Shared Extended-Spectrum β-Lactamase-Producing Salmonella Serovars between Agricultural and Aquatic Environments Revealed through invA Amplicon Sequencing
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Site Description and Sample Collection
2.2. Media and Sample Preparation
2.3. Detection and Isolation of ESBL-Producing Salmonella spp. and Salmonella spp.
2.4. Bacterial Confirmation and Identification
2.5. Serogrouping of ESBL-Producing Salmonella spp. Isolates
2.6. DNA Extraction
2.7. Detection of ARG in ESBL-Producing Salmonella spp. Using PCR
2.8. Detection of VF in ESBL-Producing Salmonella spp. Using PCR
2.9. InvA Amplicon Sequencing and Analysis
2.10. Bioinformatic Analysis of the invA Sequences
2.11. Data Analysis
3. Results
3.1. Prevalence of Nonresistant and ESBL-Producing Salmonella spp.
3.2. Bacterial Confirmation and Identification
3.3. Serotyping of ESBL-Producing Salmonella spp. Isolates
3.4. Detection of ARG in ESBL-Producing Salmonella spp.
3.5. Detection of VF in ESBL-Producing Salmonella spp.
3.6. InvA Amplicon Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Bhatta, D.R.; Bangtrakulnonth, A.; Tishyadhigama, P.; Saroj, S.D.; Bandekar, J.R.; Hendriksen, R.S.; Kapadnis, B.P. Serotyping, PCR, phage-typing and antibiotic sensitivity testing of Salmonella serovars isolated from urban drinking water supply systems of Nepal. Lett. Appl. Microbiol. 2007, 44, 588–594. [Google Scholar] [CrossRef] [PubMed]
- Amagliani, G.; Brandi, G.; Schiavano, G.F. Incidence and role of Salmonella in seafood safety. Food Res. Int. 2012, 45, 780–788. [Google Scholar] [CrossRef]
- Stanaway, J.D.; Parisi, A.; Sarkar, K.; Blacker, B.F.; Reiner, R.C.; Hay, S.I.; Nixon, M.R.; Dolecek, C.; James, S.L.; Mokdad, A.H.; et al. The global burden of non-typhoidal salmonella invasive disease: A systematic analysis for the Global Burden of Disease Study 2017. Lancet Infect. Dis. 2019, 19, 1312–1324. [Google Scholar] [CrossRef] [Green Version]
- Yang, Y.T.; Swinburne, M. New Produce Safety Regulations. Public Health Rep. 2016, 131, 754–757. [Google Scholar] [CrossRef] [Green Version]
- Jaja, I.F.; Bhembe, N.L.; Green, E.; Oguttu, J.; Muchenje, V. Molecular characterisation of antibiotic-resistant Salmonella enterica isolates recovered from meat in South Africa. Acta Trop. 2019, 190, 129–136. [Google Scholar] [CrossRef]
- Hanning, I.B.; Nutt, J.D.; Ricke, S.C. Salmonellosis Outbreaks in the United States Due to Fresh Produce: Sources and Potential Intervention Measures. Foodborne Pathog. Dis. 2009, 6, 635–648. [Google Scholar] [CrossRef]
- Fearnley, E.; Raupach, J.; Lagala, F.; Cameron, S. Salmonella in chicken meat, eggs and humans; Adelaide, South Australia, 2008. Int. J. Food Microbiol. 2011, 146, 219–227. [Google Scholar] [CrossRef]
- M’ikanatha, N.M.; Sandt, C.H.; Localio, A.R.; Tewari, D.; Rankin, S.C.; Whichard, J.M.; Altekruse, S.F.; Lautenbach, E.; Folster, J.P.; Russo, A.; et al. Multidrug-Resistant Salmonella Isolates from Retail Chicken Meat Compared with Human Clinical Isolates. Foodborne Pathog. Dis. 2010, 7, 929–934. [Google Scholar] [CrossRef]
- Ifeoma Stella, E. Evaluation of Salmonella Species in Water Sources in Two Local Government Areas of Anambra State. Cohesive J. Microbiol. Infect. Dis. 2018, 1. [Google Scholar] [CrossRef]
- Gelband, H.; Molly Miller, P.; Pant, S.; Gandra, S.; Levinson, J.; Barter, D.; White, A.; Laxminarayan, R. The state of the world’s antibiotics 2015. Wound Health South. Afr. 2015, 8, 30–34. [Google Scholar]
- Akinyemi, K.O.; Iwalokun, B.; Alafe, O.; Mudashiru, S.; Fakorede, C. blaCTX-M-I group extended spectrum beta lactamase-producing Salmonella typhi from hospitalised patients in Lagos, Nigeria. Infect. Drug Resist. 2015, 99. [Google Scholar] [CrossRef] [Green Version]
- Marti, E.; Variatza, E.; Balcazar, J.L. The role of aquatic ecosystems as reservoirs of antibiotic resistance. Trends Microbiol. 2014, 22, 36–41. [Google Scholar] [CrossRef] [PubMed]
- Martin, M.J.; Thottathil, S.E.; Newman, T.B. Antibiotics Overuse in Animal Agriculture: A Call to Action for Health Care Providers. Am. J. Public Health 2015, 105, 2409–2410. [Google Scholar] [CrossRef] [PubMed]
- Choukr-Allah, R. Wastewater Recycling and Reuse in Mediterranean Region as a Potential Resources for Water Saving and Sustainable Agriculture. In Proceedings of the Symposium International” Agriculture Durable en Region Mediterranean (AGDUMED), Rabat, Maroc, 14–16 May 2009; pp. 14–15. [Google Scholar]
- Parisi, A.; Crump, J.A.; Glass, K.; Howden, B.P.; Furuya-Kanamori, L.; Vilkins, S.; Gray, D.J.; Kirk, M.D. Health Outcomes from Multidrug-Resistant Salmonella Infections in High-Income Countries: A Systematic Review and Meta-Analysis. Foodborne Pathog. Dis. 2018, 15, 428–436. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization. WHO Publishes List of Bacteria for Which New Antibiotics are Urgently Needed; World Health Organization: Geneva, Switzerland, 2017. [Google Scholar]
- Nicolau, D.P.; Carmeli, Y.; Crank, C.W.; Goff, D.A.; Graber, C.J.; Lima, A.L.L.; Goldstein, E.J. Carbapenem stewardship: Does ertapenem affect Pseudomonas susceptibility to other carbapenems? A review of the evidence. Int. J. Antimicrob. Agents 2012, 39, 11–15. [Google Scholar] [CrossRef] [PubMed]
- Ndugulile, F.; Jureen, R.; Harthug, S.; Urassa, W.; Langeland, N. Extended Spectrum β-Lactamases among Gram-negative bacteria of nosocomial origin from an Intensive Care Unit of a tertiary health facility in Tanzania. BMC Infect. Dis. 2005, 5, 86. [Google Scholar] [CrossRef] [Green Version]
- Seong, W.-J.; Kwon, H.-J.; Kim, T.-E.; Lee, D.-Y.; Park, M.-S.; Kim, J.-H. Molecular serotyping of Salmonella enterica by complete rpoB gene sequencing. J. Microbiol. 2012, 50, 962–969. [Google Scholar] [CrossRef]
- Blaak, H.; van Hoek, A.H.A.M.; Veenman, C.; Docters van Leeuwen, A.E.; Lynch, G.; van Overbeek, W.M.; de Roda Husman, A.M. Extended spectrum ß-lactamase- and constitutively AmpC-producing Enterobacteriaceae on fresh produce and in the agricultural environment. Int. J. Food Microbiol. 2014, 168–169, 8–16. [Google Scholar] [CrossRef]
- Reuland, E.A.; al Naiemi, N.; Raadsen, S.A.; Savelkoul, P.H.M.; Kluytmans, J.A.J.W.; Vandenbroucke-Grauls, C.M.J.E. Prevalence of ESBL-producing Enterobacteriaceae in raw vegetables. Eur. J. Clin. Microbiol. Infect. Dis. 2014, 33, 1843–1846. [Google Scholar] [CrossRef] [Green Version]
- Veldman, K.; Kant, A.; Dierikx, C.; van Essen-Zandbergen, A.; Wit, B.; Mevius, D. Enterobacteriaceae resistant to third-generation cephalosporins and quinolones in fresh culinary herbs imported from Southeast Asia. Int. J. Food Microbiol. 2014, 177, 72–77. [Google Scholar] [CrossRef]
- Raseala, C.M.; Ekwanzala, M.D.; Momba, M.N.B. Multilocus-based phylogenetic analysis of extended-spectrum beta-lactamase Escherichia coli O157:H7 uncovers related strains between agriculture and nearby water sources. J. Infect. Public Health 2020. [Google Scholar] [CrossRef] [PubMed]
- Hasman, H.; Mevius, D.; Veldman, K.; Olesen, I.; Aarestrup, F.M. β-Lactamases among extended-spectrum β-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands. J. Antimicrob. Chemother. 2005, 56, 115–121. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Poppe, C.; Martin, L.; Muckle, A.; Archambault, M.; McEwen, S.; Weir, E. Characterization of antimicrobial resistance of Salmonella Newport isolated from animals, the environment, and animal food products in Canada. Can. J. Vet. Res. 2006, 70, 105. [Google Scholar] [PubMed]
- Aarestrup, F.M. Antimicrobial susceptibility and occurrence of resistance genes among Salmonella enterica serovar Weltevreden from different countries. J. Antimicrob. Chemother. 2003, 52, 715–718. [Google Scholar] [CrossRef]
- Zishiri, O.T.; Mkhize, N.; Mukaratirwa, S. Prevalence of virulence and antimicrobial resistance genes in Salmonella spp. isolated from commercial chickens and human clinical isolates from South Africa and Brazil. Onderstepoort J. Vet. Res. 2016, 83. [Google Scholar] [CrossRef]
- Fakhr, M.K.; Nolan, L.K.; Logue, C.M. Multilocus Sequence Typing Lacks the Discriminatory Ability of Pulsed-Field Gel Electrophoresis for Typing Salmonella enterica Serovar Typhimurium. J. Clin. Microbiol. 2005, 43, 2215–2219. [Google Scholar] [CrossRef] [Green Version]
- Abakpa, G.O.; Umoh, V.J.; Ameh, J.B.; Yakubu, S.E.; Kwaga, J.K.P.; Kamaruzaman, S. Diversity and antimicrobial resistance of Salmonella enterica isolated from fresh produce and environmental samples. Environ. Nanotechnol. Monit. Manag. 2015, 3, 38–46. [Google Scholar] [CrossRef] [Green Version]
- Kadry, M.; Nader, S.M.; Dorgham, S.M.; Kandil, M.M. Molecular diversity of the invA gene obtained from human and egg samples. Vet. World 2019, 12, 1033–1038. [Google Scholar] [CrossRef] [Green Version]
- Buehler, A.J.; Wiedmann, M.; Kassaify, Z.; Cheng, R.A. Evaluation of invA Diversity among Salmonella Species Suggests Why Some Commercially Available Rapid Detection Kits May Fail To Detect Multiple Salmonella Subspecies and Species. J. Food Prot. 2019, 82, 710–717. [Google Scholar] [CrossRef]
- Blankenberg, D.; Gordon, A.; von Kuster, G.; Coraor, N.; Taylor, J.; Nekrutenko, A. Manipulation of FASTQ data with Galaxy. Bioinformatics 2010, 26, 1783–1785. [Google Scholar] [CrossRef]
- Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data. 2010, pp. 175–176. Available online: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 24 September 2020).
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schmieder, R.; Edwards, R. Quality control and preprocessing of metagenomic datasets. Bioinformatics 2011, 27, 863–864. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Krueger, F. Trim galore. A wrapper tool around Cutadapt and FastQC to consistently apply quality and adapter trimming to FastQ files. Babraham Bioinformatics 2015, 516, 517. [Google Scholar]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef]
- Edgar, R.C.; Haas, B.J.; Clemente, J.C.; Quince, C.; Knight, R. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 2011, 27, 2194–2200. [Google Scholar] [CrossRef] [Green Version]
- Schmieder, R.; Edwards, R. Fast Identification and Removal of Sequence Contamination from Genomic and Metagenomic Datasets. PLoS ONE 2011, 6, e17288. [Google Scholar] [CrossRef] [Green Version]
- Menzel, P.; Ng, K.L.; Krogh, A. Fast and sensitive taxonomic classification for metagenomics with Kaiju. Nat. Commun. 2016, 7, 11257. [Google Scholar] [CrossRef] [Green Version]
- Baraniak, A.; Sadowy, E.; Hryniewicz, W.; Gniadkowski, M. Two Different Extended-Spectrum -Lactamases (ESBLs) in One of the First ESBL-Producing Salmonella Isolates in Poland. J. Clin. Microbiol. 2002, 40, 1095–1097. [Google Scholar] [CrossRef] [Green Version]
- Rotimi, V.O.; Jamal, W.; Pal, T.; Sovenned, A.; Albert, M.J. Emergence of CTX-M-15 type extended-spectrum β-lactamase-producing Salmonella spp. in Kuwait and the United Arab Emirates. J. Med Microbiol. 2008, 57, 881–886. [Google Scholar] [CrossRef] [Green Version]
- Sjölund, M.; Yam, J.; Schwenk, J.; Joyce, K.; Medalla, F.; Barzilay, E.; Whichard, J.M. Human Salmonella Infection Yielding CTX-M β-Lactamase, United States. Emerg. Infect. Dis. 2008, 14, 1957–1959. [Google Scholar] [CrossRef] [PubMed]
- Usha, G.; Chunderika, M.; Prashini, M.; Willem, S.A.; Yusuf, E.S. Characterization of extended-spectrum β-lactamases in Salmonella spp. at a tertiary hospital in Durban, South Africa. Diagn. Microbiol. Infect. Dis. 2008, 62, 86–91. [Google Scholar] [CrossRef] [PubMed]
- Yates, C.; Amyes, S. Extended-spectrum β-lactamases in non-typhoidal Salmonella spp. isolated in the UK are now a reality: Why the late arrival? J. Antimicrob. Chemother. 2005, 56, 262–264. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Z.; Raskin, L.; Zilles, J.L. Macrolide Resistance in Microorganisms at Antimicrobial-Free Swine Farms. Appl. Environ. Microbiol. 2009, 75, 5814–5820. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Heuer, H.; Schmitt, H.; Smalla, K. Antibiotic resistance gene spread due to manure application on agricultural fields. Curr. Opin. Microbiol. 2011, 14, 236–243. [Google Scholar] [CrossRef] [PubMed]
- Sato, T.; Okubo, T.; Usui, M.; Yokota, S.; Izumiyama, S.; Tamura, Y. Association of Veterinary Third-Generation Cephalosporin Use with the Risk of Emergence of Extended-Spectrum-Cephalosporin Resistance in Escherichia coli from Dairy Cattle in Japan. PLoS ONE 2014, 9, e96101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jacobsen, C.S.; Bech, T.B. Soil survival of Salmonella and transfer to freshwater and fresh produce. Food Res. Int. 2012, 45, 557–566. [Google Scholar] [CrossRef]
- Adzitey, F.; Ashiagbor, C.N.K.; Abu, H. Prevalence and antibiotic susceptibility of Salmonella spp. from water sources in Tamale, Ghana. Int. J. One Health 2016, 2, 24–28. [Google Scholar] [CrossRef] [Green Version]
- Qiao, J.; Zhang, Q.; Alali, W.Q.; Wang, J.; Meng, L.; Xiao, Y.; Yang, H.; Chen, S.; Cui, S.; Yang, B. Characterization of extended-spectrum β-lactamases (ESBLs)-producing Salmonella in retail raw chicken carcasses. Int. J. Food Microbiol. 2017, 248, 72–81. [Google Scholar] [CrossRef]
- Benagli, C.; Rossi, V.; Dolina, M.; Tonolla, M.; Petrini, O. Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry for the Identification of Clinically Relevant Bacteria. PLoS ONE 2011, 6, e16424. [Google Scholar] [CrossRef]
- Abdel-Maksoud, M.; Abdel-Khalek, R.; El-Gendy, A.; Gamal, R.F.; Abdelhady, H.M.; House, B.L. Genetic characterisation of multidrug-resistant Salmonella enterica serotypes isolated from poultry in Cairo, Egypt. Afr. J. Lab. Med. 2015, 4. [Google Scholar] [CrossRef] [Green Version]
- Roy, P.; Dhillon, A.S.; Lauerman, L.H.; Schaberg, D.M.; Bandli, D.; Johnson, S. Results of Salmonella isolation from poultry products, poultry, poultry environment, and other characteristics. Avian Dis. 2002, 46, 17–24. [Google Scholar] [CrossRef]
- Maraki, S.; Papadakis, I.S. Serotypes and Antimicrobial Resistance of Human Nontyphoidal Isolates of Salmonella enterica from Crete, Greece. Interdiscip. Perspect. Infect. Dis. 2014, 2014, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Tadesse, G. Prevalence of human Salmonellosis in Ethiopia: A systematic review and meta-analysis. BMC Infect. Dis. 2014, 14, 88. [Google Scholar] [CrossRef] [PubMed]
- Kwambana-Adams, B.; Darboe, S.; Nabwera, H.; Foster-Nyarko, E.; Ikumapayi, U.N.; Secka, O.; Betts, M.; Bradbury, R.; Wegmüller, R.; Lawal, B.; et al. Salmonella Infections in The Gambia, 2005–2015. Clin. Infect. Dis. 2015, 61, S354–S362. [Google Scholar] [CrossRef] [Green Version]
- Donaldson, S.C.; Straley, B.A.; Hegde, N.V.; Sawant, A.A.; DebRoy, C.; Jayarao, B.M. Molecular Epidemiology of Ceftiofur-Resistant Escherichia coli Isolates from Dairy Calves. Appl. Environ. Microbiol. 2006, 72, 3940–3948. [Google Scholar] [CrossRef] [Green Version]
- Frye, J.G.; Fedorka-Cray, P.J. Prevalence, distribution and characterisation of ceftiofur resistance in Salmonella enterica isolated from animals in the USA from 1999 to 2003. Int. J. Antimicrob. Agents 2007, 30, 134–142. [Google Scholar] [CrossRef] [PubMed]
- Guerri, M. Detection of integrons and antibiotic-resistance genes in Salmonella enterica serovar Typhimurium isolates with resistance to ampicillin and variable susceptibility to amoxicillin-clavulanate. Int. J. Antimicrob. Agents 2004, 24, 327–333. [Google Scholar] [CrossRef]
- Binh, C.T.T.; Heuer, H.; Gomes, N.C.M.; Kaupenjohann, M.; Smalla, K. Similar bacterial community structure and high abundance of sulfonamide resistance genes in field-scale manures. Manure Manag. Uses Environ. Impacts. Hauppauge: Nova Sci. Publ. 2010, 141–166. Available online: http://www.novapublishers.org/catalog/downloadOA.php?order=1&access=true (accessed on 22 August 2020).
- Randall, L.P. Antibiotic resistance genes, integrons and multiple antibiotic resistance in thirty-five serotypes of Salmonella enterica isolated from humans and animals in the UK. J. Antimicrob. Chemother. 2004, 53, 208–216. [Google Scholar] [CrossRef] [Green Version]
- Durso, L.M.; Miller, D.N.; Wienhold, B.J. Distribution and Quantification of Antibiotic Resistant Genes and Bacteria across Agricultural and Non-Agricultural Metagenomes. PLoS ONE 2012, 7, e48325. [Google Scholar] [CrossRef] [PubMed]
- Nesme, J.; Cécillon, S.; Delmont, T.O.; Monier, J.-M.; Vogel, T.M.; Simonet, P. Large-Scale Metagenomic-Based Study of Antibiotic Resistance in the Environment. Curr. Biol. 2014, 24, 1096–1100. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Igbinosa, I.H. Prevalence and detection of antibiotic-resistant determinant in Salmonella isolated from food-producing animals. Trop. Anim. Health Prod. 2015, 47, 37–43. [Google Scholar] [CrossRef] [PubMed]
- Jia, S.; Zhang, X.-X.; Miao, Y.; Zhao, Y.; Ye, L.; Li, B.; Zhang, T. Fate of antibiotic resistance genes and their associations with bacterial community in livestock breeding wastewater and its receiving river water. Water Res. 2017. [Google Scholar] [CrossRef]
- Falagas, M.E.; Karageorgopoulos, D.E. Extended-spectrum β-lactamase-producing organisms. J. Hosp. Infect. 2009, 73, 345–354. [Google Scholar] [CrossRef]
- Foote, A.D.; Thomsen, P.F.; Sveegaard, S.; Wahlberg, M.; Kielgast, J.; Kyhn, L.A.; Salling, A.B.; Galatius, A.; Orlando, L.; Gilbert, M.T.P. Investigating the Potential Use of Environmental DNA (eDNA) for Genetic Monitoring of Marine Mammals. PLoS ONE 2012, 7, e41781. [Google Scholar] [CrossRef]
- Adelowo, O.O.; Caucci, S.; Banjo, O.A.; Nnanna, O.C.; Awotipe, E.O.; Peters, F.B.; Fagade, O.E.; Berendonk, T.U. Extended Spectrum Beta-Lactamase (ESBL)-producing bacteria isolated from hospital wastewaters, rivers and aquaculture sources in Nigeria. Environ. Sci. Pollut. Res. 2018, 25, 2744–2755. [Google Scholar] [CrossRef]
- Liu, J.; Dan, X.; Lu, G.; Shen, J.; Wu, D.; Yan, Z. Investigation of pharmaceutically active compounds in an urban receiving water: Occurrence, fate and environmental risk assessment. Ecotoxicol. Environ. Saf. 2018, 154, 214–220. [Google Scholar] [CrossRef]
- Eckert, C.; Gautier, V.; Arlet, G. DNA sequence analysis of the genetic environment of various blaCTX-M genes. J. Antimicrob. Chemother. 2006, 57, 14–23. [Google Scholar] [CrossRef]
- Hughes, L.A.; Shopland, S.; Wigley, P.; Bradon, H.; Leatherbarrow, A.H.; Williams, N.J.; Bennett, M.; de Pinna, E.; Lawson, B.; Cunningham, A.A.; et al. Characterisation of Salmonella enterica serotype Typhimurium isolates from wild birds in northern England from 2005–2006. BMC Vet. Res. 2008, 4, 4. [Google Scholar] [CrossRef] [Green Version]
- Galán, J.E.; Ginocchio, C.; Costeas, P. Molecular and functional characterisation of the Salmonella invasion gene invA: Homology of InvA to members of a new protein family. J. Bacteriol. 1992, 174, 4338–4349. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cheng, C.-M.; Lin, W.; Van, K.T.; Phan, L.; Tran, N.N.; Farmer, D. Rapid Detection of Salmonella in Foods Using Real-Time PCR. J. Food Prot. 2008, 71, 2436–2441. [Google Scholar] [CrossRef] [PubMed]
- Al Arafat, T.; Mahmud, M.R.; Tanim, M.T.I.; Chowdhury, M.M.K.; Rahaman, M.M.; Rahman, S.R.; Rahman, M.M. Genetic Diversity of Salmonella enterica Strains Isolated from Sewage Samples of Different Hospitals in Bangladesh. Bangladesh J. Microbiol. 2019, 35, 57–60. [Google Scholar] [CrossRef]
- Zhao, S.; White, D.G.; Friedman, S.L.; Glenn, A.; Blickenstaff, K.; Ayers, S.L.; Abbott, J.W.; Hall-Robinson, E.; McDermott, P.F. Antimicrobial Resistance in Salmonella enterica Serovar Heidelberg Isolates from Retail Meats, Including poultry, from 2002 to 2006. Appl. Environ. Microbiol. 2008, 74, 6656–6662. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kidanemariam, A.; Engelbrecht, M.; Picard, J. Retrospective study on the incidence of Salmonella isolations in animals in South Africa, 1996 to 2006. J. South Afr. Vet. Assoc. 2010, 81. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bisi-Johnson, M.; Obi, C. Detection of Carbapenem Resistance in Salmonella Species from a Tertiary Hospital in Eastern Cape, South Africa. Br. Microbiol. Res. J. 2015, 10, 1–6. [Google Scholar] [CrossRef]
- Dekker, D.; Krumkamp, R.; Sarpong, N.; Frickmann, H.; Boahen, K.; Frimpong, M.; Asare, R.; Larbi, R.; Hagen, R.; Poppert, S.; et al. Drinking Water from Dug Wells in Rural Ghana—Salmonella Contamination, Environmental Factors, and Genotypes. Int. J. Environ. Res. Public Health 2015, 12, 3535–3546. [Google Scholar] [CrossRef] [Green Version]
- Traoré, O.; Nyholm, O.; Siitonen, A.; Bonkoungou, I.J.O.; Traoré, A.S.; Barro, N.; Haukka, K. Prevalence and diversity of Salmonella enterica in water, fish and lettuce in Ouagadougou, Burkina Faso. BMC Microbiol. 2015, 15, 151. [Google Scholar] [CrossRef]
Genes | Nucleotide Sequences (5′-3′) | Target Size | TAnnealing (°C) | Reference |
---|---|---|---|---|
Salmonella spp. ARG | ||||
blaCTX | F:ATGTGCAGYACCAGTAARGTKATGGC R:TGGGTRAARTARGTSACCAGAAYCAGCGG | 593 | 60 | [24] |
blaSHV | F:TTCGCCTGTGTATTATCTCCCTG R:TTAGCGTTGCCAGTGYTCG | 854 | 50 | [24] |
blaOXA-1 | F:ATGAAAAACACAATACATATCAACTTCGC R:GTGTGTTTAGAATGGTGATCGCATT | 820 | 58 | [24] |
sul1 | F:GCGCGGCGTGGGCTACCT R:GATTTCCGCGACACCGAGACAA | 350 | 65 | [25] |
blaTEM | F:ATGAGTATTCAACATTTCCG R:ACCAATGCTTAATCAGTGAG | 859 | 53 | [26] |
Salmonella spp. VF | ||||
spiC | F:CCTGGATAATGACTATTGAT R:AGTTTATGGTGATTGCGTAT | 309 | 54 | [27] |
misL | F:GTCGGCGAATGCCGCGAATA R:GCGCTGTTAACGCTAATAGT | 400 | 58 | [27] |
pipD | F:CGGCGATTCATGACTTTGAT R:CGTTATCATTCGGATCGTAA | 350 | 56 | [27] |
spaM | F:CGCTGTACGGTATTTCATT R:CTGACTCGGCCTCTTCCTG | 394 | 55 | [28] |
orfL | F:GGAGTATCGATAAAGATGTT R:GCGCGTAACGTCAGAATCAA | 550 | 58 | [27] |
invA | F:GTGAAATTATCGCCACGTTCGGGCAA R:TCATCGCACCGTCAAAGGAACC | 284 | 45 | [28] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Raseala, C.M.; Ekwanzala, M.D.; Momba, M.N.B. Shared Extended-Spectrum β-Lactamase-Producing Salmonella Serovars between Agricultural and Aquatic Environments Revealed through invA Amplicon Sequencing. Microorganisms 2020, 8, 1898. https://doi.org/10.3390/microorganisms8121898
Raseala CM, Ekwanzala MD, Momba MNB. Shared Extended-Spectrum β-Lactamase-Producing Salmonella Serovars between Agricultural and Aquatic Environments Revealed through invA Amplicon Sequencing. Microorganisms. 2020; 8(12):1898. https://doi.org/10.3390/microorganisms8121898
Chicago/Turabian StyleRaseala, Cecilia Mahlatse, Mutshiene Deogratias Ekwanzala, and Maggy Ndombo Benteke Momba. 2020. "Shared Extended-Spectrum β-Lactamase-Producing Salmonella Serovars between Agricultural and Aquatic Environments Revealed through invA Amplicon Sequencing" Microorganisms 8, no. 12: 1898. https://doi.org/10.3390/microorganisms8121898