Next Article in Journal
Survival and Morphological Changes of Clostridium butyricum Spores Co-Exposed to Antibiotics and Simulated Gastrointestinal Fluids: Implications for Antibiotic Stewardship
Previous Article in Journal
Enhancing the Catalytic Performance of PdNPs for Cr(VI) Reduction by Increasing Pd(0) Content
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 13
Issue 6
10.3390/microorganisms13061341
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Evaluation of the Immunostimulant Effect of Microvesicles of Lactobacillus acidophilus Isolated from Wild Rats

by
Pamela I. Pérez-Martínez
1,2,
Viridiana Gutiérrez-Espinosa
1,
Christian Ávalos-Gómez
3,
Mireya De la Garza-Amaya
3,
Alejandro Vargas-Ruíz
1,
Rosa I. Higuera-Piedrahita
1,
Ernesto Marín-Flamand
1,
Cristal D. Lonngi-Sosa
1,
Francisco R. González-Díaz
1,
Hugo Ramírez-Álvarez
2,* and
Cynthia González-Ruíz
1,*
1
Molecular Pathology Veterinary Laboratory, Multidisciplinary Research Unit, Facultad de Estudios Superiores Cuautitlán, UNAM, Cuautitlán Izcalli CP 54714, State of Mexico, Mexico
2
Virology, Genetics and Molecular Biology Laboratory, Facultad de Estudios Superiores Cuautitlán, UNAM, Cuautitlán Izcalli CP 54714, State of Mexico, Mexico
3
Centro de Investigación y de Estudios Avanzados del IPN, CINVESTAV Gustavo A. Madero, Ciudad de Mexico CP 07360, CDMX, Mexico
*
Authors to whom correspondence should be addressed.
Microorganisms 2025, 13(6), 1341; https://doi.org/10.3390/microorganisms13061341
Submission received: 23 April 2025 / Revised: 22 May 2025 / Accepted: 2 June 2025 / Published: 10 June 2025
(This article belongs to the Section Veterinary Microbiology)
Browse Figures
Versions Notes

Abstract

Lactic acid bacteria are components of the gastrointestinal tract microbiota in both humans and animals and are widely used as probiotics. Lactobacillus is the most closely related genus to probiotic activity. It is capable of releasing membrane microvesicles (MVs), whose primary functions include carrying and transmitting antigens to host tissues and modulating host defense responses. In the present study, MVs were isolated from Lactobacillus acidophilus resident in the ileum of free-living rats, and their immunostimulant effect was evaluated in two biological models. MVs were characterized using SDS-PAGE electrophoresis, electron microscopy, and nanoparticle tracking analysis. In the first model, the immunostimulatory effect of MVs was evaluated on ovine abomasal explants, which had been previously stimulated with MVs and then challenged with third-stage larvae of Haemonchus contortus. This resulted in a decrease in the percentage of larval association and favored the migration of inflammatory cells to the infection site. In the second model, the macrophage cell line RAW 264.7 was stimulated with MVs to evaluate the expression of transcripts encoding IL-1β and TNF-α. MVs isolated from L. acidophilus demonstrate immunostimulatory and probiotic effects in the two biological models assessed. This suggested that the MVs possess similar immunostimulatory effects as those reported for the parent bacteria.

1. Introduction

Lactic acid bacteria (LAB) are a broad group of microorganisms commonly used as probiotics. Lactobacillus acidophilus is the most well-known strain of the Lactobacillus genus since it has been the most used and studied bacterium over time [1]. LAB is widely found in human and animal mucosae, as well as in fermented foods [2,3]. These microorganisms are associated with immunomodulatory functions and the capacity to reduce the risk of infection and death by pathogens in the gastrointestinal tract (GIT) of mammals [4]. Probiotics are live microorganisms that have beneficial effects on the host when they are administered orally. Scientific evidence indicates that the molecules and cellular structures released by these microorganisms possess significant probiotic properties [5,6,7].
All prokaryotic cells have developed numerous ways to transfer proteins to the environment, which primarily involve the assistance of dedicated protein secretion systems. In that way, the secreted membrane microvesicles (MVs) have become one of the most critical mechanisms of bacterial secretion systems and intercellular communication. MVs are blebs from the outer membrane (OMVs) of Gram-negative bacteria and the cytoplasmic membrane (MVs) of Gram-positive bacteria, which are secreted during all growth phases of both bacteria [8,9].
Compared to the extensive study of OMVs, MVs have been of relatively recent interest, so the mechanisms of biogenesis are still being elucidated [9]. However, it is believed that the formation of MVs may be stimulated by the weakening of the cell envelope through enzymes that hydrolyze peptidoglycan or by β-lactam antibiotics [9,10,11]. In addition to the above, the use of sublethal concentrations of antibiotics that interfere with cell wall synthesis and protein production, such as penicillin [10], ampicillin [11], and gentamycin [12], results in a significant increase in MV production.
Regarding the genus Lactobacillus, MVs production has been described in L. rhamnosus JB-1 [7], L. plantarum [13], L. acidophilus [14], L. reuteri [15], and L. casei BL23 [16]. Immune regulation by MVs from Lactobacillus has been proposed to play a role in signaling between probiotic intestinal bacteria and their mammalian hosts [7]. MVs’ immunomodulatory effects are related to their interaction with different immune and non-immune cells through pattern recognition receptors, such as Toll-like receptors (TLR) and NOD-like receptors (NLR), as well as various pathogen-associated molecular patterns (PAMPs) [17]. MVs from different bacterial species have been shown to increase the production of proinflammatory cytokines. For instance, Staphylococcus aureus MVs [18] stimulate IL-1β and IL-18 production in murine models, Escherichia coli C25 enhances IL-8 production in intestinal epithelial cells [19], and Akkermansia muciniphila induces IL-6 secretion [20]. For Lactobacillus-derived MVs, L. casei has been reported to increase IL-6 in human intestinal epithelial cells [21], and L. reuteri DSM-17938 promotes motility in mouse intestines [15]. The important immune response that MVs stimulate in the host has facilitated the development of acellular vaccines against pathogenic bacteria, such as Neisseria meningitidis [22], Vibrio cholerae [23], Burkholderia pseudomallei [24], as well as Mannheimia haemolytica A1 [25] and A2 [26].
The use of probiotics in animal production and health is becoming increasingly relevant [27,28], because the supplementation of probiotics in the diet can improve animal health and performance, through contributions to gut health and nutrient absorption [29,30], as well as to reduce the use of antimicrobials to which microorganisms have become increasingly resistant. The primary objective of probiotics is to modulate the host immune system, thereby preventing and treating infections [31]. In the livestock industry, it has been reported that the administration of probiotics enhances milk production in Holstein Friesian cows [32,33], while in other species, such as pigs, it promotes microbiota diversity and weight gain [34,35,36]. In poultry, studies have shown that probiotics can improve broiler and egg production [37,38]. Probiotics have not been limited to animal production. Still, they are also used in pets, such as dogs and cats, which promotes the diversity of microbiota, improves the immune response, and helps control diarrhea [29,39,40].
In a previous study, the production and characterization of MVs from Lactobacillus genus bacteria isolated from the gastrointestinal tract (GIT) of free-living rats were studied [41]. The relevance of working with Lactobacillus isolated from this rodent is justified because it is exposed and resistant to many pathogens that infect humans and food animals without developing disease, which can be attributed to its intestinal microbiota [42,43,44]. Lonngi et al., 2022 previously reported a bactericidal effect of 30 µg of MVs from L. acidophilus isolated from the ileum of free-living rats on the growth of Salmonella enterica serovar Typhimurium (ATCC 154) and a field strain of E. coli [41].
On the other hand, parasitic diseases affecting the livestock industry are a persistent and challenging problem due to the resistance that parasites have developed to the various drugs intended for their control. One of the most significant ovine gastrointestinal tract (GIT) diseases is caused by Haemonchus contortus. This hematophagous parasite induces anemia and mortality in animals, even when it triggers a strong Th2 immune response [45,46,47]. The life cycle of this parasite is direct, and animals become infected when they consume feed contaminated with third-stage larvae (L3), the infective stage. Once in the abomasum, it develops into L4 and L5, remaining in this stage until it reaches adulthood [48]. However, there are no reports of the effects of MVs of probiotic bacteria on L3 of H. contortus.
Although the microbicidal and immunostimulant effects of probiotics are well established, there are few studies on the impact of MVs from L. acidophilus. Nevertheless, no information is available for the minimum viable concentrations of L. acidophilus MVs isolated from free-living rats. Bacterial MVs, in general, have demonstrated their potent ability to carry biologically active antigens, which efficiently stimulate the immune system. This study aimed to determine the immunostimulatory capacity of MVs from L. acidophilus on two in vitro biological models: the first, using ovine abomasal tissue explants, and the second, macrophage cell line cultures (RAW 264.7), to assess its potential as a probiotic strategy against H. contortus. The present study is the first report on the effects of L. acidophilus MVs isolated from free-living rats against pathogens that affect animal production and cellular responses.

2. Materials and Methods

2.1. Cells and Strains

In a previous work, Lactobacillus acidophilus ATCC® 314 (KWIK-STIK, Microbiologics, Charlottesville, VI, USA) and L. acidophilus, a field isolate from the free-living rats’ ileum, captured in the Metropolitan area in Mexico City, Mexico, and characterized using real-time PCR and the API 50CHL system (Biomérieux, Lyon, France) [41], were used.
The macrophage cell line RAW 264.7, gamma NO (-) (ATCC, Charlottesville, VI, USA) was used, and Haemonchus contortus strain third-stage larvae (L3) were obtained from two donor sheep, previously infected with 5000 L3 of H. contortus FESC UNAM strain. Recovery of eggs from H. contortus was performed using the methodology described by Reséndiz et al., 2022 [49].

2.2. Animals

Ovine Columbia breed free-grazing male adults were used to obtain larvae (23.5 ± 2 kg of body weight) (FES Cuautitlán, Cuautitlán Izcalli, State of Mexico, Mexico). Ovines were maintained indoors in metabolic cages and supplied with hay, commercial concentrate, and water ad libitum. The animals were housed in accordance with the care and welfare guidelines of the Mexican Official Rule NOM-051-ZOO-1995 [50]. The ovine abomasal tissue was donated from animals slaughtered in a slaughterhouse.

2.3. Obtaining and Characterization of MVs

Lactobacillus acidophilus strains, both field and ATCC, were grown in 250 mL of Man, Rogosa, Sharpe (MRS) broth (Becton Dickinson, Mexico)/37 °C/24 h in the absence of CO2. In the logarithmic growth phase (3.5 h), 10 µg/mL gentamicin was added to induce the release of MVs, and the mixture was incubated overnight. The culture was centrifuged at 2500× g for 15 min at 4 °C to remove biomass (whole bacteria, WB) and recover the supernatant, which was then filtered through 0.45 µm and 0.22 µm diameter Millipore membranes to remove the Whole bacteria (WB). The filtered supernatant (cell-free supernatant, CFS) was ultracentrifuged at 150,000× g for three hours at 4 °C. The resulting pellet corresponded to MVs, which were resuspended in 1 mL of 10 mM HEPES and frozen at −70 °C until use.

2.4. Characterization of MVs of Lactobacillus acidophilus

2.4.1. Nanoparticle Tracking Analysis

Nanoparticle tracking analysis (NTA) was performed using a Nanosight NS 300 (Malvern Panalytical, Malvern, UK). The 1 mL sample of MVs was diluted 1:100 in 1X phosphate-buffered saline (PBS) (filtered through a 0.22 μm filter). From this sample, an NTA was performed, resulting in the recording of three 30 s videos with an sCMOS camera to determine the size and particle concentration at the National School of Biological Sciences, Santo Tomás Unit, National Polytechnic Institute (IPN).

2.4.2. Transmission Electron Microscopy of MVs

For Transmission Electron Microscopy (TEM), the MVs were resuspended in cacodylate buffer, and 10 to 15 μL was placed on nickel grids that had been previously treated with Formvar and coated with carbon, allowing them to set for 15 min (Electron Microscopy Sciences, USA). Afterwards, the excess sample was removed with filter paper, and the grid was carefully dried. Then, 1% phosphotungstic acid (PTA/ Electron Microscopy Sciences, Sigma-Aldrich, Burlington, MA, USA) was added at pH 6.0 for 90 s. Finally, samples were observed under a transmission electron microscope (JEM-1400, JEOL, Peabody, MA, USA) at the Research and Advanced Studies Center of the National Polytechnic Institute (CINVESTAV), located at the Zacatenco Unit.

2.5. SDS-PAGE

Protein samples were quantified with the Bradford method (Bio-Rad, Hercules, CA, USA) with linear regression and bovine serum albumin (BSA) standard curve. Protein samples (2 µg) of MVs, WB, and CFS from both strains were analyzed by denaturing polyacrylamide gel electrophoresis using a 12% pre-cast acrylamide gel with the Mini-Protean R Tetra Cell 4 Gel System Kit (Bio-Rad, Hercules, CA, USA), following the manufacturer’s instructions. Samples were denatured by boiling in the presence of a reducing agent (2-mercaptoethanol, Sigma-Aldrich, Massachusetts, USA) before gel loading. The dual-color molecular weight marker 1610374TGX (Bio-Rad, California, USA) was used and run at 100 volts for 2.5 h. Subsequently, the gel was stained using a Silver Stain Pierce kit (Thermo Scientific, Walthman, MA, USA) following the manufacturer’s instructions. The electrophoretic run was evaluated using KODAK MI Software Gel-Logic 100 Imaging System (GL 100), System 1.

2.6. Obtaining the L3 Larva Stage from Haemonchus contortus

Fecal samples were obtained directly from the rectum of a male ovine donor. They were cultured in Petri dishes, following the Corticelli–Lai technique for 7 days [51]. Infective larvae were extracted from the fecal material using the Baermann funnel technique [52]. The larvae were cleaned using distilled water, centrifuged at 5000× g, and then exsheathed with 0.187% sodium hypochlorite [52]. Finally, L3 was used for subsequent assays.

2.7. Culture of Ovine Abomasal Explants

The abomasal tissue was obtained from an ovine slaughtered by the care and welfare guidelines of the Mexican Official Rule NOM-033-SAG/ZOO-2014 [50] and was carefully washed with warm Hank’s medium (Corning, NY, USA). Circular sections of approximately 3 cm2 were subsequently cut and placed in six-well culture plates containing 5 mL of warm HANKs, then 5 mL syringes with the needle end removed were placed in the center of each tissue to provide a 13 mm diameter of an isolated zone containing H. contortus larvae, according to the technique described by Jackson et al. in 2004 [53]. MVs (30 μg) in 500 μL of 1X PBS were added to the mucosal surface within the isolation cylinder for the field and ATCC strains and incubated at 37 °C for one hour. Subsequently, 0.5 mL of 1X PBS/1500 H. contortus larvae were introduced into the cylinder, and pressure was applied to the lid of the six-well plate to ensure an effective seal. Tissues with and without larvae were used as positive and negative association controls, respectively. Cultures were incubated for an additional two hours at 37 °C and 5% CO2.

2.8. Recovery of L3 Larvae of H. contortus

After incubation, the syringe cylinders and tissues were washed with a 1X PBS solution in 50 mL conical tubes (wash tube) to remove all larvae not associated with the mucosa. The tissue was placed in a second tube (digestion tube) and digested in 50 mL of a 1% pepsin solution in 1% HCl at 25 °C for 72 h. The number of larvae present in 2% aliquots of each sample was counted using a gridded Petri dish under a stereoscopic microscope (HINOTEK, NSZ-405, Ningbo, China) at 100× [53]. The percentage of association in the tissue (digestion tube) was calculated.

2.9. Histopathology of the Ovine Abomasal Explants

After the experiment was completed, samples were taken from the region delimited by the syringe and fixed in 10% buffered formalin for 24 h. Subsequently, they were subjected to the paraffin technique and stained with hematoxylin and eosin (H&E) for review under a light microscope [26].

2.10. Larval Mortality Assay

A larval mortality assay was performed using 96-well microtiter plates, with 30 μg of MVs from both L. acidophilus strains, distilled water serving as the negative control, and 0.5% ivermectin as the positive control. An aqueous suspension (50 µL) containing 100 ± 15 infective larvae was added to each well. Subsequently, 50 µL of MVs and controls were added to each well individually. The plates were incubated at 25 °C in a humidified chamber for 24 h. The total number of larvae (live or dead) in each well was counted using a microscope [49]. Mortality percentages were estimated using the criteria outlined by Olmedo et al. [54].

2.11. RAW 264.7 Cell Cultures

Cells of the RAW 264.7 line (1 × 106) were cultured in 24-well culture plates with RPMI 1640 medium high in glucose (ATCC) supplemented with 10% fetal bovine serum (GIBCO, New York, NY, USA), 2 mM L-glutamine (GIBCO, New York, USA), and 1% antibiotics (CAISSON, Rexburg, ID, USA). For the negative control, cells were maintained without treatment, and as a positive control, 2 μg of LPS from E. coli O111: B4 (Sigma Aldrich, Massachusetts, USA) was added. MVs (10 μg) of both L. acidophilus strains were used to stimulate the cells, which were then incubated for one hour at 37 °C in a 5% CO2 atmosphere. Following the incubation period, the cells were detached by raking and suspended in 1 mL of Trizol LS Reagent (Thermo Scientific, Massachusetts, USA) to extract RNA, according to the manufacturer’s instructions.

2.12. qPCR

cDNA was obtained using a FastGene Scriptase Basic cDNA Synthesis Kit, NIPPON kit (Nippon Genetics, Tokyo, Japan) according to the manufacturer’s instructions. qPCR for IL-1β and TNF-α was performed using an Agilent Technologies, Stratagene Mx3005P Thermal Cycler, Thermo Scientific, Massachusetts, USA). Primers were designed using Primer3web (v.4.1.0) software [55]; the primer sequences are listed in Table 1. The amplification conditions are briefly described: 1 denaturation cycle of 2 min at 95 °C, followed by 10 s 95 °C, 10 s 60 °C, and 20 s 72 °C for 40 cycles, and melting curves were for 5 s 95 °C, 10 s 60 °C, and 10 s 95 °C. Quantification was performed by relative expression using the hypoxanthine-guanine phosphoribosyltransferase enzyme (HPRT1) as the reference gene, with an annealing temperature of 50 °C.

2.13. Statistical Analysis

Data were analyzed based on the repetitions and data distribution; a one-way analysis of variance (ANOVA) and Tukey’s multiple comparison test were used. All statistical analyses were performed using GraphPad Prism 8 software (GraphPad Software, Inc., San Diego, CA, USA). Statistical significance was established at p < 0.05.

3. Results

3.1. Characterization of MVs by Nanoparticle Tracking Analysis and Transmission Electron Microscopy

MVs from the field isolate of L. acidophilus have a size of 165.6 ± 9.2 nm in diameter at a concentration of 6.27 × 108 particles/mL, and MVs from the ATCC strain of L. acidophilus presented a size of 160.7 ± 11.0 nm at a concentration of 1.65 × 1010 particles/mL. Figure 1A,B show the representative histograms obtained by nanoparticle tracking analysis (NTA) for both strains. From one of the field strain videos, a frame was taken where homogeneity in form and size was observed (Figure 1C). However, there is no significant difference in the size and form of the structures between the two strains; this can be attributed to the coalescence capacity of the MVs during the NTA procedure. In the TEM image (Figure 1D), we observed MVs of the field strain, which had an individual diameter of approximately 100 nm. A double-membrane structure was observed, forming the vesicular structure of the MVs.

3.2. L. acidophilus MVs Carry Multiple Proteins

From the analysis of SDS-PAGE of proteins found within the MVs, whole bacteria (WB), and cell-free supernatants (CFS) using a 12% polyacrylamide gel (Figure 2A), a distinct pattern is observed between the field-isolated and ATCC strains. Furthermore, it has been observed that there are multiple similar molecular weight proteins (approximately 25 to 75 kDa) that match the whole bacteria and the MVs from both strains. It is essential to note that the lowest molecular weight proteins are not included in the CFS. The molecular weights of the proteins obtained from the different runs were possibly identified using the KODAK MI Software Gel-Logic 100 Imaging System (GL 100), System 1 (Figure 2B). In comparison to previous studies [8], proteins associated with probiotic functions (p40 and 045), as well as cell division (FtsZ, DivlB), ABC transporters (ABC transporter ATP-binding and membrane-spanning protein, as well as Glutamine ABC transporter permease protein), and possible bacteriocins (bacteriocin like proteins) were potentially identified [8]. Some of these proteins were observed in MVs of both strains, the whole bacteria, and CFS, and are represented in Table 2.

3.3. Ovine Abomasal Tissue Explants Stimulated with L. acidophilus MVs Decrease Larvae Association

Experiments were performed by stimulating ovine abomasal tissue explants with 30 μg of MVs from the field and ATCC L. acidophilus, which were challenged with 1500 L3 larvae of H. contortus. After counting the larvae and calculating the percentage of association, a significant decrease (p < 0.0001 and p < 0.0085) in the percentage of association (Figure 3) in the groups stimulated with MVs of both strains is shown, which was lower than that of the positive control (without MVs) when a one-way ANOVA statistical test was applied.

3.4. Stimulation with the Field L. acidophilus MVs Increases the Presence of Inflammatory Cells in the Abomasal Tissue

Histological sections were prepared and stained with H&E to evaluate the explants in contact with MVs and larvae. Ovine abomasal tissue was observed, presenting mainly with foci of lymphocytic infiltrate in the submucosa, and to a lesser extent, macrophages (Figure 4). Histopathological examination of the abomasal mucosa without treatment reveals normal autolysis of the villi, consistent with the post-mortem period (Figure 4A). The treated abamosal with the L3 larvae revealed reactive germinal centers at the submucosal level (Figure 4B) as same as with the MVs from L. acidophilus field isolated strain (Figure 4C), with the difference that under 10× and 40× (Figure 4D,E, respectively) objectives, is demonstrating the presence of inflammatory cells infiltrating the interstitium of the crypts and in the lamina propia of the villi (Figure 4F).

3.5. L. acidophilus MVs Do Not Kill the L3 Larvae of H. contortus

To determine whether the decrease in the percentage of association observed was due to the effect of L. acidophilus MVs on L3, a larval mortality assay was performed. In the positive control group treated with 0.05% ivermectin, the highest percentage of L3 death (98%) was observed, while the negative control group treated with water showed less than 10% (Figure 5). The mortality percentages of the groups treated with MVs from both strains were similar (3.78% for ATCC and 4.75% for the field strain) to those of the negative control group, although a significant difference was observed (p < 0.0001; one-way ANOVA) compared to the group treated with ivermectin.

3.6. L. acidophilus MVs Activate Macrophages (RAW 264.7)

When macrophages of the RAW 264.7 cell line (Figure 6A) were stimulated with MVs from both L. acidophilus strains, the cells modified their morphology, exhibiting a greater number of pseudopodia (Figure 6B), which suggests macrophage activation. After incubating the cells for one hour, RNA was extracted, and quantitative PCR (qPCR) was performed. An increase in the expression of IL-1β (Figure 6C) and TNF-α (Figure 6D) was found, compared with the positive control group, which received LPS. In addition, relatively higher messenger expression was observed upon stimulation with L. acidophilus MVs from the field strain compared to those from the ATCC strain.

4. Discussion

Rats are important carriers of pathogenic bacteria that affect both humans and animals, such as Salmonella, Escherichia coli, Campylobacter, and Listeria, among others [56]. However, in most cases, they do not exhibit signs or symptoms of infection, partly due to their microbiota [56,57]. Studies focused on the microbiota of both free-living and laboratory rats describe Lactobacillus as one of the most abundant genera along the gastrointestinal tract [58,59]. Due to the importance of this genus, it was used in the present study.
Numerous studies have reported beneficial effects of L. acidophilus [1,4,5,8,27,28,36]. In the present study, we have demonstrated that MVs from this bacterium could stimulate an immune response in the analyzed biological models.
The production of L. acidophilus MVs was confirmed by TEM and NTA, with diameters of approximately 160 nm, similar to those previously reported by Dean et al. [14] for L. acidophilus ATCC 53544, which ranged from 100 to 150 nm. Studies analyzing proteins carried in MVs of different bacterial genera, both Gram-positive and Gram-negative, have demonstrated the extraordinary capacity of these structures to conform to proteins from the wall or the external membrane of origin, as well as proteins from the cytoplasm or in transit between the periplasm and lumen of MVs during formation [6,60,61]. The proteins carried in the MVs of both L. acidophilus strains were analyzed by SDS-PAGE, which demonstrated that a significant number of protein bands of different molecular weights were shared between them. Dean et al. [14] characterized L. acidophilus ATCC 53,544 MVs and identified more than 80 protein components, including bacteriocins and ABC transporters. In the present study, low-molecular-weight proteins ranging from 10 kDa to 6 kDa were identified, like those reported by Dean as possible bacteriocins, which were named bacteriocin-like substances (BLS) [14,62]. In addition, proteins of 32 kDa and 64 kDa, which, due to their molecular weight, coincided with the cell division protein (DivIB) and FtsZ protein [homologous to eukaryotic tubulin], respectively, are known to interfere with cell division [14,63]. The functions of the 40 kDa and 75 kDa proteins in the complete bacterium are reported to be p40 and p75, respectively, which are associated with cell communication, epithelial adhesion, anti-apoptotic effects, and immunomodulatory capacity [64,65,66]. Likewise, proteins of 54 kDa and 59 kDa were identified, which could correspond to ABC transporters, ATP-binding membrane-spanning proteins, and Glutamine ABC transporter permease proteins, respectively. All of these proteins are important for bacterial metabolism [14,62]. However, none of the proteins reported in this study were sequenced and identified.
In explants of ovine abomasal tissue, the association of L3 of H. contortus with MVs was evaluated. Over the 3 h duration of the experiment, penetration of the larvae into the mucosa was not observed; therefore, for the purposes of this study, we will only refer to an association phenomenon. L. acidophilus MVs from a field isolate and an ATCC reference strain inhibited the association of L3 larvae of H. contortus with the ovine abomasal explant tissue. Huang, 2021, Martín, 2020, and Gao, 2009 reported that bacteriocins purified from both Gram-positive and Gram-negative bacteria have been shown to affect other pathogenic bacterial genera and inhibit viruses and parasites [60,67,68]. For example, AS-48 is a peptide synthesized by Enterococcus faecalis that has a bactericidal effect on many bacteria and reduces the number of Trypanosoma cruzi by causing depolarization of the mitochondrial membrane and favoring the production of reactive oxygen species in the parasite [60,67,68]. Notably, no reports have been recorded on the effects of the bacteriocins present in L. acidophilus MVs on any parasite.
To test the effect of Lactobacillus MVs on the viability of L3 of H. contortus, a larval mortality assay was performed. The MVs did not affect the larva viability, as the percentage of mortality was the same as that of the negative control, all contrary to what was observed with ivermectin, which showed a mortality rate of 98% in the larvae since it is a potent antiparasitic effective against H. contortus [69]. This suggests that the decrease in larval association with abomasal tissue may be due to MVs’ stimulation of the abomasal mucosa rather than their direct effect on the larvae. The metabolic derivatives of Lactobacillus contain various biologically active compounds, including antimicrobial peptides and immune system signaling molecules (PAMPs) [70,71,72], to which the observed effects can be attributed. In 2007, Terefe et al. reported that the abomasal mucosa can synthesize proinflammatory cytokines, including IL-4, IL-5, and IL-13, in response to H. contortus infection [73]. IL-13 favors mucosal contractility and mucus production in the tissue, reducing the mobility of L3 larvae, which contributes to the non-association of the parasite [74].
Ovine abomasal tissue analyzed by histopathology showed the presence of mononuclear cells in the interstitium of the crypts and base of the villi in explants previously stimulated with L. acidophilus MVs. Simpson et al. [75] demonstrated, through histopathological evaluation of ovine abomasal tissue sections from animals infected with L3 of H. contortus, the presence of foci of inflammatory infiltrates confined to the submucosa. Ex vivo studies have described the presence of immune cells in the submucosa of the abomasum without the infiltrate moving to the mucosa. In contrast, the capacity of the MVs in this study to stimulate immune cells favored their migration, which is like the report by Li, 2005, where the supernatants of L. acidophilus cultures contained only cellular structures and metabolic derivatives that favored chemotaxis and proliferation of immune cells as well as angiogenesis in chicken embryonic tissues in vitro [76].
Ovine are generally prone to gastrointestinal parasitism because they feed on pastures contaminated with L3 stage larvae of H. contortus. In Mexico, its prevalence ranges from 17.5% to 57% among free-grazing animals [77,78,79]. In the animals used in the present study, adult nematodes of H. contortus were found in the abomasum of grazing animals, which explains the abundant inflammatory infiltrates found in the histological sections [80]. Constant exposure to H. contortus in sheep enhances the development of resistance to subsequent infections by this parasite and others. This is because the host immune system rapidly rejects the association of L3 by a phenomenon known as immune exclusion, wherein immune cells such as T lymphocytes and mast cells release protein compounds such as galectin and histamine that prevent the establishment of L3 in the crypts of the mucosa [80,81,82] by immunomodulation mechanisms. This phenomenon could explain the observed percentage of L3 association described in the present study, as well as that reported in other in vivo [83], in vitro [53], and ex vivo [81] studies.
The stimulation of the host immune system is a primary function of probiotics and their derivatives. In the present study, it was demonstrated that L. acidophilus MVs from the field strain can stimulate the murine macrophage RAW 264.7 cells. Morphological changes were observed in cells stimulated with both LPS (control+) and MVs, indicating cell activation, such as the extension of pseudopodia, a characteristic feature of this cell line [84]. The expression of transcripts encoding proinflammatory cytokines, such as IL-1β and TNF-α, was identified. Macrophages primarily secrete IL-1β and TNF-α, and these cytokines have a synergistic effect on inflammation in both infectious and non-infectious processes. Their primary effects include chemotaxis of immune cells, cell activation, and stimulation of cytokine production, such as IL-6, IL-8, and MCP-1 [85].
The presence of complete bacteria and some antigens secreted by them activates macrophages to synthesize proinflammatory cytokines [86,87,88]. One of the most studied components is peptidoglycan, the main component of the cell walls of Gram-positive bacteria. As MVs are formed from the elongation of the membrane, they carry structural elements, including those of the cell wall [14], which act as PAMPs responsible for stimulating the cells in vitro. The whole cell of L. acidophilus has been reported to favor the expression of IL-1β in macrophages in vitro [89,90,91]. However, Li et al. found that the CFS of L. acidophilus cells could increase TNF-α expression in chick embryonic tissues [71]. Studies have been performed with the MVs of other strains of Lactobacillus, as is the case with Vargoorani et al., who used MVs derived from L. casei and observed an increase in the production of IL-6, not IL-1β, in cultures of human intestinal epithelial cells [21]. In mice orally administered with L. plantarum, TNF-α, and IL-6 levels decreased [92]. These studies demonstrate that probiotic bacteria and their derivatives can modulate the immune system and the inflammatory response by increasing or decreasing the production of cytokines. Although they all belong to the same genus, not all species act in the same manner.
The results obtained in this study demonstrate that the MVs of L. acidophilus possess a probiotic capacity, stimulating the host immune system, as reported with the use of whole bacteria. Despite this, there is no significant statistical difference between the field-isolated and ATCC strains in the percentage of association of the H. contortus larvae; however, there is a tendency for a decrease in the rate with the field-isolated strain. On the other hand, regarding cytokine expression, there is no statistical difference between the strains; however, a significant difference is observed between the negative control and the field-isolated strain. This could be due to the origin of the strain (wild rat) [56,57], but furthermore, studies are necessary to corroborate this. These results enabled us to consider the potential use of these compounds in preventing and controlling infections. MVs have the advantage of not having the capacity to replicate; therefore, they cannot cause disease and can be administered to immunocompromised patients or patients treated with antibiotics, contrary to what has been reported with the use of probiotic bacteria, where sepsis occurs even after their administration [70,92,93].

5. Conclusions

Lactobacillus acidophilus MVs from the field and the ATCC were shown to have probiotic and immunostimulatory effects on ovine abomasal tissue, decreasing the association with L3 larvae of H. contortus. While in cell culture of a murine macrophage line (RAW 274.6), MVs activated the cells by increasing the expression of proinflammatory cytokine transcripts IL-1β and TNF-α. No statistical difference was found between the effects of the two strains; however, a more pronounced trend in the effect was observed with the field strain.

Author Contributions

Conceptualization, C.G.-R.; methodology, P.I.P.-M., V.G.-E., C.Á.-G., C.D.L.-S., R.I.H.-P., and F.R.G.-D.; software, A.V.-R.; validation, P.I.P.-M. and C.G.-R.; formal analysis, P.I.P.-M., and E.M.-F.; investigation, P.I.P.-M.; resources, C.G.-R., H.R.-Á., R.I.H.-P. and M.D.l.G.-A.; data curation, P.I.P.-M.; writing—original draft preparation, C.G.-R.; writing—review and editing, P.I.P.-M., H.R.-Á. and C.G.-R.; visualization, P.I.P.-M.; supervision, C.G.-R. and H.R.-Á.; project administration, C.G.-R.; funding acquisition, C.G.-R. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Programa de Apoyo a Proyectos de Investigación e Innovación Tecnológica (PAPIIT/IT201521 and IT201824) and the Programa Interno de Cátedras de Investigación 2024/PICI-CI2465, all programs of the Universidad Nacional Autónoma de México (UNAM).

Institutional Review Board Statement

The research project was conducted by the ethical and humane guidelines governing experimentation with animals, as described in NOM-062-ZOO-1999. The Internal Committee approved the animal study protocol for the Care and Use of Experimental Animals of the Facultad de Estudios Superiores Cuautitlán [CICUAE-FESC] of UNAM [registration number: C 23_12/ approved on 18 May 2023.].

Data Availability Statement

The data from the results obtained in this investigation are available on the ZENODO repository at https://doi.org/10.5281/zenodo.10999677.

Acknowledgments

We thank the biologists. María de Lourdes Rojas Morales from the Advanced Microscopy Laboratory for her support with the transmission electron microscopy micrographs, as well as the Cell Biology Department, where the cell cultures were performed, both from the Centro de Investigación y de Estudios Avanzados del IPN (CINVESTAV). Postdoctoral fellowship granted to Pamela Izaret Pérez Martínez., carried out thanks to the UNAM Postdoctoral Fellowship Program (POSDOC).

Conflicts of Interest

The authors declare that they have no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
MVsMicrovesicles
GITGastrointestinal tract
LABLactic acid bacteria
L3Stage 3 larva
WBWhole bacteria
CFSCell-free supernatant
BLSBacteriocin-like substances
FIField Isolated

References

  1. Santacroce, L.; Charitos, I.A.; Bottalico, L. A successful history: Probiotics and their potential as antimicrobials. Expert Rev. Anti Infect. Ther. 2019, 17, 635–645. [Google Scholar] [CrossRef] [PubMed]
  2. Ibnou-Zekri, N.; Blum, S.; Schiffrin, E.J.; von der Weid, T. Divergent patterns of colonization and immune response elicited from two intestinal Lactobacillus strains that display similar properties in vitro. Infect. Immun. 2013, 71, 428–436. [Google Scholar] [CrossRef] [PubMed]
  3. Behnsen, J.; Sassone-Corsi, M.; Raffatellu, M. Probiotics: Properties, Examples, and Specific Applications. Cold Spring Harb. Perspect. Med. 2013, 3, a010074. [Google Scholar] [CrossRef]
  4. Morelli, L.; Capurso, L. FAO/WHO Guidelines on Probiotics: 10 Years Later. J. Clin. Gastroenterol. 2001, 46, S1–S2. [Google Scholar] [CrossRef]
  5. Corthesy, B.; Gaskins, H.R.; Mercenier, A. Cross-talk between probiotic bacteria and the host immune system. J. Nutr. 2007, 137 (Suppl. S2), 781S–790S. [Google Scholar] [CrossRef]
  6. Ruiz, L.; Hevia, A.; Bernardo, D.; Margolles, A.; Sánchez, B. Extracellular molecular effectors mediating probiotic attributes. FEMS Microbiol. Lett. 2014, 359, 1–11. [Google Scholar] [CrossRef] [PubMed]
  7. Al-Nedawi, K.; Mian, M.F.; Hossain, N.; Karimi, K.; Mao, Y.K.; Forsythe, P.; Min, K.K.; Stanisz, A.M.; Kunze, W.A.; Bienenstock, J. Gut commensal microvesicles reproduce parent bacterial signals to host immune and enteric nervous systems. FASEB J. 2015, 29, 684–695. [Google Scholar] [CrossRef]
  8. Kulp, A.; Kuehn, M.J. Biological functions and biogenesis of secreted bacterial outer membrane vesicles. Annu. Rev. Microbiol. 2010, 64, 163–184. [Google Scholar] [CrossRef]
  9. Toyofuku, M.; Nomura, N.; Eberl, L. Types and origins of bacterial membrane vesicles. Nat. Rev. Microbiol. 2019, 17, 13–24. [Google Scholar] [CrossRef]
  10. Wang, X.; Eagen, W.J.; Lee, J.C. Orchestration of human macrophage NLRP3 inflammasome activation by Staphylococcus aureus extracellular vesicles. Proc. Natl. Acad. Sci. USA 2020, 117, 3174–3184. [Google Scholar] [CrossRef]
  11. Choi, J.H.; Moon, C.M.; Shin, T.S.; Kim, E.K.; McDowell, A.; Jo, M.K.; Joo, Y.H.; Kim, S.E.; Jung, H.K.; Shim, K.N.; et al. Lactobacillus paracasei-derived extracellular vesicles attenuate the intestinal inflammatory response by augmenting the endoplasmic reticulum stress pathway. Exp. Mol. Med. 2020, 52, 423–437. [Google Scholar] [CrossRef] [PubMed]
  12. May, A.L.; Corona, A.I.; Jiménez, A.L.L.; Cortés, N.G.; Vera, R.J. Sensibilidad y Resistencia a Antibióticos de Cepas Probióticas Empleadas en Productos Comerciales. Eur. Sci. J. 2020, 16, 43. [Google Scholar] [CrossRef]
  13. Hao, H.; Zhang, X.; Tong, L.; Liu, Q.; Liang, X.; Bu, Y.; Gong, P.; Liu, T.; Zhang, L.; Xia, Y.; et al. Effect of Extracellular Vesicles Derived From Lactobacillus plantarum Q7 on Gut Microbiota and Ulcerative Colitis in Mice. Front. Immunol. 2021, 12, 777147. [Google Scholar] [CrossRef] [PubMed]
  14. Dean, S.N.; Leary, D.H.; Sullivan, C.J.; Oh, E.; Walper, S.A. Isolation and characterization of Lactobacillus-derived membrane vesicles. Sci. Rep. 2019, 9, 877. [Google Scholar] [CrossRef]
  15. West, C.L.; Stanisz, A.M.; Mao, Y.K.; Champagne-Jorgensen, K.; Bienenstock, J.; Kunze, W.A. Microvesicles from Lactobacillus reuteri (DSM-17938) completely reproduce modulation of gut motility by bacteria in mice. PLoS ONE 2020, 15, e0225481. [Google Scholar] [CrossRef]
  16. Domínguez, A.P.; Martínez, J.H.; Martínez, D.C.; Coluccio, F.; Piuri, M.; Pérez, O.E. Lactobacillus casei BL23 Produces Microvesicles Carrying Proteins That Have Been Associated with Its Probiotic Effect. Front. Microbiol. 2017, 8, 1783. [Google Scholar] [CrossRef]
  17. Jan, A.T. Outer Membrane Vesicles (OMVs) of Gram-negative Bacteria: A Perspective Update. Front. Microbiol. 2017, 8, 1053. [Google Scholar] [CrossRef] [PubMed]
  18. Wang, X.; Thompson, C.D.; Weidenmaier, C.; Lee, J.C. Release of Staphylococcus aureus extracellular vesicles and their application as a vaccine platform. Nat. Commun. 2018, 9, 1379. [Google Scholar] [CrossRef]
  19. Patten, D.A.; Hussein, E.; Davies, S.P.; Humphreys, P.N.; Collett, A. Commensal-derived OMVs elicit a mild proinflammatory response in intestinal epithelial cells. Microbiology 2017, 163, 702–711. [Google Scholar] [CrossRef]
  20. Kang, C.S.; Ban, M.; Choi, E.J.; Moon, H.G.; Jeon, J.S.; Kim, D.K.; Park, S.K.; Jeon, S.G.; Roh, T.Y.; Myung, S.J.; et al. Extracellular vesicles derived from gut microbiota, especially Akkermansia muciniphila, protect the progression of dextran sulfate sodium-induced colitis. PLoS ONE 2018, 8, e76520. [Google Scholar] [CrossRef]
  21. Vargoorani, M.E.; Modarressi, M.H.; Vaziri, F.; Motevaseli, E.; Siadat, S.D. Stimulatory effects of Lactobacillus casei derived extracellular vesicles on toll-like receptor 9 gene expression and cytokine profile in human intestinal epithelial cells. J. Diabetes Metab. Disord. 2020, 19, 223–231. [Google Scholar] [CrossRef] [PubMed]
  22. Chang, C.M.; Awanye, A.M.; Marsay, L.; Dold, C.; Pollard, A.J.; Rollier, C.S.; Feavers, I.M.; Maiden, M.C.J.; Derrick, J.P. Application of a Neisseria meningitidis antigen microarray to identify candidate vaccine proteins from a human Phase I clinical trial. Vaccine 2022, 40, 3835–3842. [Google Scholar] [CrossRef]
  23. Leitner, D.R.; Lichtenegger, S.; Temel, P.; Zingl, F.G.; Ratzberger, D.; Roier, S.; Schild-Prüfert, K.; Feichter, S.; Reidl, J.; Schild, S.A. A combined vaccine approach against Vibrio cholerae and ETEC based on outer membrane vesicles. Front. Microbiol. 2015, 6, 823. [Google Scholar] [CrossRef] [PubMed]
  24. Nieves, W.; Petersen, H.; Judy, B.M.A. Burkholderia pseudomallei outer membrane vesicle vaccine provides protection against lethal sepsis. Clin. Vaccine Immunol. 2014, 21, 747–754. [Google Scholar] [CrossRef]
  25. Ayalew, S.; Confer, A.W.; Shrestha, B.; Wilson, A.E.; Montelongo, M. Proteomic analysis and immunogenicity of Mannheimia haemolytica vesicles. Clin. Vaccine Immunol. 2013, 20, 191–196. [Google Scholar] [CrossRef]
  26. De la Garza, M.; González, C.; Suárez, F.; Tenorio, V.; Trigo, F. Biológico Vacunal Elaborado a Partir de Microvesículas (MVs) de Mannheimia haemolytica Serotipo A2 de Administración Intranasal en Ovinos. Mexico Pathent Nomber 341611. IMPI 2016. Available online: https://siga.impi.gob.mx/newSIGA/content/common/principal.jsf (accessed on 22 April 2025).
  27. Dhama, K.; Verma, V.; Sawant, P.; Tiwari, R.; Vaid, R.; Chauhan, R. Applications of probiotics in poultry: Enhancing immunity and beneficial effects on production performances and health: A review. J. Immunol. 2011, 13, 1–19. [Google Scholar]
  28. Hoseinifar, S.H.; Sun, Y.Z.; Wang, A.; Zhou, Z. Probiotics as means of diseases control in aquaculture, a review of current knowledge and future perspectives. Front. Microbiol. 2018, 9, 2429. [Google Scholar] [CrossRef]
  29. Di Gioia, D.; Biavati, B. Probiotics and Prebiotics in Animal Health and Food Safety Switzerland; Springer International Publishing: Berlin/Heidelberg, Germany, 2018; Volume 273. [Google Scholar] [CrossRef]
  30. Zhong, Y.; Wang, S.; Di, H.; Deng, Z.; Liu, J.; Wang, H. Gut health benefit and application of postbiotics in animal production. J. Anim. Sci. Biotechnol. 2022, 13, 38. [Google Scholar] [CrossRef] [PubMed]
  31. Raheem, A.; Liang, L.; Zhang, G.; Cui, S. Modulatory Effects of Probiotics During Pathogenic Infections with Emphasis on Immune Regulation. Front. Immunol. 2021, 12, 616713. [Google Scholar] [CrossRef]
  32. Zhang, R.; Zhou, M.; Tu, Y.; Zhang, N.F.; Deng, K.D.; Ma, T.; Diao, Q.Y. Effect of oral administration of probiotics on growth performance, apparent nutrient digestibility and stress-related indicators in Holstein calves. J. Anim. Physiol. Anim. Nutr. 2015, 100, 33–38. [Google Scholar] [CrossRef]
  33. Xu, H.; Huang, W.; Hou, Q.; Kwok, L.Y.; Sun, Z.; Ma, H.; Zhao, F.; Lee, Y.K.; Zhang, H. The effects of probiotics administration on the milk production, milk components and fecal bacteria microbiota of dairy cows. Sci. Bull. 2017, 62, 767–774. [Google Scholar] [CrossRef] [PubMed]
  34. Yin, Q.Q.; Chang, J.; Zuo, R.Y.; Chen, L.Y.; Chen, Q.X.; Wei, X.Y.; Guan, Q.F.; Sun, J.W.; Zheng, Q.H.; Yang, X.; et al. Effect of the transformed lactobacillus with phytase gene on pig production performance, nutrient digestibility, gut microbes, and serum biochemical indexes. Asian-Australas J. Anim. Sci. 2010, 23, 246–252. [Google Scholar] [CrossRef]
  35. Xin, J.; Zeng, D.; Wang, H.; Sun, N.; Zhao, Y.; Dan, Y.; Pan, K.; Jing, B.; Ni, X. Probiotic Lactobacillus johnsonii BS15 Promotes Growth Performance, Intestinal Immunity, and Gut Microbiota in Piglets. Probiotics Antimicro. Prot. 2020, 12, 184–193. [Google Scholar] [CrossRef]
  36. Yang, J.; Wang, C.; Huang, K.; Zhang, M.; Wang, J.; Pan, X. Compound Lactobacillus sp. administration ameliorates stress and body growth through gut microbiota optimization on weaning piglets. Appl. Microbiol. Biotechnol. 2020, 104, 6749–6765. [Google Scholar] [CrossRef]
  37. Iraqi, E.K.G.; Fayed, R.H. Effect of yeast as feed supplement on behavioural and productive performance of broiler chickens. J. Life Sci. 2012, 9, 4026–4031. [Google Scholar]
  38. Forte, C.; Manuali, E.; Abbate, Y.; Papa, P.; Vieceli, L.; Tentellini, M.; Trabalza, M.; Moscati, L. Dietary Lactobacillus acidophilus positively influences growth performance, gut morphology, and gut microbiology in rurally reared chickens. Poult. Sci. 2018, 97, 930–936. [Google Scholar] [CrossRef]
  39. Anee, I.J.; Alam, S.; Begum, R.A.; Shahjahan, R.; Khandaker, A. The role of probiotics on animal health and nutrition. J. Basic Appl. Zool. 2021, 82, 52. [Google Scholar] [CrossRef]
  40. Jensen, H.; Grimmer, S.; Naterstad, K.; Axelsson, L. In vitro testing of commercial and potential probiotic lactic acid bacteria. Int. J. Food Microbiol. 2012, 153, 216–222. [Google Scholar] [CrossRef]
  41. Lonngi, C. Evaluación del Efecto de Microvesículas (MVs) de Bacterias Ácido Lácticas (BAL), en Cultivos de Salmonella typhimurium ATCC 154 y Escherichia coli de Campo. Bachelor’s Degree, Universidad Nacional Autónoma de México, Mexico City, Mexico, 2022. Available online: https://tesiunam.dgb.unam.mx/F/UE2HK7UPD3Q2NV8BG4VCT8GNALMUPXXVYPVIFF5225NLCRDT3A-40114?func=findb&local_base=TES01&request=cristal+dafne+lonngi+sosa&find_code=WAT&adjacent=N&filter_code_2=WYR&filter_request_2=&filter_code_3=WYR&filter_request_3= (accessed on 22 April 2025).
  42. Zhang, S.D.; Lin, G.H.; Han, J.R.; Lin, Y.W.; Wang, F.Q.; Lu, D.C.; Xie, J.X.; Zhao, J.X. Digestive Tract Morphology and Gut Microbiota Jointly Determine an Efficient Digestive Strategy in Subterranean Rodents: Plateau Zokor. Animals 2022, 12, 2155. [Google Scholar] [CrossRef]
  43. He, W.Q.; Xiong, Y.Q.; Ge, J.; Chen, Y.X.; Chen, X.J.; Zhong, X.S.; Ou, Z.J.; Gao, Y.H.; Cheng, M.J.; Mo, Y.; et al. Composition of gut and oropharynx bacterial communities in Rattus norvegicus and Suncus murinus in China. BMC Vet. Res. 2020, 16, 413. [Google Scholar] [CrossRef]
  44. Desvars, A.; Ruppitsch, W.; Lepuschitz, S.; Szostak, M.P.; Spergser, J.; Feßler, A.T.; Schwarz, S.; Monecke, S.; Ehricht, R.; Walzer, C.; et al. Urban brown rats (Rattus norvegicus) as possible source of multidrug-resistant Enterobacteriaceae and meticillin-resistant Staphylococcus spp. Vienna, Austria, 2016 and 2017. Euro Surveill. 2019, 24, 1900149. [Google Scholar] [CrossRef]
  45. Arsenopoulos, K.V.; Fthenakis, G.C.; Katsarou, E.I.; Papadopoulos, E. Haemonchosis: A challenging parasitic infection of sheep and goats. Animals 2021, 11, 363. [Google Scholar] [CrossRef] [PubMed]
  46. Besier, R.B.; Kahn, L.P.; Sargison, N.D.; Van, J.A. The pathophysiology, ecology and epidemiology of Haemonchus contortus infection in small ruminants. Adv. Parasitol. 2016, 93, 95–143. [Google Scholar] [CrossRef]
  47. Emery, D.L.; Hunt, P.W.; Leo, F.L.J. Haemonchus contortus: The then and now, and where to from here? Int. J. Parasitol. 2016, 46, 755–769. [Google Scholar] [CrossRef] [PubMed]
  48. Adduci, I.; Sajovitz, F.; Hinney, B.; Lichtmannsperger, K.; Joachim, A.; Wittek, T.; Yan, S. Haemonchosis in Sheep and Goats, Control Strategies and Development of Vaccines against Haemonchus contortus. Animals 2022, 12, 2339. [Google Scholar] [CrossRef]
  49. Reséndiz, G.; Higuera, R.I.; Lara, A.; González, R.; Cortes, J.A.; González, M.; Mendoza, P.; Romero, S.G.; Olmedo, A. In Vitro Anthelmintic Activity of a Hydroalcoholic Extract from Guazuma ulmifolia Leaves against Haemonchus contortus. Pathogens 2022, 11, 1160. [Google Scholar] [CrossRef]
  50. Gobierno de México/ SENASICA. Available online: https://www.gob.mx/senasica/documentos/nom-051-zoo-1995 (accessed on 26 March 2025).
  51. Corticelli, B.; Lai, M. Ricerche sulla tecnica di coltura delle larve infestive degli strongili gastro-intestinali del bovino. Acta Med. Vet. 1963, 9, 347–357. [Google Scholar]
  52. Mesquita, J.R.; Mega, C.; Coelho, C.; Cruz, R.; Vala, H.; Estebez, S.; Santos, C.; Vasconcelos, C. EBC series on diagnostic parasitology part 3: The Baermann technique. Vet. Nurs. J. 2017, 8, 558–562. [Google Scholar] [CrossRef]
  53. Jackson, F.; Greer, A.W.; Huntley, J.; McAnulty, R.W.; Bartley, D.J.; Stanley, A.; Stenhouse, L.; Stankiewicz, M.; Sykes, A.R. Studies using Teladorsagia circumcincta in an in vitro direct challenge method using abomasal tissue explants. Vet. Parasitol. 2004, 124, 73–89. [Google Scholar] [CrossRef]
  54. Olmedo, A.; Rojo, R.; Zamilpa, A.; Mendoza, P.; Arece, J.; López, M.E.; von Son-de Fernex, E. In vitro larvicidal effect of a hydroalcoholic extract from Acacia cochliacantha leaf against ruminant parasitic nematodes. Vet. Res. Commun. 2017, 41, 227–232. [Google Scholar] [CrossRef]
  55. Rozen, S.; Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 2000, 132, 365–386. [Google Scholar] [CrossRef] [PubMed]
  56. Meerburg, B.G.; Singleton, G.R.; Kijlstra, A. Rodent-borne diseases and their risks for public health. Crit. Rev. Microbiol. 2009, 35, 221–270. [Google Scholar] [CrossRef] [PubMed]
  57. Čoklo, M.; Maslov, D.R.; Kraljević, S. Modulation of gut microbiota in healthy rats after exposure to nutritional supplements. Gut Microbes 2020, 12, 1–28. [Google Scholar] [CrossRef]
  58. Brooks, S.P.; McAllister, M.; Sandoz, M.; Kalmokoff, M.L. Culture-independent phylogenetic analysis of the faecal flora of the rat. Can. J. Microbiol. 2003, 49, 589–601. [Google Scholar] [CrossRef]
  59. Li, D.; Chen, H.; Mao, B.; Yang, Q.; Zhao, J.; Gu, Z.; Zhang, H.; Chen, Y.Q.; Chen, W. Microbial Biogeography and Core Microbiota of the Rat Digestive Tract. Sci. Rep. 2017, 7, 45840. [Google Scholar] [CrossRef]
  60. Gao, B.; Rodriguez, M.d.C.; Lanz, H.; Zhu, S. AdDLP, a bacterial defensin-like peptide, exhibits anti-Plasmodium activity. Biochem. Biophys. Res. Commun. 2009, 387, 393–398. [Google Scholar] [CrossRef]
  61. Collins, S.M.; Nice, J.B.; Chang, E.H.; Brown, A.C. Size Exclusion Chromatography to Analyze Bacterial Outer Membrane Vesicle Heterogeneity. Journal of Visualized Experiments. Vis. Exp. 2021, 169, e62429. [Google Scholar] [CrossRef]
  62. Dean, S.N.; Rimmer, M.A.; Turner, K.B.; Phillips, D.A.; Caruana, J.C.; Hervey, W.J., 4th; Leary, D.H.; Walper, S.A. Lactobacillus acidophilus Membrane Vesicles as a Vehicle of Bacteriocin Delivery. Front. Microbiol. 2020, 11, 710. [Google Scholar] [CrossRef]
  63. Margolin, W. FtsZ and the division of prokaryotic cells and organelles. Nat. Rev. Mol. Cell Biol. 2005, 6, 862–871. [Google Scholar] [CrossRef]
  64. Bäuerl, C.; Coll, J.M.; Tarazona, C.; Pérez, G. Lactobacillus casei extracellular vesicles stimulate EGFR pathway likely due to the presence of proteins P40 and P75 bound to their surface. Sci. Rep 2020, 10, 19237. [Google Scholar] [CrossRef]
  65. Raman, M.; Ambalam, P.; Kondepudi, K.K.; Pithva, S.; Kothari, C.; Patel, A.T.; Purama, R.K.; Dave, J.M.; Vyas, B.R. Potential of probiotics, prebiotics and synbiotics for management of colorectal cancer. Gut Microbes 2013, 4, 181–192. [Google Scholar] [CrossRef] [PubMed]
  66. Claes, I.J.; Schoofs, G.; Regulski, K.; Courtin, P.; Chapot, M.P.; Rolain, T.; Hols, P.; von Ossowski, I.; Reunanen, J.; de Vos, W.M.; et al. Genetic and biochemical characterization of the cell wall hydrolase activity of the major secreted protein of Lactobacillus rhamnosus GG. PLoS ONE 2012, 7, e31588. [Google Scholar] [CrossRef]
  67. Huang, F.; Teng, K.; Liu, Y. Bacteriocins: Potential for Human Health. Oxid. Med. Cell. Longev. 2021, 10, 5518825. [Google Scholar] [CrossRef] [PubMed]
  68. Martín, R.; Cebrián, R.; Maqueda, M.; Romero, D.; Rosales, M.J.; Sánchez, M.; Marín, C. Assessing the effectiveness of AS-48 in experimental mice models of Chagas’ disease. J. Antimicrob. Chemother. 2020, 75, 1537–1545. [Google Scholar] [CrossRef] [PubMed]
  69. Puspitasari, S.; Farajallah, A.; Sulistiawati, E.; Muladno. Effectiveness of Ivermectin and Albendazole against Haemonchus contortus in Sheep in West Java, Indonesia. Trop. Life. Sci. Res. 2016, 27, 135–144. [Google Scholar]
  70. Moradi, M.; Kousheh, S.A.; Almasi, H.; Alizadeh, A.; Guimarães, J.T.; Yılmaz, N.; Lotfi, A. Postbiotics produced by lactic acid bacteria: The next frontier in food safety. Compr. Rev. Food. Sci. Food Saf. 2020, 19, 3390–3415. [Google Scholar] [CrossRef]
  71. Moradi, M.; Mardani, K.; Tajik, H. Characterization and application of postbiotics of Lactobacillus spp. on Listeria monocytogenes in vitro and in food models. LWT 2019, 111, 457–464. [Google Scholar] [CrossRef]
  72. Rajakovich, L.J.; Balskus, E.P. Metabolic functions of the human gut microbiota: The role of metalloenzymes. Nat. Prod. Rep. 2019, 36, 593–625. [Google Scholar] [CrossRef]
  73. Terefe, G.; Lacroux, C.; Andreoletti, O.; Grisez, C.; Prevot, F.; Bergeaud, J.P.; Penicaud, J.; Rouillon, V.; Gruner, L.; Brunel, J.C.; et al. Immune response to Haemonchus contortus infection in susceptible (INRA 401) and resistant (Barbados Black Belly) breeds of lambs. Parasite Immunol. 2007, 29, 415–424. [Google Scholar] [CrossRef]
  74. Shepherd, E.; Greiner, S.P.; Russ, B.; Bowdridge, S.A. Interleukin-13 induces paralysis of Haemonchus contortus larvae in vitro. Parasite Immunol. 2020, 42, e12758. [Google Scholar] [CrossRef]
  75. Simpson, H.V.; Umair, S.; Hoang, V.C.; Savoian, M.S. Histochemical study of the effects on abomasal mucins of Haemonchus contortus or Teladorsagia circumcincta infection in lambs. Vet. Parasitol. 2016, 226, 210–221. [Google Scholar] [CrossRef] [PubMed]
  76. Li, W.I.; Brackett, B.G.; Halper, J. Culture supernatant of Lactobacillus acidophilus stimulates proliferation of embryonic cells. Exp. Biol. Med. 2005, 230, 494–500. [Google Scholar] [CrossRef] [PubMed]
  77. Hernández, S.; Segura, I.; Olivares, P.J.; Almazán, M.T. Prevalencia de nematodos gastrointestinales en ovinos en pastoreo en la parte alta del MPIO. de Cuetzala del Progreso, Guerrero-México. Redvet 2007, 8, 1–7. Available online: https://www.researchgate.net/publication/26475878_Prevalencia_de_nematodos_gastrointestinales_en_ovinos_en_pastoreo_en_la_parte_alta_del_MPIO_De_Cuetzala_del_Progreso_Guerrero-Mexico (accessed on 22 April 2025).
  78. Solís, J.; Gaxiola, S.; Enríquez, I.; Portillo, J.; López, G.; Castro, N. Factores ambientales asociados a la prevalencia de Haemonchus spp en corderos de la zona centro de Sinaloa. Abanico Vet. 2021, 11, 2021–2049. [Google Scholar] [CrossRef]
  79. González, R.; Córdova, C.; Torres, G.; Mendoza, P.; Arece, J. Prevalencia de parásitos gastrointestinales en ovinos sacrificados en un rastro de Tabasco, México. Vet. México 2011, 42, 125–135. [Google Scholar]
  80. Balic, A.; Cunningham, C.P.; Meeusen, E.N. Eosinophil interactions with Haemonchus contortus larvae in the ovine gastrointestinal tract. Parasite Immunol. 2006, 28, 107–115. [Google Scholar] [CrossRef]
  81. Kemp, J.M.; Robinson, N.A.; Meeusen, E.N.; Piedrafita, D.M. The relationship between the rapid rejection of Haemonchus contortus larvae with cells and mediators in abomasal tissues in immune sheep. Int. J. Parasitol. 2009, 39, 1589–1594. [Google Scholar] [CrossRef]
  82. Yang, X.; Khan, S.; Zhao, X.; Zhang, J.; Nisar, A.; Feng, X. Suppression of hyaluronidase reduces invasion and establishment of Haemonchus contortus larvae in sheep. J. Vet. Res. 2020, 51, 106. [Google Scholar] [CrossRef]
  83. Miller, H.R.; Jackson, F.; Newlands, G.; Appleyard, W.T. Immune exclusion, a mechanism of protection against the ovine nematode Haemonchus contortus. Res. Vet. Sci. 1983, 35, 357–363. [Google Scholar] [CrossRef]
  84. Xiaoyan, X.; Hongxia, S.; Jiamin, G.; Huicheng, C.; Ye, L.; Qiang, X. Antimicrobial peptide HI-3 from Hermetia illucens alleviates inflammation in lipopolysaccharide-stimulated RAW 264.7 cells via suppression of the nuclear factor kappa-B signaling pathway. Microbiol. Immunol. 2023, 67, 32–43. [Google Scholar] [CrossRef]
  85. Weber, A.; Wasiliew, P.; Kracht, M. Interleukin-1 (IL-1) pathway. Sci. Signal. 2020, 105, 32–43. [Google Scholar] [CrossRef] [PubMed]
  86. Ellis, T.N.; Leiman, S.A.; Kuehn, M.J. Naturally produced outer membrane vesicles from Pseudomonas aeruginosa elicit a potent innate immune response via combined sensing of both lipopolysaccharide and protein components. Infect. Immun. 2010, 78, 3822–3831. [Google Scholar] [CrossRef]
  87. Briaud, P.; Carroll, R.K. Extracellular Vesicle Biogenesis and Functions in Gram-Positive Bacteria. Infect. Immun. 2020, 88, e00433-20. [Google Scholar] [CrossRef] [PubMed]
  88. Dinarello, C.A. Descripción general de la familia IL-1 en la inflamación innata y la inmunidad adquirida. Immunol. Rev. 2018, 281, 8–27. [Google Scholar] [CrossRef] [PubMed]
  89. Matsubara, V.H.; Ishikawa, K.H.; Ando, E.S.; Bueno, B.; Nakamae, A.E.M.; Mayer, M.P.A. Probiotic Bacteria Alter Pattern-Recognition Receptor Expression and Cytokine Profile in a Human Macrophage Model Challenged with Candida albicans and Lipopolysaccharide. Front. Microbiol. 2017, 8, 2280. [Google Scholar] [CrossRef]
  90. Yanagihara, S.; Goto, H.; Hirota, T.; Fukuda, S.; Ohno, H.; Yamamoto, N. Lactobacillus acidophilus L-92 Cells Activate Expression of Immunomodulatory Genes in THP-1 Cells. Biosci. Microbiota Food Health 2014, 33, 157–164. [Google Scholar] [CrossRef]
  91. Le, B.; Anh, P.T.N.; Yang, S.H. Enhancement of the anti-inflammatory effect of mustard kimchi on RAW 264.7 macrophages by the Lactobacillus plantarum fermentation-mediated generation of phenolic compound derivatives. Foods 2020, 9, 181. [Google Scholar] [CrossRef]
  92. Vinderola, G.; Sanders, M.E.; Salminen, S. The Concept of Postbiotics. Foods 2022, 11, 1077. [Google Scholar] [CrossRef]
  93. Tsilingiri, K.; Barbosa, T.; Penna, G.; Caprioli, F.; Sonzogni, A.; Viale, G.; Rescigno, M. Probiotic and postbiotic activity in health and disease: Comparison on a novel polarised ex-vivo organ culture model. Gut 2012, 61, 1007–1015. [Google Scholar] [CrossRef]
Microorganisms 13 01341 g001
Figure 1. Characterization of extracellular microvesicles (MVs) secreted by Lactobacillus acidophilus. Concentration and size distribution [nm] of MVs produced by field (A) and ATCC (B) L. acidophilus, where the red hihglights correspond to the dispersion of the data meanwhile the blue numbers are the size of the nanoparticles. (C) Representative frame of one of the videos of L. acidophilus in NanoSight, where MVs are observed (white arrow). (D) TEM micrograph of MVs produced by field L. acidophilus stained with phosphotungstic acid (white arrow).
Figure 1. Characterization of extracellular microvesicles (MVs) secreted by Lactobacillus acidophilus. Concentration and size distribution [nm] of MVs produced by field (A) and ATCC (B) L. acidophilus, where the red hihglights correspond to the dispersion of the data meanwhile the blue numbers are the size of the nanoparticles. (C) Representative frame of one of the videos of L. acidophilus in NanoSight, where MVs are observed (white arrow). (D) TEM micrograph of MVs produced by field L. acidophilus stained with phosphotungstic acid (white arrow).
Microorganisms 13 01341 g001
Microorganisms 13 01341 g002
Figure 2. Protein composition of different cell fractions of Lactobacillus acidophilus (A) SDS-PAGE gel (12%), stained with silver, of proteins from both field (FI) and ATCC strains of L. acidophilus from MVs (FI MVS and ATCC MVS), whole bacteria (FI WB and ATCC WB), and cell-free supernatant (FI CFS and ATCC CFS). In all lanes, 25 μg of protein was placed. (B) SDS-PAGE 12% gel analysis, with KODAK Gel-Logic 100 system software, where proteins detected by the software are marked with white lines.
Figure 2. Protein composition of different cell fractions of Lactobacillus acidophilus (A) SDS-PAGE gel (12%), stained with silver, of proteins from both field (FI) and ATCC strains of L. acidophilus from MVs (FI MVS and ATCC MVS), whole bacteria (FI WB and ATCC WB), and cell-free supernatant (FI CFS and ATCC CFS). In all lanes, 25 μg of protein was placed. (B) SDS-PAGE 12% gel analysis, with KODAK Gel-Logic 100 system software, where proteins detected by the software are marked with white lines.
Microorganisms 13 01341 g002
Microorganisms 13 01341 g003
Figure 3. Percentage of Haemonchus contortus L3 association in ovine abomasal tissue. Association of H. contortus L3 larvae in abomasal tissue of ovine, where abomasal mucosa only (CTRL-), without stimulation of MVs (CTRL+), and stimulated with 30 μg of MVs of L. acidophilus field strain (FI) and ATCC strain, a significant decrease in the percentage of association is appreciated. One-way ANOVA p = 0.001 (****).
Figure 3. Percentage of Haemonchus contortus L3 association in ovine abomasal tissue. Association of H. contortus L3 larvae in abomasal tissue of ovine, where abomasal mucosa only (CTRL-), without stimulation of MVs (CTRL+), and stimulated with 30 μg of MVs of L. acidophilus field strain (FI) and ATCC strain, a significant decrease in the percentage of association is appreciated. One-way ANOVA p = 0.001 (****).
Microorganisms 13 01341 g003
Microorganisms 13 01341 g004
Figure 4. Sections of ovine abomasal tissue stimulated with MV of Lactobacillus acidophilus stained with H&E. Ovine abomasal tissue. (A) Unstimulated tissue (Ctrl−). (B) Tissue challenged with 1500 L3 of H. contortus (Ctrl+). (C) Tissue stimulated with MVS of L. acidophilus field strain. (D) Approach 10× to the tissue stimulated with MVS of L. acidophilus field strain. Mucosal-associated lymphoid tissue in (B–D) panels is marked with an oval. (E) With a 40× objective, the presence of lymphocytic cells and some macrophages in the submucosal area of the tissue challenged with L3 of H. contortus, and (F) infiltrate between the crypts of the tissue stimulated with L. acidophilus MVs from the field strain.
Figure 4. Sections of ovine abomasal tissue stimulated with MV of Lactobacillus acidophilus stained with H&E. Ovine abomasal tissue. (A) Unstimulated tissue (Ctrl−). (B) Tissue challenged with 1500 L3 of H. contortus (Ctrl+). (C) Tissue stimulated with MVS of L. acidophilus field strain. (D) Approach 10× to the tissue stimulated with MVS of L. acidophilus field strain. Mucosal-associated lymphoid tissue in (B–D) panels is marked with an oval. (E) With a 40× objective, the presence of lymphocytic cells and some macrophages in the submucosal area of the tissue challenged with L3 of H. contortus, and (F) infiltrate between the crypts of the tissue stimulated with L. acidophilus MVs from the field strain.
Microorganisms 13 01341 g004
Microorganisms 13 01341 g005
Figure 5. Percentage mortality of Haemonchus contortus L3. Larvae mortality assay of H. contortus L3 incubated with 30 μg of MVs of L. acidophilus field strain (FI) and ATCC strain. As a positive control, 0.05% ivermectin (IVM) was used. It showed a 98% mortality rate among the larvae, resulting in a significant difference compared to the negative control (water) and the treatments with both L. acidophilus MV strains. One-way ANOVA p = 0.001 (****).
Figure 5. Percentage mortality of Haemonchus contortus L3. Larvae mortality assay of H. contortus L3 incubated with 30 μg of MVs of L. acidophilus field strain (FI) and ATCC strain. As a positive control, 0.05% ivermectin (IVM) was used. It showed a 98% mortality rate among the larvae, resulting in a significant difference compared to the negative control (water) and the treatments with both L. acidophilus MV strains. One-way ANOVA p = 0.001 (****).
Microorganisms 13 01341 g005
Microorganisms 13 01341 g006
Figure 6. RAW 264.7 cells stimulated with Lactobacillus acidophilus MVs and relative expression of IL-1β and TNF-α mRNA. RAW 264.7 cells (A) untreated cells (negative control)/40×, (B) stimulated cells with 10 μg of MVs obtained from a field strain (MVs FI)/40×. In activated macrophages, more pseudopods are observed (black arrow), (C) Relative mRNA expression of TNF-α and (D) Relative mRNA expression of IL-1β. Stimulation with MVs increases the relative messenger expression of both cytokines compared to the negative control. Tukey’s multiple comparisons test p 0.0084 (**), p 0.0008 (***), p < 0.0001 (****). Messenger RNA (mRNA), Interleukin 1 beta (IL-1β), Tumor necrosis factor alpha (TNF-α).
Figure 6. RAW 264.7 cells stimulated with Lactobacillus acidophilus MVs and relative expression of IL-1β and TNF-α mRNA. RAW 264.7 cells (A) untreated cells (negative control)/40×, (B) stimulated cells with 10 μg of MVs obtained from a field strain (MVs FI)/40×. In activated macrophages, more pseudopods are observed (black arrow), (C) Relative mRNA expression of TNF-α and (D) Relative mRNA expression of IL-1β. Stimulation with MVs increases the relative messenger expression of both cytokines compared to the negative control. Tukey’s multiple comparisons test p 0.0084 (**), p 0.0008 (***), p < 0.0001 (****). Messenger RNA (mRNA), Interleukin 1 beta (IL-1β), Tumor necrosis factor alpha (TNF-α).
Microorganisms 13 01341 g006
Table 1. Primer sequence for the RAW264.7 cell genes.
Table 1. Primer sequence for the RAW264.7 cell genes.
Primer GeneSequence [5′-3′]Alignment TemperatureLength [bp]
IL-1βFw: GTGTGTGACGTTCCCATTA
Rv: CGTTGCTTGGTTCTCCTTGT		62 °C170
TNF-αFw: TATGGCTCAGGGTCCAACTC
Rv: CTCCCTTTGCAGAACTCAGG		62 °C174
HPRT1Fw: ATTCCCAACAGACAGACAGACAGAA
Rv: TTAGGTCGGAAGGCATCAT		50 °C224
Fw—forward primer; Rv—reverse primer; IL 1β—interleukin one beta; TNFα—tumor necrosis factor alpha; HPRT1—hypoxanthine-guanine phosphoribosyltransferase enzyme; bp—base pairs.
Table 2. Proteins identified for SDS-PAGE 12% for MVs, whole bacteria, and cell-free supernatants of the field strain and ATCC of Lactobacillus acidophilus.
Table 2. Proteins identified for SDS-PAGE 12% for MVs, whole bacteria, and cell-free supernatants of the field strain and ATCC of Lactobacillus acidophilus.
ProteinsFractions
DescriptionPM/
kDa		FI MVsFI WBFI CFSATCC MVSATCC WBATCC CFS
p7575✓✓-✓✓-
FtsZ protein64✓✓✓✓✓✓
ABC transporter: ATP-binding and membrane-spanning protein59✓-----
Glutamine ABC transporter permease protein glnP54✓✓✓✓✓✓
p4040✓--✓--
Cell division protein DivIB32✓--✓--
Bacteriocin-like proteins BLP10✓✓-✓✓-
9✓✓-✓✓-
6✓--✓--
The table shows the proteins of both L. acidophilus strains, field strain [FI] and ATCC, present [✓] or absent [-] obtained from the fractions: MVs [FI MVS and ATCC MVS], whole bacteria [FI WB and ATCC WB], and cell-free supernatant [FI CFS and ATCC CFS]. By analyzing the molecular weights reported by the KODAK Gel-Logic 100 system software, the proteins were compared with those reported in the literature.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Pérez-Martínez, P.I.; Gutiérrez-Espinosa, V.; Ávalos-Gómez, C.; De la Garza-Amaya, M.; Vargas-Ruíz, A.; Higuera-Piedrahita, R.I.; Marín-Flamand, E.; Lonngi-Sosa, C.D.; González-Díaz, F.R.; Ramírez-Álvarez, H.; et al. Evaluation of the Immunostimulant Effect of Microvesicles of Lactobacillus acidophilus Isolated from Wild Rats. Microorganisms 2025, 13, 1341. https://doi.org/10.3390/microorganisms13061341

AMA Style

Pérez-Martínez PI, Gutiérrez-Espinosa V, Ávalos-Gómez C, De la Garza-Amaya M, Vargas-Ruíz A, Higuera-Piedrahita RI, Marín-Flamand E, Lonngi-Sosa CD, González-Díaz FR, Ramírez-Álvarez H, et al. Evaluation of the Immunostimulant Effect of Microvesicles of Lactobacillus acidophilus Isolated from Wild Rats. Microorganisms. 2025; 13(6):1341. https://doi.org/10.3390/microorganisms13061341

Chicago/Turabian Style

Pérez-Martínez, Pamela I., Viridiana Gutiérrez-Espinosa, Christian Ávalos-Gómez, Mireya De la Garza-Amaya, Alejandro Vargas-Ruíz, Rosa I. Higuera-Piedrahita, Ernesto Marín-Flamand, Cristal D. Lonngi-Sosa, Francisco R. González-Díaz, Hugo Ramírez-Álvarez, and et al. 2025. "Evaluation of the Immunostimulant Effect of Microvesicles of Lactobacillus acidophilus Isolated from Wild Rats" Microorganisms 13, no. 6: 1341. https://doi.org/10.3390/microorganisms13061341

APA Style

Pérez-Martínez, P. I., Gutiérrez-Espinosa, V., Ávalos-Gómez, C., De la Garza-Amaya, M., Vargas-Ruíz, A., Higuera-Piedrahita, R. I., Marín-Flamand, E., Lonngi-Sosa, C. D., González-Díaz, F. R., Ramírez-Álvarez, H., & González-Ruíz, C. (2025). Evaluation of the Immunostimulant Effect of Microvesicles of Lactobacillus acidophilus Isolated from Wild Rats. Microorganisms, 13(6), 1341. https://doi.org/10.3390/microorganisms13061341

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop