [Google Scholar]
- Bürgmann, H.; Frigon, D.; Gaze, W.H.; Manaia, C.M.; Pruden, A.; Singer, A.C.; Smets, B.F.; Zhang, T. Water and sanitation: An essential battlefront in the war on antimicrobial resistance. FEMS Microbiol. Ecol. 2018, 94, 1–14. [Google Scholar] [CrossRef]
- Klümper, U.; Dechesne, A.; Smets, B.F. Protocol for Evaluating the Permissiveness of Bacterial Communities Toward Conjugal Plasmids by Quantification and Isolation of Transconjugants. In Hydrocarbon and Lipid Microbiology Protocols; Springer: Berlin/Heidelberg, Germany, 2014. [Google Scholar]
- Gillings, M.R.; Gaze, W.H.; Pruden, A.; Smalla, K.; Tiedje, J.M.; Zhu, Y.G. Using the class 1 integron-integrase gene as a proxy for anthropogenic pollution. ISME J. 2015, 9, 1269–1279. [Google Scholar] [CrossRef]
- Franiczek, R.; Krzyzanowska, B. ESBL-producing Escherichia coli isolated from bloodstream infections - Antimicrobial susceptibility, conjugative transfer of resistance genes and phylogenetic origin. Adv. Clin. Exp. Med. 2014, 23, 865–870. [Google Scholar] [CrossRef]
- Rossi, F.; Rizzotti, L.; Felis, G.E.; Torriani, S. Horizontal gene transfer among microorganisms in food: Current knowledge and future perspectives. Food Microbiol. 2014, 42, 232–243. [Google Scholar] [CrossRef]





| Target | Primer | Sequence (5′-3′) | Size (bp) | T (°C) | Reference |
|---|---|---|---|---|---|
| fimA | fimA-Fw | GTTGTTCTGTCGGCTCTGTC | 447 | 55 | [21] |
| fimA-Rv | ATGGTGTTGGTTCCGTTATTC | ||||
| papGIII | papG-Fw | CATTTATCGTCCTCAACTTAG | 482 | 55 | [21] |
| papG-Rv | AAGAAGGGATTTTGTAGCGTC | ||||
| papC | papC-Rw | GACGGCTGTACTGCAGGGTGTGGCG | 382 | 63 | [20] |
| papC-Rv | ATATCCTTTCTGCAGGGATGCAATA | ||||
| aer | aer-Fw | TACCGGATTGTCATATGCAGACCGT | 602 | 63 | [20] |
| aer-Rv | AATATCTTCCTCCAGTCCGGAGAAG | ||||
| hlyA | hlyA-Fw | AACAAGGATAAGCACTGTTCTGGCT | 1117 | 63 | [20] |
| hlyA-Rv | ACCATATAAGCGGTCATTCCCGTCA | ||||
| cnfI | cnfI-Fw | AAGATGGAGTTTCCTATGCAGGAG | 498 | 63 | [20] |
| cnfI-Rv | CATTCAGAGTCCTGCCCTCATTATT |
| Gene | Number of Isolates (%) | |||||
|---|---|---|---|---|---|---|
| Clinical Cases | Healthy Volunteers | Food Products | Farms and Feed | Rivers and WWTPs | Total | |
| fimA | 36 (100) a | 13 (100) | 48 (100) b | 17 (85) a,b | 32 (97) | 146 (97.3) |
| papG III | 4 (11.1) | 0 | 2 (4.1) | 0 | 0 | 6 (4) |
| papC | 30 (83.3) c,d | 13 (100) g,i | 24 (50) d,e,h,i | 18 (90) f,h | 5 (15.2) c,e,f,g | 90 (60) |
| aer | 33 (91.6) j,k,l | 9 (69.2) l | 28 (58.3) k | 15 (75) | 23 (69.7) j | 108 (72) |
| hlyA | 2 (5.5) | 0 | 0 | 0 | 1 (3) | 3 (2) |
| cnf1 | 5 (13.8) | 0 | 0 | 0 | 3 (9) | 8 (5.3) |
| VF | Number of Isolates (% of Total) | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| Gene | A | B1 | B2 | D | C | F | Clade I | Unknown | |
| (n = 44) | (n = 27) | (n = 30) | (n = 36) | (n = 3) | (n = 6) | (n = 1) | (n = 3) | ||
| Adhesins | fimA | 43 (97.7) | 27 (100) | 28 (93.3) | 35 (97.2) | 3 (100) | 6 (100) | 1 (100) | 3 (100) |
| papC | 24 (54.4) | 16 (59.3) | 25 (83.3) | 21 (58.3) | 2 (66.6) | 1 (16.6) | - | 1 (33.3) | |
| papG III | 2 (4.5) | 1 (3.7) | 1 (3.3) | 2 (5.5) | - | - | - | - | |
| Siderophore | aer | 25 (56.8) | 17 (63) | 24 (80) | 32 (88.8) | 3 (100) | 6 (100) | - | 1 (33.3) |
| Toxins | hlyA | - | 1 (3.7) | 2 (6.6) | - | - | - | - | - |
| cnf1 | 1 (2.27) | 1 (3.7) | 2 (6.6) | 4 (11.1) | - | - | - | - | |
| Origin | Conjugation Frequency Average ± Sd | Conjugation Frequency Range |
|---|---|---|
| Rivers and WWTPs | 1.15 × 10−1 ± 5 × 10−1 | 2.35–3.37 × 10−6 |
| Healthy volunteers | 3.38 × 10−2 ± 4.20 × 10−2 | 4.81× 10−2–2.28 × 10−6 |
| Clinical cases | 2.64 × 10−3 ± 5.82 × 10−3 | 1.19 × 10−2–9.08 × 10−7 |
| Farms and feeds | 1.53 × 10−4 ± 2.85 × 10−4 | 1.03 × 10−4–9.14 × 10−7 |
| Food products | 9.61 × 10−4 ± 1.96 × 10−3 | 1.16 × 10−3–3.59 × 10−7 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pérez-Etayo, L.; González, D.; Vitas, A.I. The Aquatic Ecosystem, a Good Environment for the Horizontal Transfer of Antimicrobial Resistance and Virulence-Associated Factors Among Extended Spectrum β-lactamases Producing E. coli. Microorganisms 2020, 8, 568. https://doi.org/10.3390/microorganisms8040568
Pérez-Etayo L, González D, Vitas AI. The Aquatic Ecosystem, a Good Environment for the Horizontal Transfer of Antimicrobial Resistance and Virulence-Associated Factors Among Extended Spectrum β-lactamases Producing E. coli. Microorganisms. 2020; 8(4):568. https://doi.org/10.3390/microorganisms8040568
Chicago/Turabian StylePérez-Etayo, Lara, David González, and Ana Isabel Vitas. 2020. "The Aquatic Ecosystem, a Good Environment for the Horizontal Transfer of Antimicrobial Resistance and Virulence-Associated Factors Among Extended Spectrum β-lactamases Producing E. coli" Microorganisms 8, no. 4: 568. https://doi.org/10.3390/microorganisms8040568
APA StylePérez-Etayo, L., González, D., & Vitas, A. I. (2020). The Aquatic Ecosystem, a Good Environment for the Horizontal Transfer of Antimicrobial Resistance and Virulence-Associated Factors Among Extended Spectrum β-lactamases Producing E. coli. Microorganisms, 8(4), 568. https://doi.org/10.3390/microorganisms8040568

