Additions to Pleosporalean Taxa Associated with Xanthoceras sorbifolium from Jilin and Hebei, China

Abstract

Pleosporalean fungi play significant roles as plant pathogens, saprobes, and endophytes in a wide variety of economically important plant hosts. During an investigation of saprobic fungi from Jilin and Hebei, China, five pleosporalean isolates were obtained from the dead stems of Xanthoceras sorbifolium. Morphological evidence and multi-locus sequence analyses using a combined dataset of ITS, LSU, SSU, rpb2, tef1-α, and tub2 indicate that these isolates represent two new species (Alloleptosphaeria xanthoceratis and Lophiostoma multiforme) and a new record of Lophiostoma montanae. Full morphological descriptions and illustrations are provided herein, and phylogenetic relationships of three pleosporalean taxa are also discussed. Detailed morphological descriptions and illustrations are presented, along with phylogenetic affiliations of three pleosporalean taxa.

1. Introduction

Ascomycota, commonly known as sac fungi, constitutes the largest and most ecologically diverse phylum within the fungal kingdom [1]. The phylum exhibits remarkable morphological variability, ranging from unicellular yeasts to multicellular structures producing elaborate fruiting bodies [2,3]. They occupy virtually every terrestrial and aquatic habitat, functioning as decomposers, pathogens, endophytes, and mutualistic symbionts (e.g., lichens and mycorrhizae) [4]. These fungi are economically important as antibiotic producers, industrial agents, model organisms, and sources of bioactive metabolites [5]. Given their ecological dominance and biotechnological relevance, Ascomycota remain a critical focus of mycological research.

Pleosporales, a diverse order in the class Dothideomycetes (Ascomycota), comprises over 10,000 species across more than 90 families [6]. Members of this order are characterized by pseudothecial ascomata, bitunicate and fissitunicate asci, and aseptate or septate ascospores that vary in pigmentation, shape, and gelatinous sheath [7]. Asexual morphs are predominantly coelomycetous or can sometimes be hyphomycetous [8,9,10,11]. Pleosporalean fungi contain saprobic, pathogenic, endophytic, parasitic, hyperparasitic, and lichenized species that have successfully colonized virtually all global habitats, from terrestrial to aquatic environments [7,8,9]. Over the past decade, molecular phylogenetic studies coupled with morphological evidence have significantly refined the taxonomy of Pleosporales, revealing abundant diversity and leading to the establishment of new families and genera [6,12]. Recent investigations in China have revealed numerous novel species associated with woody oil plants [13,14,15].

Xanthoceras sorbifolium (Sapindaceae) is an important tree native to northern China with resistance to drought and could be used for windbreak, sand fixation, and desertification control [16,17]. It also has antitumor and anti-inflammatory activities [18]. Notably, its oil-rich seeds (containing >50% unsaturated fatty acids) have garnered attention as a promising biodiesel feedstock and edible oil source with potential cardiovascular benefits [18]. While extensively studied for its medicinal properties, oil-rich seeds, and stress tolerance, the microfungi associated with this plant remain underexplored despite their potential agricultural and ecological implications [18]. Preliminary investigations have identified several saprobic and pathogenic fungi, including Angularia xanthoceratis [19], Comoclathris xanthoceratis [20], Neocucurbitaria subribicola [21], Fusarium sp., and Verticillium sp. [22], which reflect the abundance of potential microfungal resources in X. sorbifolium.

During a survey of microfungi allied with X. sorbifolium in China, a series of interesting pleosporalean fungi was collected. This study aimed to enrich knowledge of the pleosporalean taxa in X. sorbifolium. Morphological comparisons integrated with multilocus phylogenetic analyses were conducted to determine the classification of these new collections. Two novel species and one newly recorded species are described from Jilin and Hebei Provinces, China.

2. Materials and Methods

2.1. Sample Collection, Isolation, and Morphological Observation

During a series of fieldwork from 2021 to 2022 in Jilin and Hebei Provinces, China, dried woody litter samples were collected. The collected samples, labeled with location, date, host, and collection data in plastic bags, were transported to the lab for morphological study. Pure colonies were obtained through single spore isolation [23] and incubated on potato dextrose agar (PDA) at 25 °C for 2 to 6 weeks. The specimens were preserved at the Herbarium of Mycology, Jilin Agricultural University (HMJAU), Changchun, China, while the pure cultures were stored in the Culture Collection of the International Cooperation Research Center of China for New Germplasm Breeding of Edible Mushrooms (CCMJ). The novel species were documented and assigned accession numbers in MycoBank [24].

Fungal morphological structures were examined and photographed using a Zeiss Stemi 2000C stereo microscope (paired with a Leica DFC450C camera) and a Zeiss AX10 light microscope (fitted with an Axiocam 506 camera) (ZEISS/Leica, Jena/Wetzlar, Germany). Microscopic elements were measured using the ZEN 3.4 (blue edition) program (ZEISS, Jena, Germany), and all images were processed with Adobe Photoshop 2020 (Adobe Systems, San Jose, CA, USA).

2.2. DNA Extraction, PCR Amplification, and Sequencing

Fungal genomic DNA was extracted from mycelium using the NuClean PlantGen DNA Kit (CWBIO, Taizhou, China) following the manufacturer’s protocol. The DNA amplification was conducted by polymerase chain reaction (PCR) using internal transcribed spacers (ITS), large subunit (LSU) rDNA, small subunit (SSU) rDNA, translation elongation factor 1-α (tef1-α), RNA polymerase II second largest subunit (rpb2), and beta-tubulin (tub2). The specific primer pairs for six molecular markers are described in

Table 1. PCR primers utilized for amplification and sequencing in the investigation.

Loci	Primer Pair Forward/Reverse	Sequence (5′–3′)	Reference
ITS	ITS5/ITS4	GGAAGTAAAAGTCGTAACAAGG TCCTCCGCTTATTGATATGC	[26]
LSU	LR0R/LR5	ACCCGCTGAACTTAAGC ATCCTGAGGGAAACTTC	[27]
SSU	NS1/NS4	GTAGTCATATGCTTGTCTC CTTCCGTCAATTCCTTTAAG	[26]
tef1-α	2218F/983R	GCYCCYGGHCAYCGTGAYTTYAT ATGACACCRACRGCRACACRGTYTG	[28]
rpb2	fRPB2-5F/fRPB2-7cR	GAYGAYMGWGATCAYTTYGG CCCATRGCTTGYTTRCCCAT	[29]
tub2	T1/Bt2b	AACATGCGTGAGATTGTAAGT ACCCTCAGTGTAGTGACCCTTGGC	[30]

. Amplification was conducted following Xu et al. [19,21], with PCR products confirmed via 1% agarose gel electrophoresis (stained with 0.5 mL of 10,000× DNA dye; Biotium, Fremont, CA, USA). Successful amplifications were sequenced by Sangon Biotech (Shanghai, China). The newly obtained sequences have been submitted to GenBank [25], with accession numbers provided in Table 2 and Table 3.

2.3. Molecular Phylogeny

The new strains were initially identified by molecular techniques through comparison of individual gene sequences using BLASTn [31], with relevant sequence data acquired from GenBank (Table 2 and Table 3). Alignments were generated using MAFFT v.7 [32] with the L-INS-i algorithm (1PAM/k = 2 scoring matrix, 1.50 gap opening penalty for nucleotide sequences), followed by manual adjustment in BioEdit v7.2.5 [33]. The AliView program was used to convert the alignment data files to PHYLIP and NEXUS formats [34].

Phylogenetic trees were constructed using individual genetic markers and subsequently analyzed in combination, along with a concatenated multi-gene dataset. Maximum likelihood analysis was conducted with RAxML-HPC2 on XSEDE through the CIPRES web portal (http://www.phylo.org/portal2/; accessed 28 March 2025) [35]. The optimal evolutionary models for both individual and concatenated datasets were determined using jModeltest 2.1.10, with model selection based on the Akaike Information Criterion (AIC) for posterior probability analysis [36]. The GTR+GAMMA model of nucleotide evolution was applied to all datasets with 1000 bootstrap repeats. BI analysis was performed using MrBayes v.3.2.6 implemented through the CIPRES Science Gateway portal (https://www.phylo.org; accessed on 29 March 2025) [37]. Simultaneous Markov chains were run for 800 million generations. Trees were sampled every 100 generations, with the first 20% discarded as burn-in. Outgroup taxa selection comprised Didymella exigua (CBS 183.55), D. rumicicola (CBS 683.79), Teichospora rubriostiolata (TR7), and T. trabicola (C134) (Figure 1 and Figure 2). The phylogenetic tree file was downloaded from CIPRES and visualized in FigTree v.1.4.4 [38]. The tree designs were crafted in Adobe Illustrator CS6.

Table 2. Names and corresponding GenBank accession numbers of Leptosphaeriaceae taxa used in phylogenetic analyses, with new sequences in bold blue and type strains in bold.

Species	Strain/Isolate	GenBank Accession Numbers
		ITS	LSU	SSU	tub2
Alloleptosphaeria italica	MFLUCC 14-0934	KT454722	KT454714	_	_
A. clematidis	MFLUCC 17-2071	MT310604	MT214557	MT226674	_
A. iridicola	CBS 143395	MH107919	MH107965	_	NA
A. shangrilana	HKAS:112210	MW431059	MW431315	MW431058	NA
A. xanthoceratis	CCMJ 13066	PP151694	PP153449	PV569760	PV670045
Didymella exigua	CBS 183.55	GU237794	EU754155	EU754056	GU237525
D. rumicicola	CBS 683.79	KT389503	KT389721	_	KT389800
Heterospora chenopodii	CBS 448.68	FJ427023	EU754187	EU754088	_
H. chenopodii	CBS 115.96	JF740227	EU754188	EU754089	_
H. dimorphospora	CBS 165.78	JF740204	JF740281	JF740098	_
H. dimorphospora	CBS 345.78	JF740203	GU238069	GU238213	_
Lep. conoidea	CBS 616.75	JF740201	JF740279	_	KT389804
Lep. doliolum	CBS 155.94	JF740207	JF740282	_	JF740146
Lep. doliolum	CBS 505.75	JF740205	GQ387576	GQ387515	JF740144
Lep. ebuli	MFLUCC 14-0828	KP744446	KP744488	KP753954	_
Lep. irregularis	MFLUCC 15-1118	KX856056	KX856055	_	_
Lep. slovacica	CBS 389.80	JF740247	JF740315	JF740101	_
Lep. urticae	MFLU 18-0591	MK123333	MK123332	MK123329	_
Neoleptosphaeria jonesii	MFLUCC 16-1442	KY211869	KY211870	KY211871	_
Neol. rubefaciens	CBS 223.77	JF740243	JF740312	_	_
Neol. rubefaciens	CBS 387.80	JF740242	JF740311	_	_
Pseudoleptosphaeria etheridgei	CBS 125980	JF740221	JF740291	_	_
Querciphoma carteri	CBS 105.91	KF251209	GQ387594	GQ387533	KF252700
Q. carteri	CBS 101633	KF251210	GQ387593	GQ387532	KF252701
Sclerenchymomyces clematidis	MFLUCC 17-2180	MT310605	MT214558	MT226675	_

Table 2. Names and corresponding GenBank accession numbers of Leptosphaeriaceae taxa used in phylogenetic analyses, with new sequences in bold blue and type strains in bold.

Species	Strain/Isolate	GenBank Accession Numbers
		ITS	LSU	SSU	tub2
Alloleptosphaeria italica	MFLUCC 14-0934	KT454722	KT454714	_	_
A. clematidis	MFLUCC 17-2071	MT310604	MT214557	MT226674	_
A. iridicola	CBS 143395	MH107919	MH107965	_	NA
A. shangrilana	HKAS:112210	MW431059	MW431315	MW431058	NA
A. xanthoceratis	CCMJ 13066	PP151694	PP153449	PV569760	PV670045
Didymella exigua	CBS 183.55	GU237794	EU754155	EU754056	GU237525
D. rumicicola	CBS 683.79	KT389503	KT389721	_	KT389800
Heterospora chenopodii	CBS 448.68	FJ427023	EU754187	EU754088	_
H. chenopodii	CBS 115.96	JF740227	EU754188	EU754089	_
H. dimorphospora	CBS 165.78	JF740204	JF740281	JF740098	_
H. dimorphospora	CBS 345.78	JF740203	GU238069	GU238213	_
Lep. conoidea	CBS 616.75	JF740201	JF740279	_	KT389804
Lep. doliolum	CBS 155.94	JF740207	JF740282	_	JF740146
Lep. doliolum	CBS 505.75	JF740205	GQ387576	GQ387515	JF740144
Lep. ebuli	MFLUCC 14-0828	KP744446	KP744488	KP753954	_
Lep. irregularis	MFLUCC 15-1118	KX856056	KX856055	_	_
Lep. slovacica	CBS 389.80	JF740247	JF740315	JF740101	_
Lep. urticae	MFLU 18-0591	MK123333	MK123332	MK123329	_
Neoleptosphaeria jonesii	MFLUCC 16-1442	KY211869	KY211870	KY211871	_
Neol. rubefaciens	CBS 223.77	JF740243	JF740312	_	_
Neol. rubefaciens	CBS 387.80	JF740242	JF740311	_	_
Pseudoleptosphaeria etheridgei	CBS 125980	JF740221	JF740291	_	_
Querciphoma carteri	CBS 105.91	KF251209	GQ387594	GQ387533	KF252700
Q. carteri	CBS 101633	KF251210	GQ387593	GQ387532	KF252701
Sclerenchymomyces clematidis	MFLUCC 17-2180	MT310605	MT214558	MT226675	_

Table 3. Names and corresponding GenBank accession numbers of Lophiostomataceae taxa used in phylogenetic analyses, with new sequences in bold blue and type strains in bold.

Species	Strain/Isolate	GenBank Accession Numbers
		ITS	LSU	SSU	tef1-α	rpb2
Crassiclypeus aquaticus	KH 104	LC312499	LC312528	LC312470	LC312557	LC312586
C. aquaticus	KT 970	LC312501	LC312530	LC312472	LC312559	LC312588
Dimorphiopsis brachystegiae	CPC 22679	KF777160	KF777213	_	_	_
Flabellascoma aquaticum	KUMCC 15-0258	MN304827	MN274564	MN304832	MN328898	MN328895
F. cycadicola	KT 2034	LC312502	LC312531	LC312473	LC312560	LC312589
F. fusiforme	MFLUCC 18-1584	MN304830	MN274567	_	MN328902	_
F. minimum	KT 2013	LC312503	LC312532	LC312474	LC312561	LC312590
F. minimum	KT 2040	LC312504	LC312533	LC312475	LC312562	LC312591
Lentistoma bipolare	KT 3056	LC312513	LC312542	LC312484	LC312571	LC312600
Len. bipolare	CBS 115375	LC312506	LC312535	LC312477	LC312564	LC312593
Leptoparies palmarum	KT 1653	LC312514	LC312543	LC312485	LC312572	LC312601
Lophiostoma arundinis	KT 606	JN942964	AB618998	AB618679	LC001737	JN993482
Lop. arundinis	KT 651	JN942965	AB618999	AB618680	LC001738	JN993486
Lop. biappendiculatum	KT 975	_	GU205228	GU205254	_	_
Lop. biappendiculatum	KT 1124	_	GU205227	GU205256	_	_
Lop. caespitosum	CBS 147391	MW759252	MW750387	_	MW752404	MW752383
Lop. caespitosum	MFLUCC 13-0442	KP899134	KP888639	KP899125	KR075161	_
Lop. caespitosum	MFLUCC 14-0993	KP899135	KP888640	KP899126	KR075162	_
Lop. carabassense	CBS 149324	MT679671	OL544969	OL544968	OL554876	_
Lop. carpini	CBS 147279	MW759258	MW750386	_	MW752405	MW752384
Lop. caryophyllacearum	MFLUCC 17-0749	MG828964	MG829076	MG829176	MG829238	_
Lop. caudatum	KT 530	LC001723	AB619000	AB618681	LC001739	_
Lop. caulium	KT 603	LC001724	AB619001	AB618682	LC001740	_
Lop. caulium	KT 633	LC001725	AB619002	AB618683	LC001741	_
Lop. clavatum	CBS 147278	MW759259	MW750385	_	MW752406	MW752385
Lop. clavatum	MFLUCC 18-1316	_	MN274566	MN304835	MN328901	_
Lop. clematidicola	MFLUCC 16-0446	MT310609	MT214563	MT226680	MT394742	_
Lop. clematidis	MFLUCC 17-2081	MN393004	MT214562	MT226679	MT394741	MT394689
Lop. clematidis-subumbellatae	MFLUCC 17-2063	MT310607	MT214560	MT226677	MT394739	MT394687
Lop. clematidis-vitalbae	MFLUCC 16-1368	MT310610	MT214564	MT226681	MT394743	_
Lop. compressum	CBS 147276	MW759272	MW750382	_	MW752408	MW752381
Lop. compressum	IFRD 2014	_	FJ795437	FJ795480	_	FJ795457
Lop. cornisporum	KH 322	LC312515	LC312544	LC312486	LC312573	LC312602
Lop. coronillae	MFLUCC 14-0941	KT026120	KT026112	KT026116	_	_
Lop. crenatum	AFTOL-ID 1581	_	DQ678069	DQ678017	DQ677912	DQ677965
Lop. dictyosporum	CBS 147389	MW759251	MW750379	_	MW752411	MW752388
Lop. erumpens	CBS 147275	MW759262	MW750381	_	MW752409	MW752386
Lop. fusisporum	CBS 147891	MW759253	_	_	MW752401	MW752382
Lop. helichrysi	IT-1296	KT333435	KT333436	KT333437	KT427535	_
Lop. heterosporum	AFTOL-ID 1036	GQ203795	AY016369	_	DQ497609	DQ497615
Lop. japonicum	KT 686-1	LC001729	AB619006	AB618687	LC001745	_
Lop. japonicum	KT 573	LC001728	AB619005	AB618686	LC001744	_
Lop. jonesii	GAAZ 54-1	KX687757	KX687753	KX687755	KX687759	_
Lop. jonesii	GAAZ 54-2	KX687758	KX687754	KX687756	KX687760	_
Lop. jotunheimenense	CBS 147522	MW759261	MW750394	_	MW752392	_
Lop. junci	MFLUCC 14-0938	MG828966	MG829078	MG829178	NA	_
Lop. khanzada-kirgizbaeva	TASM 6158	MZ966265	OK017520	OK017525	MZ997338	_
Lop. khanzada-kirgizbaeva	TASM 6164	MZ966266	OK017521	OK017526	MZ997339	_
Lop. longiappendiculatum	MFLUCC 17-1452	MT214368	MT214462	MT214415	MT235783	_
Lop. longiappendiculatum	MFLUCC 17-1457	MT214369	MT214463	MT214416	MT235784	MT235821
Lop. macrostomoides	CBS 147523	MW759256	MW750389	_	_	_
Lop. macrostomoides	CBS 147277	MW759257	MW750384	_	MW752407	MW752380
Lop. macrostomoides	CBS 123097	_	FJ795439	FJ795482	GU456277	FJ795458
Lop. macrostomum	KT 508	JN942961	AB619010	_	LC001751	JN993491
Lop. macrostomum	KT 709/HHUF 27293	AB433276	AB433274	AB521732	LC001753	JN993493
Lop. macrostomum	KT 635/HHUF 27290	AB433275	AB433273	AB521731	LC001752	JN993484
Lop. mangiferae	MFLUCC 17-2651	MG931031	MG931025	MG931028	_	_
Lop. mangiferae	MFLUCC 17-2653	MG931032	MG931026	MG931029	_	_
Lop. medicaginicola	MFLUCC 17-0681	MG828967	MG829079	MG829179	_	_
Lop. montanae	MFLUCC 16-0999	MT310611	MT214565	MT226682	MT394744	_
Lop. montanae	UESTCC 23.0038	OR253137	OR253296	OR253209	OR263570	OR253750
Lop. montanae	UESTCC 23.0039	OR253138	OR253297	OR253210	OR251148	OR253751
Lop. montanae	CCMJ 13067	PV569791	PV569911	PV569764	PV670048	PV670046
Lop. montanae	CCMJ 13068	PV569792	PV569912	PV569765	PV670049	PV670047
Lop. multiforme	CCMJ 13069	PP151705	PP153460	PV569761	PV670043	PV670041
Lop. multiforme	CCMJ 13070	PP151706	PP153461	PV569762	PV670044	PV670042
Lop. multiseptatum	CBS 623.86	_	GU301833	GU296163	_	GU371791
Lop. multiseptatum	KT 604	LC001726	AB619003	AB618684	LC001742	_
Lop. neomuriforme	MFLUCC 13-0744	KY496740	KY496719	KY501110	_	_
Lop. obtusisporum	KT 3098	LC312519	LC312548	LC312490	LC312577	LC312606
Lop. obtusisporum	KT 2838	LC312518	LC312547	LC312489	LC312576	LC312605
Lop. oleae	CGMCC 3.24426	OR253081	OR253233	OR253172	OR262141	OR262130
Lop. oleae	UESTCC 23.0036	OR253079	OR253231	OR253171	OR262139	OR262129
Lop. ononidis	MFLUCC 14-0613	KU243128	KU243125	KU243126	KU243127	_
Lop. paramacrostomum	MFLUCC 11-0463	_	KP888636	KP899122	_	_
Lop. plantaginis	CBS 147527	MW759250	MW750378	_	_	MW752375
Lop. pseudodictyosporium	MFLUCC 13-0451	KR025858	KR025862	_	_	_
Lop. pseudomacrostomum	CBS 147525	MW759255	MW750391	_	MW752395	_
Lop. pseudomacrostomum	CBS 147526	MW759254	MW750392	_	MW752394	_
Lop. ravennicum	MFLUCC 14-0005	KP698413	KP698414	KP698415	_	_
Lop. rosae-ecae	MFLUCC 17-0807	MG828924	MG829033	MG829139	MG829217	_
Lop. rosicola	MFLU 15-1888	MG828968	MG829080	MG829180	MG829240	_
Lop. sagittiforme	KT 1934	AB369268	AB369267	AB618693	LC001756	_
Lop. scabridisporum	BCC 22835	_	GQ925844	GQ925831	GU479857	GU479830
Lop. scabridisporum	BCC 22836	_	GQ925845	GQ925832	GU479856	GU479829
Lop. scrophulariicola	MFLUCC 17-0689	MG828969	MG829081	_	_	_
Lop. semiliberum	KT 622	JN942966	AB619012	AB618694	LC001757	JN993483
Lop. semiliberum	KT 652	JN942967	AB619013	AB618695	LC001758	JN993485
Lop. semiliberum	KT 828	JN942970	AB619014	AB618696	LC001759	JN993489
Lop. spartii-juncei	MFLUCC 13-0351	KP899136	KP888641	KP899127	KR075163	_
Lop. submuriforme	CBS 147274	MW759260	MW750380	_	MW752410	MW752387
Lop. terricola	SC-12	JN662930	JX985750	JX985749	_	_
Lop. thymi	MFLU 15-2131	MG828970	MG829082	MG829182	MG829241	_
Lop. tropicum	KH 352	LC312521	LC312550	LC312492	LC312579	LC312608
Lop. tropicum	KT 3134	LC312522	LC312551	LC312493	LC312580	LC312609
Lop. vitigenum	HH 26930	LC001735	AB619015	AB618697	LC001761	_
Lop. vitigenum	HH 26931	LC001736	AB619016	AB618698	LC001762	_
Lop. winteri	KT 740	JN942969	AB619017	AB618699	LC001763	JN993487
Lop. winteri	KT 764	JN942968	AB619018	AB618700	LC001764	JN993488
Neovaginatispora clematidis	MFLUCC 17-2149	MT310606	MT214559	MT226676	MT394738	_
Neov. fuckelii	MFLUCC 17-1334	MN304828	MN274565	MN304833	MN328899	MN328896
Neov. fuckelii	KT 634	LC001732	AB619009	AB618690	LC001750	_
Parapaucispora pseudoarmatispora	KT 2237	LC100021	LC100026	LC100018	LC100030	_
Paucispora kunmingense	MFLUCC 17-0932	MF173432	MF173428	MF173430	MF173434	MF173436
Pa. quadrispora	KH 448	LC001733	LC001722	LC001720	LC001754	_
Pa. quadrispora	KT 843	LC001734	AB619011	AB618692	LC001755	_
Pa. versicolor	KH 110	AB918731	AB918732	LC001721	LC001760	_
Pa. xishanensis	HKAS 115905	MZ966267	OK017522	OK017527	MZ997340	_
Pa. xishanensis	HKAS 115906	MZ966268	OK017523	OK017528	MZ997341	_
Platystomum actinidiae	KT 521	JN942963	JN941380	JN941375	LC001747	JN993490
Pl. actinidiae	KT 534	JN942962	JN941379	JN941376	LC001748	JN993492
Pl. crataegi	MFLUCC 14-0925	KT026117	KT026109	KT026113	KT026121	_
Pl. rosae	MFLUCC 15-0633	KT026119	KT026111	KT026115	_	_
Pl. salicicola	MFLUCC 15-0632	KT026118	KT026110	KT026114	_	_
Pseudopaucispora brunneospora	KH 227	LC312523	LC312552	LC312494	LC312581	LC312610
Vaginatispora amygdali	KT 2248	LC312524	LC312553	LC312495	LC312582	LC312611
V. amygdali	MFLUCC 18-1526	MK085055	MK085059	MK085057	MK087657	_
V. appendiculata	MFLUCC 16-0314	KU743217	KU743218	KU743219	KU743220	_
V. appendiculata	MFLUCC 13-0835	_	KY264745	KY264749	_	_
V. aquatica	MFLUCC 11-0083	KJ591577	KJ591576	KJ591575	_	_
V. armatispora	MFLUCC 18-0247	MK085056	MK085060	MK085058	MK087658	MK087669
V. armatispora	MFLUCC 18-0213	MN304826	MN274563	MN304831	MN328897	MN328894
V. microarmatispora	MTCC 12733	MF142592	MF142593	MF142594	MF142595	MF142596
V. scabrispora	KT 2443	LC312525	LC312554	LC312496	LC312583	LC312612
Teichospora rubriostiolata	TR7	KU601590	_	_	KU601609	KU601599
T. trabicola	C134	KU601591	_	_	KU601601	KU601600

Table 3. Names and corresponding GenBank accession numbers of Lophiostomataceae taxa used in phylogenetic analyses, with new sequences in bold blue and type strains in bold.

Species	Strain/Isolate	GenBank Accession Numbers
		ITS	LSU	SSU	tef1-α	rpb2
Crassiclypeus aquaticus	KH 104	LC312499	LC312528	LC312470	LC312557	LC312586
C. aquaticus	KT 970	LC312501	LC312530	LC312472	LC312559	LC312588
Dimorphiopsis brachystegiae	CPC 22679	KF777160	KF777213	_	_	_
Flabellascoma aquaticum	KUMCC 15-0258	MN304827	MN274564	MN304832	MN328898	MN328895
F. cycadicola	KT 2034	LC312502	LC312531	LC312473	LC312560	LC312589
F. fusiforme	MFLUCC 18-1584	MN304830	MN274567	_	MN328902	_
F. minimum	KT 2013	LC312503	LC312532	LC312474	LC312561	LC312590
F. minimum	KT 2040	LC312504	LC312533	LC312475	LC312562	LC312591
Lentistoma bipolare	KT 3056	LC312513	LC312542	LC312484	LC312571	LC312600
Len. bipolare	CBS 115375	LC312506	LC312535	LC312477	LC312564	LC312593
Leptoparies palmarum	KT 1653	LC312514	LC312543	LC312485	LC312572	LC312601
Lophiostoma arundinis	KT 606	JN942964	AB618998	AB618679	LC001737	JN993482
Lop. arundinis	KT 651	JN942965	AB618999	AB618680	LC001738	JN993486
Lop. biappendiculatum	KT 975	_	GU205228	GU205254	_	_
Lop. biappendiculatum	KT 1124	_	GU205227	GU205256	_	_
Lop. caespitosum	CBS 147391	MW759252	MW750387	_	MW752404	MW752383
Lop. caespitosum	MFLUCC 13-0442	KP899134	KP888639	KP899125	KR075161	_
Lop. caespitosum	MFLUCC 14-0993	KP899135	KP888640	KP899126	KR075162	_
Lop. carabassense	CBS 149324	MT679671	OL544969	OL544968	OL554876	_
Lop. carpini	CBS 147279	MW759258	MW750386	_	MW752405	MW752384
Lop. caryophyllacearum	MFLUCC 17-0749	MG828964	MG829076	MG829176	MG829238	_
Lop. caudatum	KT 530	LC001723	AB619000	AB618681	LC001739	_
Lop. caulium	KT 603	LC001724	AB619001	AB618682	LC001740	_
Lop. caulium	KT 633	LC001725	AB619002	AB618683	LC001741	_
Lop. clavatum	CBS 147278	MW759259	MW750385	_	MW752406	MW752385
Lop. clavatum	MFLUCC 18-1316	_	MN274566	MN304835	MN328901	_
Lop. clematidicola	MFLUCC 16-0446	MT310609	MT214563	MT226680	MT394742	_
Lop. clematidis	MFLUCC 17-2081	MN393004	MT214562	MT226679	MT394741	MT394689
Lop. clematidis-subumbellatae	MFLUCC 17-2063	MT310607	MT214560	MT226677	MT394739	MT394687
Lop. clematidis-vitalbae	MFLUCC 16-1368	MT310610	MT214564	MT226681	MT394743	_
Lop. compressum	CBS 147276	MW759272	MW750382	_	MW752408	MW752381
Lop. compressum	IFRD 2014	_	FJ795437	FJ795480	_	FJ795457
Lop. cornisporum	KH 322	LC312515	LC312544	LC312486	LC312573	LC312602
Lop. coronillae	MFLUCC 14-0941	KT026120	KT026112	KT026116	_	_
Lop. crenatum	AFTOL-ID 1581	_	DQ678069	DQ678017	DQ677912	DQ677965
Lop. dictyosporum	CBS 147389	MW759251	MW750379	_	MW752411	MW752388
Lop. erumpens	CBS 147275	MW759262	MW750381	_	MW752409	MW752386
Lop. fusisporum	CBS 147891	MW759253	_	_	MW752401	MW752382
Lop. helichrysi	IT-1296	KT333435	KT333436	KT333437	KT427535	_
Lop. heterosporum	AFTOL-ID 1036	GQ203795	AY016369	_	DQ497609	DQ497615
Lop. japonicum	KT 686-1	LC001729	AB619006	AB618687	LC001745	_
Lop. japonicum	KT 573	LC001728	AB619005	AB618686	LC001744	_
Lop. jonesii	GAAZ 54-1	KX687757	KX687753	KX687755	KX687759	_
Lop. jonesii	GAAZ 54-2	KX687758	KX687754	KX687756	KX687760	_
Lop. jotunheimenense	CBS 147522	MW759261	MW750394	_	MW752392	_
Lop. junci	MFLUCC 14-0938	MG828966	MG829078	MG829178	NA	_
Lop. khanzada-kirgizbaeva	TASM 6158	MZ966265	OK017520	OK017525	MZ997338	_
Lop. khanzada-kirgizbaeva	TASM 6164	MZ966266	OK017521	OK017526	MZ997339	_
Lop. longiappendiculatum	MFLUCC 17-1452	MT214368	MT214462	MT214415	MT235783	_
Lop. longiappendiculatum	MFLUCC 17-1457	MT214369	MT214463	MT214416	MT235784	MT235821
Lop. macrostomoides	CBS 147523	MW759256	MW750389	_	_	_
Lop. macrostomoides	CBS 147277	MW759257	MW750384	_	MW752407	MW752380
Lop. macrostomoides	CBS 123097	_	FJ795439	FJ795482	GU456277	FJ795458
Lop. macrostomum	KT 508	JN942961	AB619010	_	LC001751	JN993491
Lop. macrostomum	KT 709/HHUF 27293	AB433276	AB433274	AB521732	LC001753	JN993493
Lop. macrostomum	KT 635/HHUF 27290	AB433275	AB433273	AB521731	LC001752	JN993484
Lop. mangiferae	MFLUCC 17-2651	MG931031	MG931025	MG931028	_	_
Lop. mangiferae	MFLUCC 17-2653	MG931032	MG931026	MG931029	_	_
Lop. medicaginicola	MFLUCC 17-0681	MG828967	MG829079	MG829179	_	_
Lop. montanae	MFLUCC 16-0999	MT310611	MT214565	MT226682	MT394744	_
Lop. montanae	UESTCC 23.0038	OR253137	OR253296	OR253209	OR263570	OR253750
Lop. montanae	UESTCC 23.0039	OR253138	OR253297	OR253210	OR251148	OR253751
Lop. montanae	CCMJ 13067	PV569791	PV569911	PV569764	PV670048	PV670046
Lop. montanae	CCMJ 13068	PV569792	PV569912	PV569765	PV670049	PV670047
Lop. multiforme	CCMJ 13069	PP151705	PP153460	PV569761	PV670043	PV670041
Lop. multiforme	CCMJ 13070	PP151706	PP153461	PV569762	PV670044	PV670042
Lop. multiseptatum	CBS 623.86	_	GU301833	GU296163	_	GU371791
Lop. multiseptatum	KT 604	LC001726	AB619003	AB618684	LC001742	_
Lop. neomuriforme	MFLUCC 13-0744	KY496740	KY496719	KY501110	_	_
Lop. obtusisporum	KT 3098	LC312519	LC312548	LC312490	LC312577	LC312606
Lop. obtusisporum	KT 2838	LC312518	LC312547	LC312489	LC312576	LC312605
Lop. oleae	CGMCC 3.24426	OR253081	OR253233	OR253172	OR262141	OR262130
Lop. oleae	UESTCC 23.0036	OR253079	OR253231	OR253171	OR262139	OR262129
Lop. ononidis	MFLUCC 14-0613	KU243128	KU243125	KU243126	KU243127	_
Lop. paramacrostomum	MFLUCC 11-0463	_	KP888636	KP899122	_	_
Lop. plantaginis	CBS 147527	MW759250	MW750378	_	_	MW752375
Lop. pseudodictyosporium	MFLUCC 13-0451	KR025858	KR025862	_	_	_
Lop. pseudomacrostomum	CBS 147525	MW759255	MW750391	_	MW752395	_
Lop. pseudomacrostomum	CBS 147526	MW759254	MW750392	_	MW752394	_
Lop. ravennicum	MFLUCC 14-0005	KP698413	KP698414	KP698415	_	_
Lop. rosae-ecae	MFLUCC 17-0807	MG828924	MG829033	MG829139	MG829217	_
Lop. rosicola	MFLU 15-1888	MG828968	MG829080	MG829180	MG829240	_
Lop. sagittiforme	KT 1934	AB369268	AB369267	AB618693	LC001756	_
Lop. scabridisporum	BCC 22835	_	GQ925844	GQ925831	GU479857	GU479830
Lop. scabridisporum	BCC 22836	_	GQ925845	GQ925832	GU479856	GU479829
Lop. scrophulariicola	MFLUCC 17-0689	MG828969	MG829081	_	_	_
Lop. semiliberum	KT 622	JN942966	AB619012	AB618694	LC001757	JN993483
Lop. semiliberum	KT 652	JN942967	AB619013	AB618695	LC001758	JN993485
Lop. semiliberum	KT 828	JN942970	AB619014	AB618696	LC001759	JN993489
Lop. spartii-juncei	MFLUCC 13-0351	KP899136	KP888641	KP899127	KR075163	_
Lop. submuriforme	CBS 147274	MW759260	MW750380	_	MW752410	MW752387
Lop. terricola	SC-12	JN662930	JX985750	JX985749	_	_
Lop. thymi	MFLU 15-2131	MG828970	MG829082	MG829182	MG829241	_
Lop. tropicum	KH 352	LC312521	LC312550	LC312492	LC312579	LC312608
Lop. tropicum	KT 3134	LC312522	LC312551	LC312493	LC312580	LC312609
Lop. vitigenum	HH 26930	LC001735	AB619015	AB618697	LC001761	_
Lop. vitigenum	HH 26931	LC001736	AB619016	AB618698	LC001762	_
Lop. winteri	KT 740	JN942969	AB619017	AB618699	LC001763	JN993487
Lop. winteri	KT 764	JN942968	AB619018	AB618700	LC001764	JN993488
Neovaginatispora clematidis	MFLUCC 17-2149	MT310606	MT214559	MT226676	MT394738	_
Neov. fuckelii	MFLUCC 17-1334	MN304828	MN274565	MN304833	MN328899	MN328896
Neov. fuckelii	KT 634	LC001732	AB619009	AB618690	LC001750	_
Parapaucispora pseudoarmatispora	KT 2237	LC100021	LC100026	LC100018	LC100030	_
Paucispora kunmingense	MFLUCC 17-0932	MF173432	MF173428	MF173430	MF173434	MF173436
Pa. quadrispora	KH 448	LC001733	LC001722	LC001720	LC001754	_
Pa. quadrispora	KT 843	LC001734	AB619011	AB618692	LC001755	_
Pa. versicolor	KH 110	AB918731	AB918732	LC001721	LC001760	_
Pa. xishanensis	HKAS 115905	MZ966267	OK017522	OK017527	MZ997340	_
Pa. xishanensis	HKAS 115906	MZ966268	OK017523	OK017528	MZ997341	_
Platystomum actinidiae	KT 521	JN942963	JN941380	JN941375	LC001747	JN993490
Pl. actinidiae	KT 534	JN942962	JN941379	JN941376	LC001748	JN993492
Pl. crataegi	MFLUCC 14-0925	KT026117	KT026109	KT026113	KT026121	_
Pl. rosae	MFLUCC 15-0633	KT026119	KT026111	KT026115	_	_
Pl. salicicola	MFLUCC 15-0632	KT026118	KT026110	KT026114	_	_
Pseudopaucispora brunneospora	KH 227	LC312523	LC312552	LC312494	LC312581	LC312610
Vaginatispora amygdali	KT 2248	LC312524	LC312553	LC312495	LC312582	LC312611
V. amygdali	MFLUCC 18-1526	MK085055	MK085059	MK085057	MK087657	_
V. appendiculata	MFLUCC 16-0314	KU743217	KU743218	KU743219	KU743220	_
V. appendiculata	MFLUCC 13-0835	_	KY264745	KY264749	_	_
V. aquatica	MFLUCC 11-0083	KJ591577	KJ591576	KJ591575	_	_
V. armatispora	MFLUCC 18-0247	MK085056	MK085060	MK085058	MK087658	MK087669
V. armatispora	MFLUCC 18-0213	MN304826	MN274563	MN304831	MN328897	MN328894
V. microarmatispora	MTCC 12733	MF142592	MF142593	MF142594	MF142595	MF142596
V. scabrispora	KT 2443	LC312525	LC312554	LC312496	LC312583	LC312612
Teichospora rubriostiolata	TR7	KU601590	_	_	KU601609	KU601599
T. trabicola	C134	KU601591	_	_	KU601601	KU601600

3. Results

3.1. Phylogenetic Analyses

3.1.1. Phylogenetic Analyses of Alloleptosphaeria

One strain was successfully isolated in the laboratory. Phylogenetic analyses incorporated 25 strains using a 2801-character concatenated alignment (ITS: 556 bp; LSU: 881 bp; SSU: 1023 bp; tub2: 341 bp; gaps included). The optimal RAxML tree (likelihood score: −8462.532314) was derived from an alignment of 504 distinct patterns, including 25.52% undetermined characters/gaps. Estimated base frequencies were as follows: A = 0.244324, C = 0.224019, G = 0.271360, and T = 0.260297; substitution rates, AC = 1.370239, AG = 2.327667, AT = 1.974968, CG = 0.418253, CT = 5.227042, and GT = 1.000000; evolutionary parameters included gamma shape (α = 0.583180) and invariable sites (I = 0.753617). For the Bayesian analysis, a total of 1598 trees were retained after the 20% burn-in with a stop value of 0.008440. Both ML and BI methods yielded consistent topologies (Figure 1 and Figure S1). In our phylogenetic tree, Alloleptosphaeria xanthoceratis (CCMJ 13066) formed a distinct lineage with 42% ML and 1.00 BPP support (Figure 1).

Figure 1. The Bayesian 50% majority-rule consensus tree based on concatenated ITS, LSU, SSU, and tub2 sequences in Leptosphaeriaceae. The tree is rooted with Didymella exigua (CBS 183.55) and D. rumicicola (CBS 683.79). Maximum likelihood bootstrap support values ≥ 70% (ML) and Bayesian posterior probabilities ≥ 0.9 (BPP) are given at the nodes as ML/BPP. The type strains are in bold and black. The newly generated isolates are shown in bold red and marked with “T”.

Figure 1. The Bayesian 50% majority-rule consensus tree based on concatenated ITS, LSU, SSU, and tub2 sequences in Leptosphaeriaceae. The tree is rooted with Didymella exigua (CBS 183.55) and D. rumicicola (CBS 683.79). Maximum likelihood bootstrap support values ≥ 70% (ML) and Bayesian posterior probabilities ≥ 0.9 (BPP) are given at the nodes as ML/BPP. The type strains are in bold and black. The newly generated isolates are shown in bold red and marked with “T”.

3.1.2. Phylogenetic Analyses of Lophiostoma

Four strains were successfully isolated in the laboratory. Phylogenetic analyses were performed using a concatenated alignment of ITS (1–603 bp), LSU (604–1521 bp), SSU (1522–2503 bp), tef1-α (2504–3468 bp), and rpb2 (3469–4494 bp) sequences from 125 strains, totaling 4494 characters (including gaps). The RAxML analysis yielded a best-scoring tree (Figure 2) with a final ML optimization likelihood value of −34137.002757. The matrix had 1885 distinct alignment patterns, with 26.95% of undetermined characters or gaps. Estimated base frequencies were as follows: A = 0.249896, C = 0.247227, G = 0.266396, and T = 0.236482; substitution rates AC = 1.541329, AG = 4.043212, AT = 1.269617, CG = 1.398831, CT = 9.131101, and GT = 1.000000; proportion of invariable sites (I) = 0.563654; and gamma distribution shape parameter (α) = 0.661958. Bayesian analysis showed similar topologies with the RAxML analysis (Figure 2 and Figure S2); therefore, only the BI tree is presented herein (Figure 2). Bayesian inference yielded 11,202 post-burn-in trees, with convergence achieved at a stop value of 0.009957.

The phylogenetic analyses (ML/BI) strongly supported the monophyly of 11 Lophiostomataceae genera, with high statistical support (100% ML/1.00 BPP). A total of 88 strains of Lophiostoma formed a monophyletic clade with 75% ML support (Figure 2). Lophiostoma multiforme (CCMJ 13069 and CCMJ 13070) formed a well-supported monophyletic lineage with 88% ML and 0.99 BPP values (Figure 2). Lophiostoma montanae (CCMJ 13067 and CCMJ 13068) grouped with L. montanae (MFLUCC 16-0999, UESTCC 23.0038, and UESTCC 23.0039) with 0.99 BPP values.

Figure 2. The Bayesian 50% majority-rule consensus tree based on concatenated ITS, LSU, SSU, tef1-α, and rpb2 sequences in Lophiostomataceae. The tree is rooted with Teichospora rubriostiolata (TR7) and T. trabicola (C134). Maximum likelihood bootstrap support values ≥ 70% (ML) and Bayesian posterior probabilities ≥ 0.9 (BPP) are at the nodes as ML/BPP. The type strains are in bold and black. The newly generated isolates are indicated in bold red and marked with “T”.

Figure 2. The Bayesian 50% majority-rule consensus tree based on concatenated ITS, LSU, SSU, tef1-α, and rpb2 sequences in Lophiostomataceae. The tree is rooted with Teichospora rubriostiolata (TR7) and T. trabicola (C134). Maximum likelihood bootstrap support values ≥ 70% (ML) and Bayesian posterior probabilities ≥ 0.9 (BPP) are at the nodes as ML/BPP. The type strains are in bold and black. The newly generated isolates are indicated in bold red and marked with “T”.

3.2. Taxonomy

3.2.1. Alloleptosphaeria xanthoceratis R. Xu and Y. Li, sp. nov. (Figure 3)

MycoBank Number: 858873

Etymology: referring to the host plant genus Xanthoceras (Sapindaceae).

Holotype: HMJAU 60190

Description: Saprobic on dead stems of Xanthoceras sorbifolium. Sexual morph: Undetermined. Asexual morph: Conidiomata 131–175 × 110–200 µm ($\stackrel{-}{x}$ = 151 × 158 µm, n = 5), pycnidial, solitary to aggregated in small groups, semi-immersed in host substrate, black, elongate, subglobose, without a distinct ostiole. Ostioles absent. Conidiomatal wall multilayered, thick, 12–30 µm wide, comprising 3–4 layers of scleroplectenchymatous tissue, pale brown to brown, arranged in textura angularis. Conidiophores reduced to conidiogenous cells. Conidiogenous cells hyaline, phialidic, discrete, determinate, 9.8–22 × 1.8–3 µm ($\stackrel{-}{x}$ = 15 × 2.5 µm, n = 20), arising from inner wall layers. Conidia 3.6–6.4 × 2–6.4 µm ($\stackrel{-}{x}$ = 4.8 × 2.6 µm, n = 40), aseptate, hyaline, smooth-walled, guttulate, subcylindrical to narrowly ellipsoid, apex obtuse, base truncate.

Culture characteristics: Colonies reach 2 cm in diameter after 14 days at 25 °C. Colonies are dense, round, milky-white central domes, transitioning to gray toward the periphery, creeping hyphae margins irregular with pale brown; reverse white centrally, becoming dark brown peripherally.

Material examined: CHINA. Jilin Province: Changchun city, on dead stems of Xanthoceras sorbifolium. 16 October 2021, Rong Xu, HMJAU 60190 (holotype); living culture, CCMJ 13066.

GenBank numbers: ITS: PP151694; LSU: PP153449; SSU: PV569760; tub2: PV670045.

Notes: A BLASTn search of the ITS region revealed that our strain shares 96.41% similarity with A. iridicola (CBS 143395, NR_159068). The tub2 sequence is 84.92% similar to Leptosphaeria zhaotongensis (HKAS:124664, OP476695) with 94% query cover. In our phylogenetic study, Alloleptosphaeria xanthoceratis is phylogenetically closely related to three other Alloleptosphaeria species. To date, only A. iridicola has been reported to produce asexual morph within this genus [39]. Crous et al. [39] initially described Subplenodomus iridicola as the causative agent of Iris leaf spots in England, and it was later transferred to Alloleptosphaeria based on molecular evidence [40]. Morphologically, Alloleptosphaeria xanthoceratis is distinguished from A. iridicola by its larger conidiogenous cells (9.8–22 × 1.8–3 µm vs. 4–7 × 4–6 µm). We therefore formally describe it as a new species.

Figure 3. Alloleptosphaeria xanthoceratis (HMJAU 60190, holotype). (a,b) Conidiomata developing on natural substrate. (c) Longitudinal section through conidioma. (d) Wall of conidioma. (e–g) Conidiogenous cells and conidia. (h) Mature conidia. (i) Colony morphology on PDA. Scale bars: (c) = 100 µm; (d) = 20 µm; (e–g) = 10 µm; (h) = 5 µm.

Figure 3. Alloleptosphaeria xanthoceratis (HMJAU 60190, holotype). (a,b) Conidiomata developing on natural substrate. (c) Longitudinal section through conidioma. (d) Wall of conidioma. (e–g) Conidiogenous cells and conidia. (h) Mature conidia. (i) Colony morphology on PDA. Scale bars: (c) = 100 µm; (d) = 20 µm; (e–g) = 10 µm; (h) = 5 µm.

3.2.2. Lophiostoma montanae (Phukhams., Sue, and K.D. Hyde) Andreasen, Jaklitsch, and Voglmayr, Persoonia 46: 259 (2021) [41] = Sigarispora montanae Phukhams. Sue et al., Fungal Diversity 102: 55 [42], (Figure 4)

Index Fungorum number: IF557124; Facesofungi number: FoF 07295

Description: Saprobic on dead stems of Xanthoceras sorbifolium. Sexual morph: Ascomata dark brown to black, solitary, scattered, semi-immersed, globose, 186–350 × 160–278 μm ($\stackrel{-}{x}$ = 260 × 216 μm, n = 5), rough-walled, apex partially carbonaceous forming a clypeate structure, ostiolate, coriaceous. Ostioles central, crest-like at apex, 65–93 × 39–57 μm ($\stackrel{-}{x}$ = 76.1 × 49.6 μm, n = 5), elongated and laterally compressed, filled with hyaline periphyses, irregular wall. Peridium composed of 6–8 layers of thick-walled, brown to dark brown cells of textura angularis, broader at the apex and gradually tapering toward the base, 22–46 μm wide ($\stackrel{-}{x}$ = 33 μm, n = 20). Hamathecium 1–1.9 µm ($\stackrel{-}{x}$ = 1.6 μm, n = 20), densely arranged, hyaline, septate, frequently branched, and anastomosing within a gelatinous matrix. Asci bitunicate, fissitunicate, 8-spored, broad cylindrical to clavate, 102–130 × 9–14 µm ($\stackrel{-}{x}$ = 118 × 12 µm, n = 20), short pedicellate (pedicel furcate), apically rounded with distinct ocular chamber. Ascospores biseriate and partially overlapping, fusiform with attenuated ends, initially hyaline, becoming yellowish-brown at maturity, 16–29 × 4.5–6.8 µm ($\stackrel{-}{x}$ = 21.1 × 5.6 µm, n = 50), 3–5 transversely septa, constricted at the septa, cells above medial septum swollen, wall smooth, guttulate, surrounded by persistent mucilaginous sheath (3–5 μm) extending as polar appendages. Asexual morph: Undetermined.

Culture characteristics: Colonies on PDA reaching 30 mm in diameter after 35 days at 25 °C. Cultures from above are circular, flat, thick and dense, umbonate, entire edge, grayish white; reverse is cream-colored marginally, gradually darkening to brown at the middle region with a distinct red-brown central disc.

Material examined: CHINA. Jilin Province: Changchun city, Jinyue district, on dead stem of Xanthoceras sorbifolium, 10 June 2022, Rong Xu, XR36.1 (HMJAU 64835), living culture CCMJ 13067; XR36.2 (HMJAU 64836), living culture CCMJ 13068.

GenBank numbers: CCMJ 13067: ITS = PV569791, LSU = PV569911, SSU = PV569764, tef1-α = PV670048, rpb2 = PV670046. CCMJ 13068: ITS = PV569792, LSU = PV569912, SSU = PV569765, tef1-α = PV670049, rpb2 = PV6700467.

Host: Xanthoceras sorbifolium (this study), Clematis montana, Paeonia suffruticosa.

Distribution: Jilin Province (this study), Yunnan Province [42], Sichuan Province [14], China.

Notes: Lophiostoma montanae was originally described by Phukhamsakda et al. [42] from dead leaves of Clematis montana in China, characterized by its distinctive ascomata featuring ostioles with crest-like apices. Our new isolates align morphologically with this species and form a fully supported clade (100% ML/1.00 BPP) with L. montanae in phylogenetic analyses (Figure 2 and Figure 4). Thus, the isolates are identified as L. montanae, representing the first record of this species in X. sorbifolium and expanding its known host range in China.

Figure 4. Lophiostoma montanae (HMJAU 64835). (a,b) Ascomata developing on natural host substrate. (c) Longitudinal section through ascomata. (d) Ostiole. (e) Partial peridium wall. (f) Anastomosing pseudoparaphyses in hamathecium. (g–i) Asci. (j–m) Ascospores. (n) Colony morphology on PDA. Scale bars: (c) = 100 μm; (d,e,g–i) = 50 μm; (f,j–m) = 20 μm.

Figure 4. Lophiostoma montanae (HMJAU 64835). (a,b) Ascomata developing on natural host substrate. (c) Longitudinal section through ascomata. (d) Ostiole. (e) Partial peridium wall. (f) Anastomosing pseudoparaphyses in hamathecium. (g–i) Asci. (j–m) Ascospores. (n) Colony morphology on PDA. Scale bars: (c) = 100 μm; (d,e,g–i) = 50 μm; (f,j–m) = 20 μm.

3.2.3. Lophiostoma multiforme R. Xu and Y. Li, sp. nov. (Figure 5)

MycoBank number: 858874

Etymology: referring to its multiform of ascospores.

Holotype: HMJAU 64837.

Description: Saprobic on dead stems of Xanthoceras sorbifolium. Sexual morph: Ascomata 223–352 × 187–351 μm ($\stackrel{-}{x}$ = 226 × 259 μm, n = 5), black, solitary, superficial, scattered or aggregated in small groups, globose to subglobose, coriaceous. Ostioles 80–100 μm × 20–30 μm ($\stackrel{-}{x}$ = 90 × 25.4 μm, n = 5), slit-like, central. Peridium wider at the apex, 31–65 μm ($\stackrel{-}{x}$ = 43 μm, n = 20), attenuating toward the base, distinctly layered, comprising 6–8 cell layers; outer layers composed of reddish brown to dark brown, thick-walled cells of textura angularis, gradually transitioning inward to paler, more elongated cells of textura prismatica. Hamathecium composed of filamentous, densely branched, septate pseudoparaphyses, 1–1.7 μm wide, embedded in a gelatinous matrix, extending between and surpassing the asci. Asci 51–102 × 8–12 μm ($\stackrel{-}{x}$ = 81.9 × 10 μm, n = 30), bitunicate, fissitunicate, 8-spored, cylindrical to clavate, apex rounded with a distinct ocular chamber, base tapering to a short furcate pedicel. Ascospores 16–23 × 4–7 μm ($\stackrel{-}{x}$ = 20.1 × 5.5 μm, n = 50), 1–2-seriate, ellipsoidal to fusiform, gradually tapering toward both ends, (0-)1–2 transversely septa, initially hyaline, becoming dark brown at maturity, guttulate, smooth-walled, surrounded by a distinct mucilaginous sheath. Asexual morph: Undetermined.

Culture characteristics: Colonies on PDA attaining 30 mm diam after 10 days at 25 °C, circular with undulate margins, flat, moderately dense, greenish brown at the center, transitioning gradually to cream-colored at the periphery, with a distinct radiate pattern.

Material examined: CHINA. Hebei Province: Handan city, Qiu county, forest farm in Liangerzhuang Town, on dead stem of Xanthoceras sorbifolium, 9 August 2022, Rong Xu, XR98.1 (HMJAU 64837, holotype), ex-type living culture CCMJ 13069; XR98.2 (HMJAU 648838, isotype), ex-isotype living culture CCMJ 13070.

GenBank numbers: CCMJ 13069: ITS = PP151705, LSU = PP153460, SSU = PV569761, tef1-α = PV670043, rpb2 = PV670041. CCMJ 13070: ITS = PP151706, LSU = PP153461, SSU = PV569762, tef1-α = PV670044, rpb2 = PV670042.

Notes: The new collections fit well with the generic concept of Lophiostoma in having crest-like apices ascomata. In the phylogenetic analyses, two strains of L. multiforme (CCMJ 13069 and CCMJ 13070) are distinct from extant species in Lophiostomataceae and clustered with the strain of L. heterospora (AFTOL-ID 1036) with 88% ML/0.99 BPP support (Figure 2). A BLASTn analysis in GenBank revealed that the ITS sequence of CCMJ 13069 showed the highest similarity (92.77%) to L. compressum (MAL02, MW759267), while its LSU sequence most closely matched Guttulispora crataegi (MFLUCC 13-0442, NG_059563) with 97.87% similarity.

Lophiostoma multiforme differs from L. heterospora in having smaller ascomata (223–352 × 187–351 vs. 275–440 × 220–275 μm), smaller asci (51–102 × 8–12 vs. 70–110 × 15–23 μm), smaller ascospores (16–23 × 4–7 vs. 27–35 × 5–6 μm), and less septate (0–2 transversely septa vs. 8–10 transversely septa) [43]. Additionally, the ascospores of L. heterosporum are hyaline, while those of L. multiforme are initially hyaline and become dark brown at maturity. Based on morphological characteristics and multi-locus phylogenetic analyses, we propose Lophiostoma multiforme as a novel species.

Figure 5. Lophiostoma multiforme (HMJAU 64837, holotype). (a,b) Ascomata developing on natural host substrate. (c) Longitudinal section through ascomata. (d) Ostiole. (e) Partial peridium wall. (f) Anastomosing pseudoparaphyses in hamathecium. (g–k) Asci. (l–q) Ascospores. (r) Colony morphology on PDA. Scale bars: (c) = 100 μm; (d–e,l–q) = 20 μm; (f) = 10 μm; (g–k) = 50 μm.

Figure 5. Lophiostoma multiforme (HMJAU 64837, holotype). (a,b) Ascomata developing on natural host substrate. (c) Longitudinal section through ascomata. (d) Ostiole. (e) Partial peridium wall. (f) Anastomosing pseudoparaphyses in hamathecium. (g–k) Asci. (l–q) Ascospores. (r) Colony morphology on PDA. Scale bars: (c) = 100 μm; (d–e,l–q) = 20 μm; (f) = 10 μm; (g–k) = 50 μm.

4. Discussion

Pleosporales was formally defined as an order by Luttrell and Barr (1987) [9]. Due to the polyphyly of traditional morphological groupings, the order has undergone extensive reorganization and significant changes in circumscription [9]. Recent taxonomic studies on Pleosporales have significantly refined its classification through integrative approaches combining morphology, multi-locus phylogenetics, and phylogenomic analyses [7,8,44,45,46]. The application of high-throughput sequencing is helpful for the classification and identification of controversial species [45,47]. Despite these advances, the taxonomic delineation of many species remains unresolved. A robust framework integrating evolutionary genomics and functional ecology is imperative to clarify phylogenetic relationships and ecological diversification within this economically and ecologically pivotal fungal clade.

Alloleptosphaeria was established by Ariyawansa et al. [48] to include the single species A. italica, isolated from dead stems of Clematis vitalba in Italy. This genus species is characterized by semi-immersed to erumpent ascomata, papillate ostiole, reddish brown to dark brown pseudoparenchymatous cells present in the thin-walled peridium, septate, cellular pseudoparaphyses, cylindric-clavate asci, and hyaline to brown ascospores that have transverse or longitudinal septa or have transverse and longitudinal septa together [39,40,42,48,49]. The asexual morph has been documented only from A. iridicola [39]. Currently, there are four epithets (Alloleptosphaeria clematidis Phukhams. and K.D. Hyde; A. iridicola (Crous and Denman) Voglmayr; A. italica Wanas., Camporesi, Ariyaw. and K.D. Hyde; and A. shangrilana Thiyagaraja, Tennakoon and K.D. Hyde) listed in Species Fungorum (2022) under this genus. In the present study, Alloleptosphaeria xanthoceratis groups with other Alloleptosphaeria species with strong support (Figure 1) and differs from known asexual morphs in the genus by its larger conidiogenous cells (9.8–22 × 1.8–3 µm vs. 4–7 × 4–6 µm). Both asexual morph species of Alloleptosphaeria were discovered in temperate regions [39], suggesting these areas may be favorable habitats for asexual members of this genus.

The genus Lophiostoma (type genus of Lophiostomataceae) was established by Cesati and De Notaris (1863), with L. macrostomum designated as its type species [8,50]. Species of Lophiostoma are characterized by laterally compressed or crest-like ascomatal apices, typically occurring as saprobes on decaying plant material in both aquatic and terrestrial environments [41,51,52]. Lophiostoma has been subjected to a number of revisions since its introduction [50,51,52,53]. Andreasen et al. [41] proposed the synonymization of 14 genera with Lophiostoma based on multi-gene phylogenetic analysis using ITS, LSU, tef1-α, and rpb2 markers. A new species, Lophiostoma multiforme sp. nov., and a new record of L. montanae are described in this study based on their morphological characteristics and phylogenetic analysis. Lophiostoma montanae has been documented in Yunnan and Sichuan Provinces, China, associated with Clematis montana and Paeonia suffruticosa, respectively [14,42]. Our isolate was isolated from Xanthoceras sorbifolium in Jilin Province. Subtle variations in morphology were observed among these strains, suggesting that host substrates may influence fungal development. The newly identified strain contributes additional molecular data to the genus Lophiostoma.

Current estimates suggest 2.2–3.8 million fungal species exist worldwide, yet approximately 150,000 (3.5–7%) are formally described [1,54,55]. As the largest Ascomycota order, Pleosporales has a global distribution [7,8,9]. However, studies of microfungi in X. sorbifolium are very scattered, and there are a lot of fungal species that remain to be discovered [19,20,21,22]. Our results emphasize that pleosporalean fungi associated with X. sorbifolium are yet to be properly studied. Further research integrating multi-gene phylogenetic analysis, morphological characterization, and genomic study is essential to elucidate the diversity of microfungi associated with X. sorbifolium and their co-evolutionary interactions.