Development of Enzyme-Mediated Duplex Exponential Amplification Assay for Detection and Identification of Meloidogyne enterolobii in Field
Abstract
1. Introduction
2. Materials and Methods
2.1. Nematode Isolation and Acquisition
2.2. DNA Extraction
- (1)
- Preparation of DNA crude extract: For single J2 nematode DNA extraction, 5 μL of lysis buffer (Suzhou Jingrui Biotechnology Co., Ltd., Suzhou, China) was added to a 0.2 mL PCR tube. A single nematode was picked, placed in the lysis buffer, and then cut into two sections by using a syringe needle [14]. An additional 5 μL of lysis solution was added. The mixture was incubated at 95 °C for 10 min, and after cooling, the DNA crude extract of a single nematode was obtained.
- (2)
- Soil DNA extraction: Total DNA was extracted from 0.5 g soil by using the FastDNA™ Soil Genomic Kit (MP Biomedicals, Santa Ana, CA, USA), following the manufacturer’s protocol.
- (3)
- Nematode DNA extraction: Bulk J2 nematode DNA was extracted by using the TaKaRa MiniBEST Universal Genomic DNA Extraction Kit (Takara Bio, Beijing, China).
2.3. Primer Design
2.4. qPCR Detection Reaction
2.5. EmDEA Reaction
2.6. Specificity Detection
2.7. Sensitivity Detection
2.8. Validation of EmDEA Assay in Naturally Infected Plants
3. Results
3.1. Specificity
3.2. Sensitivity
3.3. Standard Curve
3.4. Detection of Meloidogyne Enterolobii in Field Soil and Tissues
3.5. Comparison Between qPCR and EmDEA Detection Methods
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Appendix A



References
- Abad, P.; Favery, B.; Rosso, M.N.; Castagnone-Sereno, P. Root-knot nematode parasitism and host response: Molecular basis of a sophisticated interaction. Mol. Plant Pathol. 2003, 4, 217–224. [Google Scholar] [CrossRef] [Scilit]
- Sikandar, A.; Jia, L.; Wu, H.; Yang, S. Meloidogyne enterolobii risk to agriculture, its present status and future prospective for management. Front. Plant Sci. 2022, 13, 1093657. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elling, A.A. Major emerging problems with minor meloidogyne species. Phytopathology 2013, 103, 1092–1102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, Y.; Jiang, R.; Peng, D.; Zhang, Y.; Peng, H.; Long, H. Morphological and molecular characterization of a new root-knot nematode, Meloidogyne limonae n. sp. (Nematoda: Meloidogynidae), parasitizing lemon in China. Plant Dis. 2024, 108, 833–846. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, B.; Wang, R.Y.; Chen, S.L.; Li, X.H.; Ma, J. First report of root-knot nematode Meloidogyne enterolobii on sweet potato in China. Plant Dis. 2014, 98, 702. [Google Scholar] [CrossRef] [Scilit]
- Ramírez-Suárez, A.; Rosas-Hernández, L.; Alcasio-Rangel, S.; Powers, T.O. First report of the root-knot nematode Meloidogyne enterolobii parasitizing watermelon from Veracruz, Mexico. Plant Dis. 2014, 98, 428. [Google Scholar] [CrossRef] [Scilit]
- Salazar-Mesta, R.J.; Carrillo-Fasio, J.A.; Tovar-Pedraza, J.M.; Garcia-Estrada, R.S.; Mora-Romero, G.A.; Vega-Hernández, R.; Torres-López, J. First report of the root-knot nematode Meloidogyne enterolobii parasitizing eggplant in Mexico. Plant Dis. 2022, 107, 1638. [Google Scholar] [CrossRef] [Scilit]
- Wong, T.S.; Ye, W.; Thiessen, L.D.; Huseth, A.S.; Gorny, A.; Quesada-Ocampo, L.M. Occurrence and distribution of meloidogyne spp. in fields rotated with sweet potato and host range of a North Carolina Population of Meloidogyne enterolobii. Plant Dis. 2024, 108, 2855–2864. [Google Scholar] [CrossRef] [Scilit]
- Song, P.; Peng, D.-L.; Li, Y.M.; Chen, Z.-J.; Zhai, Y.-Y.; Chen, L.; Bo, H. Potential global distribution of the guava root-knot nematode Meloidogyne enterolobii under different climate change scenarios using MaxEnt ecological niche modeling. J. Integr. Agric. 2023, 22, 2138–2150. [Google Scholar]
- Hunt, D.J.; Handoo, Z.A. Taxonomy, identification and principal species. In Root-Knot Nematodes; CABI: Wallingford, UK, 2009; pp. 55–97. [Google Scholar]
- Taylor, S.C.; Nadeau, K.; Abbasi, M.; Lachance, C.; Nguyen, M.; Fenrich, J. The Ultimate qPCR experiment: Producing publication quality, reproducible data the first time. Trends Biotechnol. 2019, 37, 761–774. [Google Scholar] [CrossRef] [Scilit]
- Wissel, M.; Poirier, M.; Satterwhite, C.; Lin, J.; Islam, R.; Zimmer, J.; Khadang, A.; Zemo, J.; Lester, T.; Fjording, M.; et al. Recommendations on qPCR/ddPCR assay validation by GCC. Bioanalysis 2022, 14, 853–863. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ko, H.R.; Kang, H.; Park, E.H.; Kim, E.H.; Lee, J.K. Identification of Heterodera glycines (Tylenchida; Heteroderidae) Using qPCR. Plant Pathol. J. 2019, 35, 654–661. [Google Scholar] [CrossRef] [Scilit]
- Gao, B.; Ma, J.; Li, X.; Wang, R.; Chen, S. A real-time recombinase polymerase amplification assay for fast and accurate detection of Ditylenchus destructor. Mol. Cell. Probes 2022, 61, 101788. [Google Scholar] [CrossRef] [Scilit]
- Su, Y.; Zhu, X.; Jing, H.; Yu, H.; Liu, H. Establishment of a sensitive and reliable droplet digital PCRassay for the detection of Bursaphelenchus xylophilus. Plants 2024, 13, 2701. [Google Scholar] [CrossRef] [Scilit]
- McCuiston, J.L.; Hudson, L.C.; Subbotin, S.A.; Davis, E.L.; Warfield, C.Y. Conventional and PCR detection of Aphelenchoides fragariae in diverse ornamental host plant species. J. Nematol. 2007, 39, 343–355. [Google Scholar] [PubMed Central]
- Hodson, A.K.; Celayir, T.; Quiroz Alonso, A. A Real-Time PCR assay to detect and quantify root-knot nematodes from soil extracts. Plant Dis. 2023, 107, 2169–2176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kiewnick, S.; Frey, J.E.; Braun-Kiewnick, A. Development and validation of LNA-based quantitative real-time PCR assays for detection and identification of the root-knot nematode Meloidogyne enterolobii in complex dna backgrounds. Phytopathology 2015, 105, 1245–1249. [Google Scholar] [CrossRef] [Scilit]
- Hu, M.X.; Zhuo, K.; Liao, J.L. Multiplex PCR for the simultaneous identification and detection of Meloidogyne incognita, M. enterolobii, and M. javanica using DNA extracted directly from individual galls. Phytopathology 2011, 101, 1270–1277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.; Long, H.; Feng, T.; Pei, Y.; Sun, Y.; Zhang, X. Development of a novel primer-taqman probe set for diagnosis and quantification of Meloidogyne enterolobii in soil using qPCR and droplet digital PCR assays. Int. J. Mol. Sci. 2022, 23, 11185. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Wang, S.; Guo, Y.; Wang, L.; Feng, T.; Zhang, X.; Long, H. Development of the duplex droplet digital PCR for quantitative monitoring of mixed infections of Meloidogyne incognita and M. enterolobii. Pest Manag. Sci. 2025, 81, 1501–1511. [Google Scholar] [CrossRef] [Scilit]
- Soroka, M.; Wasowicz, B.; Rymaszewska, A. Loop-mediated isothermal amplification (LAMP): The better sibling of PCR? Cells 2021, 10, 1931. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, Z.; Yang, X.; Zhang, X.; Luan, M.; Guo, B.; Liu, C.; Pan, J.; Mei, S. Rapid and visual detection of Meloidogyne hapla using recombinase polymerase amplification combined with a lateral flow dipstick assay. Plant Dis. 2021, 105, 2697–2703. [Google Scholar] [CrossRef] [Scilit]
- Zhang, T.; Xu, H.; Liu, M.; Zhang, W. Development of a rapid detection technology system for noxious plants based on a novel isothermal amplification technique. Front. Plant Sci. 2024, 15, 1502052. [Google Scholar] [CrossRef] [Scilit]
- Zhao, L.R.; Xu, C.L.; Wu, M.T.; Gu, J.F.; Yang, S.H.; Pan, Z.K.; Yu, J.; Feng, L.X.; Zhao, J.P.; Li, X.F. A Primer-Probe combination for EmDEA isothermal fluorescence detection of Radopholus similis, Kit and Its Application. Chinese Patent CN202411509150.5, 3 January 2025. [Google Scholar]
- Duan, W.J.; Yu, Z.L.; Zhao, L.; Liu, L.; Li, X.L.; Zhang, H.L.; Wang, J.Y.; Gu, J.F. Method for detecting Ciborinia camelliae and its application. Chinese Patent CN202410356936.1, 7 June 2024. [Google Scholar]
- Long, H.; Liu, H.; Xu, H. Development of a PCR diagnostic for the root-knot nematode Meloidogyne enterobill. Acta Phytopathol. Sin. 2006, 36, 109–115. [Google Scholar]
- Watson, T.T. Sensitivity of Meloidogyne enterolobii and M. incognita to fluorinated nematicides. Pest Manag. Sci. 2022, 78, 1398–1406. [Google Scholar] [CrossRef] [Scilit]
- Piccin-Santos, V.; Brandão, M.M.; Bittencourt-Oliveira Mdo, C. Phylogenetic study of geitlerinema and Microcystis (cyanobacteria) using PC-IGS and 16S-23S ITS as markers: Investigation of horizontal gene transfer. J. Phycol. 2014, 50, 736–743. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Poczai, P.; Varga, I.; Hyvönen, J. Internal transcribed spacer (ITS) evolution in populations of the hyperparasitic European mistletoe pathogen fungus, Sphaeropsis visci (Botryos phaeriaceae): The utility of ITS2 secondary structures. Gene 2015, 558, 54–64. [Google Scholar] [CrossRef] [Scilit]
- Kojabad, A.A.; Farzanehpour, M.; Galeh, H.E.G.; Dorostkar, R.; Jafarpour, A.; Bolandian, M.; Nodooshan, M.M. Droplet digital PCR of viral DNA/RNA, current progress, challenges, and future perspectives. J. Med. Virol. 2021, 93, 4182–4197. [Google Scholar] [CrossRef] [Scilit]
- Shahrajabian, M.H.; Sun, W. The Significance and importance of dPCR, qPCR, and SYBR Green PCR Kit in the detection of numerous diseases. Curr. Pharm. Des. 2024, 30, 169–179. [Google Scholar] [CrossRef] [Scilit]
- Lawaju, B.R.; Yan, G.; Whitworth, J. Development of a droplet digital PCR assay for detection and quantification of stubby root nematode, Paratrichodorus allius, in Soil. Plant Dis. 2023, 107, 3344–3353. [Google Scholar] [CrossRef] [Scilit]
- Hu, Z.; Qin, H.; Wu, Y.; Xie, Y.; Wu, F.; Li, Q.; Dai, D.; Zhang, Y.; Niu, Z. Development and application evaluation of a rapid on-site nucleic acid detection method for African swine fever virus based on enzymes mediated duplex exponential amplification. Hinese Vet. Sci. 2024, 54, 1334–1344. [Google Scholar] [CrossRef]
- Arjoune, Y.; Sugunaraj, N.; Peri, S.; Nair, S.V.; Skurdal, A.; Ranganathan, P.; Johnson, B. Soybean cyst nematode detection and management: A review. Plant Methods 2022, 18, 110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Young, J.M.; Rawlence, N.J.; Weyrich, L.S.; Cooper, A. Limitations and recommendations for successful DNA extraction from forensic soil samples: A review. Sci. Justice: J. Forensic Sci. Soc. 2014, 54, 238–244. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lima, A.; França, A.; Muzny, C.A.; Taylor, C.M.; Cerca, N. DNA extraction leads to bias in bacterial quantification by qPCR. Appl. Microbiol. Biotechnol. 2022, 106, 7993–8006. [Google Scholar] [CrossRef] [Scilit]
- Xie, W.; Xue, J.; Chen, R.; Su, H.; Fang, X.; Wu, Q.; Yang, W.; Jia, L. Extraction of Genomic DNA from soil samples by polyethylene glycol-modified magnetic particles via isopropanol promotion and Ca2+ mediation. Langmuir ACS J. Surf. Colloids 2024, 40, 20550–20558. [Google Scholar] [CrossRef] [Scilit]
- Pun, T.B.; Thapa Magar, R.; Koech, R.; Owen, K.J.; Adorada, D.L. Emerging trends and technologies used for the identification, detection, and characterisation of plant-parasitic nematode infestation in crops. Plants 2024, 13, 3041. [Google Scholar] [CrossRef] [Scilit]
- Massi, F.; Torriani, S.F.F.; Borghi, L.; Toffolatti, S.L. Fungicide resistance evolution and detection in plant pathogens: Plasmopara viticola as a case study. Microorganisms 2021, 9, 119. [Google Scholar] [CrossRef] [Scilit]



| Primer | Sequence | Product | Origin |
|---|---|---|---|
| Me-F5 | AAGCTAATACGACTCACTATAGGGTGTTGTT CGCTGTTCGCGGGAATGGTTT | 241 bp | Designed in this study |
| Me-R1 | AGTTTATTATTATAAGCTTTATTTTTTT | ||
| Me-RNA1 | UUCCUCCCACACAUUUUUAUAAUUGCCC | ||
| Me-F | AACTTTTGTGAAAGTGCCGCTG | 235 bp | [27] |
| Me-R | TCAGTTCAGGCAGGATCAACC |
| Sample ID | Host | Type | DNA Extraction Method | Origin | Concentration (Nematodes/g of Plant or Soil) | |
|---|---|---|---|---|---|---|
| EmDEA | qPCR | |||||
| FQ-1 | Tomato | Root | Crude DNA extract | Baoding city, Hebei Province | 53.74 | /(32 < CT < 36) |
| FQ-2 | Tomato | Root | Crude DNA extract | Baoding city, Hebei Province | 46.00 | /(32 < CT < 36) |
| YC-1 | Tobacco | Root | Crude DNA extract | Baoding city, Hebei Province | 108.32 | /(32 < CT < 36) |
| YC-2 | Tobacco | Root | Crude DNA extract | Baoding city, Hebei Province | 69.29 | /(32 < CT < 36) |
| YC-3 | Tobacco | Root | Crude DNA extract | Baoding city, Hebei Province | 124.03 | /(32 < CT < 36) |
| YC-4 | Tobacco | Root | Crude DNA extract | Baoding city, Hebei Province | 123.57 | /(32 < CT < 36) |
| YC-5 | Tobacco | Root | Crude DNA extract | Baoding city, Hebei Province | 121.49 | /(32 < CT < 36) |
| GS-1 | Sweet potato | Root | Crude DNA extract | Lufeng city, Guangdong Province | 97.62 | /(32 < CT < 36) |
| Soil | Soil DNA extraction | 1.28 | 1.35 | |||
| Soil | Crude DNA extract | No amplification | No amplification | |||
| GS-2 | Sweet potato | Root | Crude DNA extract | Lufeng city, Guangdong Province | 50.41 | /(32 < CT < 36) |
| Soil | Soil DNA extraction | 1.07 | 1.21 | |||
| Soil | Crude DNA extract | No amplification | No amplification | |||
| GS-3 | Sweet potato | Root | Crude DNA extract | Lufeng city, Guangdong Province | 60.21 | /(32 < CT < 37) |
| Soil | Soil DNA extraction | 1.27 | 1.52 | |||
| Soil | Crude DNA extract | No amplification | No amplification | |||
| Detection Method | Sensitivity | Detection Time 5 | Field Operability | Professional Skills | |||
|---|---|---|---|---|---|---|---|
| DNA 1 | Individual Nematode 2 | Sweet Potato 3 | Soil 4 | ||||
| qPCR | 3.6 × 10−4 ng/μL | 1/1500 of a nematode | 8.97 nematodes/g sweet potato | 4.08 nematodes/100 g soil | 80~90 min | Not directly operable in the field | Strong |
| EmDEA | 3.6 × 10−4 ng/μL | 1/1000 of a nematode | 8.97 nematodes/g sweet potato | 4.08 nematodes/100 g soil | 40 min | Directly operable in the field | Weak |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, B.; Gao, B.; Wang, R.; Chen, S.; Li, X.; Dong, Y.; Ma, J. Development of Enzyme-Mediated Duplex Exponential Amplification Assay for Detection and Identification of Meloidogyne enterolobii in Field. Microorganisms 2025, 13, 1353. https://doi.org/10.3390/microorganisms13061353
Sun B, Gao B, Wang R, Chen S, Li X, Dong Y, Ma J. Development of Enzyme-Mediated Duplex Exponential Amplification Assay for Detection and Identification of Meloidogyne enterolobii in Field. Microorganisms. 2025; 13(6):1353. https://doi.org/10.3390/microorganisms13061353
Chicago/Turabian StyleSun, Bingxue, Bo Gao, Rongyan Wang, Shulong Chen, Xiuhua Li, Yonghao Dong, and Juan Ma. 2025. "Development of Enzyme-Mediated Duplex Exponential Amplification Assay for Detection and Identification of Meloidogyne enterolobii in Field" Microorganisms 13, no. 6: 1353. https://doi.org/10.3390/microorganisms13061353
APA StyleSun, B., Gao, B., Wang, R., Chen, S., Li, X., Dong, Y., & Ma, J. (2025). Development of Enzyme-Mediated Duplex Exponential Amplification Assay for Detection and Identification of Meloidogyne enterolobii in Field. Microorganisms, 13(6), 1353. https://doi.org/10.3390/microorganisms13061353

