Enhancing Sorghum Growth: Influence of Arbuscular Mycorrhizal Fungi and Sorgoleone
Abstract
:1. Introduction
2. Material and Methods
2.1. Sorgoleone Production and Purification
2.2. Inoculation of the P9401 Sorghum Genotype with Arbuscular Mycorrhizal Fungi and Sorgoleone Under Controlled Conditions
2.3. Qualitative and Quantitative Assessments of Mycorrhizal Colonization
2.4. Sorghum Gene Expression
2.5. Microbial Diversity and Composition in the Sorghum Rhizosphere
2.5.1. Soil DNA Extraction
2.5.2. 16S and 28S rRNA Gene Amplification
2.5.3. Terminal Restriction Fragment Length Polymorphism (T-RFLP) Profile Analysis
2.5.4. Bacterial Community Identification
2.6. Phosphatases Activities
2.7. Data Statistical Analysis
3. Results
3.1. The Concentration of 20 µM Sorgoleone Promotes Increased Mycorrhization, P Content, and Plant Biomass
3.2. Overexpression of Genes Related to Sorgoleone Pathway and Mycorrhization
3.3. Effect of Treatments on Soil Microbiota
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Aguégué, M.R.; Agbodjato, N.A. Efficacy of Native Strains of Arbuscular Mycorrhizal Fungi on Maize Productivity on Ferralitic Soil in Benin. Agric. Res. 2021, 11, 627–641. [Google Scholar] [CrossRef]
- Kazadi, A.T.; Ansey, B.K. Effect of phosphorus and arbuscular mycorrhizal fungi (AMF) inoculation on growth and productivity of maize (Zea mays L.) in a tropical ferralsol. J. Crop Health 2022, 74, 159–165. [Google Scholar]
- Abdelhalim, T.; Jannoura, R.; Joergensen, R.G. Mycorrhiza response and phosphorus acquisition efficiency of sorghum cultivars differing in strigolactone composition. Plant Soil 2019, 437, 55–63. [Google Scholar] [CrossRef]
- Sarr, P.S.; Nakamura, S.; Ando, Y.; Iwasaki, S.; Subbarao, G.V. Sorgoleone production enhances mycorrhizal association and reduces soil nitrification in sorghum. Rhizosphere 2021, 17, 100283. [Google Scholar] [CrossRef]
- Wang, P.; Chai, Y.N.; Roston, R.; Dayan, F.E.; Schachtman, D.P. The Sorghum bicolor root exudate sorgoleone shapes bacterial communities and delays network formation. mSystems 2021, 6, 10–1128. [Google Scholar] [CrossRef]
- Watts-Williams, S.J.; Gill, A.R.; Jewell, N.; Brien, C.J.; Berger, B.; Tran, B.T.; Mace, E.; Cruickshank, A.W.; Jordan, D.R.; Cavagnaro, T.R.; et al. Enhancement of sorghum grain yield and nutrition: A role for arbuscular mycorrhizal fungi regardless of soil phosphorus availability. Plants People Planet 2021, 4, 143–156. [Google Scholar] [CrossRef]
- Cely, M.V.T.; Freitas, V.F. Inoculant of Arbuscular Mycorrhizal Fungi (Rhizophagus clarus) Increase Yield of Soybean and Cotton under Field Conditions. Front. Microbiol. 2016, 7, 720. [Google Scholar] [CrossRef]
- Marro, N.; Grilli, G. Soybean yield, protein content, and oil quality in response to interaction of arbuscular mycorrhizal fungi and native microbial populations from mono- and rotation-cropped soils. Appl. Soil Ecol. 2020, 152, 103575. [Google Scholar] [CrossRef]
- Kobae, Y.; Kameoka, H.; Sugimura, Y.; Saito, K.; Ohtomo, R.; Fujiwara, T.; Kyozuka, J. Strigolactone biosynthesis genes of rice are required for the punctual entry of arbuscular mycorrhizal fungi into the roots. Plant Cell Physiol. 2018, 59, 544–553. [Google Scholar] [CrossRef]
- Wu, Y.; Chen, C.; Wang, G. Inoculation with arbuscular mycorrhizal fungi improves plant biomass and nitrogen and phosphorus nutrients: A meta-analysis. BMC Plant Biol. 2024, 24, 960. [Google Scholar] [CrossRef]
- Oliveira, I.F.; Gomes, T.C.; Simeone, M.L.F.; Karam, D.; Tinoco-Sousa, S.M. Sorgoleone unveiled: Exploring its biosynthesis, functional perspectives and applications. Braz. J. Bot. 2024, 47, 723–733. [Google Scholar] [CrossRef]
- Oliveira, T.C.; Cabral, J.S.R.; Santana, L.R.; Tavares, G.G.; Santos, L.D.S.; Paim, T.P.; Müller, C.; Silva, F.G.; Costa, A.C.; Souchie, E.L.; et al. The arbuscular mycorrhizal fungus Rhizophagus clarus improves physiological tolerance to drought stress in soybean plants. Sci Rep. 2022, 12, 9044. [Google Scholar] [CrossRef] [PubMed]
- INVAM: International Culture Collection of (Vesicular) Arbuscular Mycorrhizal Fungi, West Virginia University. 2022. Available online: http://fungi.invam.wvu.edu (accessed on 10 January 2023).
- Sugiura, Y.; Akiyama, R.; Tanaka, S.; Yano, K.; Kameoka, H.; Marui, S.; Saito, M.; Kawaguchi, M.; Akiyama, K.; Saito, K. Myristate can be used as a carbon and energy source for the asymbiotic growth of arbuscular mycorrhizal fungi. Proc. Natl. Acad. Sci. USA 2020, 117, 25779–25788. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, S.; Hashimoto, K.; Kobayashi, Y.; Yano, K.; Maeda, T.; Kameoka, H.; Ezawa, T.; Saito, K.; Akiyama, K.; Kawaguchi, M. Asymbiotic mass production of the arbuscular mycorrhizal fungus Rhizophagus clarus. Commun. Biol. 2022, 5, 43. [Google Scholar] [CrossRef] [PubMed]
- Lanfranco, L.; Fiorilli, V.; Gutjahr, C. Partner communication and role of nutrients in the arbuscular mycorrhizal symbiosis. New Phytol. 2018, 220, 1031–1046. [Google Scholar] [CrossRef]
- Lynch, J.P. Root phenotypes for improved nutrient capture: An underexploited opportunity for global agriculture. New Phytol. 2019, 223, 548–564. [Google Scholar] [CrossRef]
- Barros, V.A.; Chandnani, R.; de Sousa, S.M.; Maciel, L.S.; Tokizawa, M.; Guimaraes, C.T.; Magalhaes, J.V.; Kochian, L.V. Root adaptation via common genetic factors conditioning tolerance to multiple stresses for crops cultivated on acidic tropical soils. Front. Plant Sci. 2020, 12, 565339. [Google Scholar]
- Wen, Z.; Li, H.; Shen, Q.; Tang, X.; Xiong, C.; Li, H.; Shen, J. Tradeoffs among root morphology, exudation and mycorrhizal symbioses for phosphorus-acquisition strategies of 16 crop species. New Phytol. 2019, 223, 882–895. [Google Scholar] [CrossRef]
- Pu, Z.; Zhang, R.; Wang, H.; Li, Q.; Zhang, J.; Wang, X.X. Root morphological and physiological traits and arbuscular mycorrhizal fungi shape phosphorus-acquisition strategies of 12 vegetable species. Front. Plant Sci. 2023, 14, 1150832. [Google Scholar] [CrossRef]
- Hufnagel, B.; de Sousa, S.M.; Assis, L.; Guimaraes, C.T.; Leiser, W.; Azevedo, G.C.; Negri, B.; Larson, B.G.; Shaff, J.E.; Magalhaes, J.V. Duplicate and conquer: Multiple homologs of PHOSPHORUS-STARVATION TOLERANCE1 enhance phosphorus acquisition and sorghum performance on low-phosphorus soils. Plant Physiol. 2014, 166, 659–677. [Google Scholar] [CrossRef]
- Parra-Londono, S.; Kavka, M.; Samans, B.; Snowdon, R.; Wieckhorst, S.; Uptmoor, R. Sorghum root-system classification in contrasting P environments reveals three main rooting types and root-architecture-related marker–trait associations. Ann. Bot. 2018, 121, 267–280. [Google Scholar] [CrossRef] [PubMed]
- Bernardino, K.C.; de Menezes, C.B.; de Sousa, S.M.; Guimarães, C.T.; Carneiro, P.C.S.; Schaffert, R.E.; Kochian, L.V.; Hufnagel, B.; Pastina, M.M.; Magalhaes, J.V. Association mapping and genomic selection for sorghum adaptation to tropical soils of Brazil in a sorghum multiparental random mating population. TAG. Theor. Appl. Genet. 2021, 134, 295–312. [Google Scholar] [CrossRef]
- Bernardino, K.C.; Pastina, M.M.; Menezes, C.B.; De Sousa, S.M.; Maciel, L.S.; Carvalho, G., Jr.; Guimarães, C.T.; Barros, B.A.; da Costa e Silva, L.; Carneiro, P.C.S.; et al. The genetic architecture of phosphorus efficiency in sorghum involves pleiotropic QTL for root morphology and grain yield under low phosphorus availability in the soil. BMC Plant Biol. 2019, 19, 87. [Google Scholar] [CrossRef] [PubMed]
- Hostetler, A.N.; Tinoco, S.M.S.; Sparks, E.E. Root responses to abiotic stress: A comparative look at root system architecture in maize and sorghum. J. Exp. Bot. 2024, 75, 553–562. [Google Scholar] [CrossRef] [PubMed]
- Oliveira, I.F.; Simeone, M.L.F.; De Guimarães, C.C.; Garcia, N.S.; Schaffert, R.E.; De Sousa, S.M. Sorgoleone concentration influences mycorrhizal colonization in sorghum. Mycorrhiza 2021, 31, 259–264. [Google Scholar] [CrossRef]
- Campolino, M.L.; dos Santos, T.T.; Lana, U.G.P.; Gomes, E.A.; Guilhen, J.H.S.; Pastina, M.M.; Coelho, A.M.; de Sousa, S.M. Crop type determines the relation between root system architecture and microbial diversity indices in different phosphate fertilization conditions. Field Crops Res. 2023, 295, 108893. [Google Scholar] [CrossRef]
- Chang, M.; Netzly, D.H.; Butler, L.G.; Lynn, D.G. Chemical regulation of distance. Characterization of the first natural host germination stimulant for Striga asiatica. J. Am. Chem. Soc. 1986, 108, 7858–7860. [Google Scholar]
- Vejan, P.; Abdullah, R.; Khadiran, T.; Ismail, S.; Nasrulhaq, B.A. Role of plant growth promoting rhizobacteria in agricultural sustainability—A review. Molecules 2016, 21, 573. [Google Scholar] [CrossRef]
- Liu, G.; Pfeifer, J.; Brito, F.R.; Emonet, A.; Stirnemann, M.; Gübeli, C.; Borghi, L. Changes in the allocation of endogenous strigolactone improve plant biomass production on phosphate-poor soils. New Phytol. 2018, 217, 784–798. [Google Scholar] [CrossRef]
- Ortas, I.; Bilgili, G. Mycorrhizal species selectivity of sweet sorghum genotypes and their effect on nutrients uptake. Acta Agr. Scand. B-S. P. 2022, 72, 733–743. [Google Scholar] [CrossRef]
- Czarnota, M.A.; Rimando, A.M.; Weston, L.A. Evaluation of Root Exudates of Seven Sorghum Accessions. J. Chem. Ecol. 2003, 29, 2073–2083. [Google Scholar] [CrossRef] [PubMed]
- Satish, K.; Gutema, Z.; Grenier, C.; Rich, P.J.; Ejeta, G. Molecular tagging and validation of microsatellite markers linked to the low germination stimulant gene (lgs) for Striga resistance in sorghum [Sorghum bicolor (L.) Moench]. Theor. Appl. Genet. 2012, 124, 989–1003. [Google Scholar] [CrossRef] [PubMed]
- EMBRAPA; Centro Nacional de Pesquisa de Solos. Manual de Métodos de Análise de Solo, 2nd ed.; Embrapa: Brasília, Brasil, 1997; p. 212. [Google Scholar]
- Dayan, F.E.; Howell, J.L.; Weidenhamer, J.D. Dynamic root exudation of sorgoleone and its in planta mechanism of action. J. Exp. Bot. 2009, 60, 2107–2117. [Google Scholar] [CrossRef]
- Brunetto, G.; Rosa, D.J.; Ambrosini, V.G.; Heinzen, J.; Ferreira, P.A.A.; Ceretta, C.A.; Soares, C.R.F.S.; Melo, G.W.B.; Soriani, H.H.; Nicoloso, F.T.; et al. Use of phosphorus fertilization and mycorrhization as strategies for reducing copper toxicity in young grapevines. Sci. Hortic. 2019, 248, 176–183. [Google Scholar] [CrossRef]
- Besserer, A.; Puech-Pagès, V.; Kiefer, P.; Gomez-Roldan, V.; Jauneau, A.; Roy, S.; Portais, J.-C.; Roux, C.; Bécard, G.; Séjalon-Delmas, N. Strigolactones stimulate arbuscular mycorrhizal fungi by activating mitochondria. PLoS Biol. 2006, 7, e226. [Google Scholar] [CrossRef]
- De Sousa, S.M.; Clark, R.T.; Mendes, F.F.; Oliveira, A.C.; Vasconcelos, M.J.V.; Parentoni, S.N.; Kochian, L.V.; Guimaraes, C.T.; Magalhaes, J.V. A role for root morphology and related candidate genes in P acquisition efficiency in maize. Funct. Plant Biol. 2012, 39, 925–935. [Google Scholar]
- Malavolta, E. Mineral Nutrition of Higher Plants—The First 150 Years. In Inter-Relação Fertilidade, Biologia do Solo e Nutrição de Plantas; Siqueira, J.O., Moreira, F.M.S., Lopes, A.S., Guilherme, L.R.G., Faquim, V., Furtini, A.E., Carvalho, J.G., Eds.; Viçosa: Lavras, Brasil, 1999; pp. 51–122. [Google Scholar]
- Paszkowski, U.; Jakovleva, L.; Boller, T. Maize mutants affected at distinct stages of the arbuscular mycorrhizal symbiosis. Plant J. 2006, 47, 165–173. [Google Scholar] [CrossRef]
- Ferreira, D.F. Sisvar: A computer statistical analysis system. Cienc. Agrotecnol. 2011, 35, 1039–1042. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Pan, Z.; Baerson, S.R.; Wang, M.; Bajsa-Hirschel, J.; Rimando, A.M.; Wang, X.; Duke, S.O. A cytochrome P450 CYP 71 enzyme expressed in Sorghum bicolor root hair cells participates in the biosynthesis of the benzoquinone allelochemical sorgoleone. New Phytol. 2018, 218, 616–629. [Google Scholar] [CrossRef]
- Walder, F.; Brulé, D.; Koegel, S.; Wiemken, A.; Boller, T.; Courty, P.E. Plant phosphorus acquisition in a common mycorrhizal network: Regulation of phosphate transporter genes of the Pht1 family in sorghum and flax. New Phytol. 2015, 205, 1632–1645. [Google Scholar] [CrossRef]
- LaMontagne, M.G.; Michel, F.C., Jr.; Holden, P.A.; Reddy, C.A. Evaluation of extraction and purification methods for obtaining PCR-amplifiable DNA from compost for microbial community analysis. J. Microbiol. Methods 2002, 49, 255–264. [Google Scholar] [CrossRef] [PubMed]
- Turner, S.; Pryer, K.M.; Miao, V.P.; Palmer, J.D. Investigating deep phylogenetic relationships among cyanobacteria and plastids by small subunit rRNA sequence analysis. J. Eukaryot. Microbiol. 1999, 46, 327–338. [Google Scholar] [CrossRef] [PubMed]
- Trouvelot, S.; Van Tuinen, D.; Hijri, M.; Gianinazzi-Pearson, V. Visualization of ribosomal DNA loci in spore interphasic nuclei of glomalean fungi by fluorescence in situ hybridization. Mycorrhiza 1999, 8, 203–206. [Google Scholar] [CrossRef]
- Verbruggen, E.; Van Der Heijden, M.G.A.; Weedon, J.T.; Kowalchuk, G.A.; Röling, W.F. Community assembly, species richness and nestedness of arbuscular mycorrhizal fungi in agricultural soils. Mol. Ecol. 2012, 21, 2341–2353. [Google Scholar] [CrossRef]
- Hammer, O.; Harper, D.A.T.; Ryan, P.D. PAST: Paleontological Statistics software package for education and data analysis. Palaeontol Electron. 2011, 4, 9. [Google Scholar]
- Tabatabai, M.A. Soil Enzymes. In Methods of Soil Analysis: Part 2 Microbiological and Biochemical Properties; Page, A.L., Ed.; The American Society of Agronomy: Madison, WI, USA, 1994; Volume 99, pp. 775–833. [Google Scholar]
- Ferreira, E.B.; Cavalcanti, P.P.; Nogueira, D.A. R Package Version 1.2.2; ExpDes.pt: Pacote Experimental Designs (Portugues). 2021. Available online: https://cran.r-project.org/web/packages/ExpDes.pt/ExpDes.pt.pdf (accessed on 10 January 2023).
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2021; Available online: https://www.R-project.org/ (accessed on 10 January 2023).
- Kassambara, A.; Mundt, F. R Package Version 1.0.7; Factoextra: Extract and Visualize the Results of Multivariate Data Analyses: 2020. Available online: https://CRAN.R-project.org/package=factoextra (accessed on 10 January 2023).
- Wickham, H. Ggplot2: Elegant Graphics for Data Analysis; Springer: New York, NY, USA, 2016. [Google Scholar]
- Wickham, H. Reshaping data with the reshape package. J. Stat. Softw. 2007, 21, 1–20. [Google Scholar] [CrossRef]
- Hess, D.E.; Ejeta, G.; Butler, L.G. Selecting sorghum genotypes expressing a quantitative biosynthetic trait that confers resistance to Striga. Phytochem. 1992, 31, 493–497. [Google Scholar] [CrossRef]
- Rich, P.J.; Grenier, C.; Ejeta, G. Striga resistance in the wild relatives of sorghum. Crop Sci. 2004, 4, 2221–2229. [Google Scholar] [CrossRef]
- Gobena, D.; Shimels, M.; Rich, P.J.; Ruyter-Spira, C.; Bouwmeester, H.; Kanuganti, S.; Ejeta, G. Mutation in sorghum LOW GERMINATION STIMULANT 1 alters strigolactones and causes Striga resistance. Proc. Natl. Acad. Sci. USA 2017, 114, 4471–4476. [Google Scholar] [CrossRef]
- Mohemed, N.; Charnikhova, T.; Fradin, E.F.; Rienstra, J.; Babiker, A.G.T.; Bouwmeester, H.J. Genetic variation in Sorghum bicolor strigolactones and their role in resistance against Striga hermonthica. J. Exp. Bot. 2018, 69, 2415–2430. [Google Scholar] [CrossRef]
- Ruyter-Spira, C.; Kohlen, W.; Charnikhova, T.; van Zeijl, A.; van Bezouwen, L.; de Ruijter, N.; Cardoso, C.; Matusova, R.; Bours, R.; Bouwmeester, H.; et al. Physiological effects of the synthetic strigolactone analog GR24 on root system architecture in Arabidopsis: Another belowground role for strigolactones? Plant Physiol. 2011, 155, 721–734. [Google Scholar] [CrossRef] [PubMed]
- Geo, J.A.; Nair, A.S.; Vijayan, A.K. Association of Glomus Intraradices in Sorghum Bicolor. Int. J. Agric. Sci. Food Technol. 2018, 4, 003–006. [Google Scholar] [CrossRef]
- Nakmee, P.S.; Techapinyawat, S.; Ngamprasit, S. Comparative potentials of native arbuscular mycorrhizal fungi to improve nutrient uptake and biomass of Sorghum bicolor Linn. Agric. Nat. Resour. 2016, 50, 173–178. [Google Scholar] [CrossRef]
- Nasr, A.H.; Zare, M.; Alizadeh, O.; Naderi, N.M. Improving effects of mycorrhizal symbiosis on sorghum bicolor under four levels of drought stress. Afr. J. Agric. Res. 2013, 43, 5347–5353. [Google Scholar]
- Torres, M.J.; Moreira, G.; Bhadha, J.H.; McLamore, E.S. Arbuscular mycorrhizal Fungi as Inspiration for Sustainable Technology. Encyclopedia 2024, 4, 1188–1200. [Google Scholar] [CrossRef]
- MacLean, A.M.; Bravo, A.; Harrison, M.J. Plant signaling and metabolic pathways enabling arbuscular mycorrhizal symbiosis. Plant Cell 2017, 29, 2319–2335. [Google Scholar] [CrossRef]
- Johri, A.K.; Oelmueller, R.; Dua, M.; Yadav, V.; Kumar, M.; Tuteja, N.; Stroud, R.M. Fungal association and utilization of phosphate by plants: Success, limitations, and future prospects. Front. Microbiol. 2015, 6, 984. [Google Scholar] [CrossRef]
- Gomez-Roldan, V.; Fermas, S.; Brewer, P.B.; Puech-Pages, V.; Dun, E.A.; Pillot, J.P.; Letisse, F.; Matusova, R.; Danoun, S.; Portais, J.C.; et al. Strigolactone inhibition of shoot branching. Nature 2008, 455, 189–194. [Google Scholar] [CrossRef]
- Luqman, M.; Shahbaz, M.; Maqsood, M.F.; Farhat, F.; Zulfiqar, U.; Siddiqui, M.H.; Haider, F.U. Effect of strigolactone on growth, photosynthetic efficiency, antioxidant activity, and osmolytes accumulation in different maize (Zea mays L.) hybrids grown under drought stress. Plant Signal. Behav. 2023, 18, 2262795. [Google Scholar] [CrossRef]
- Smalla, K.; Wieland, G.; Buchner, A.; Zock, A.; Parzy, J.; Kaiser, S.; Roskot, N.; Heuer, H.; Berg, G. Bulk and rhizosphere soil bacterial communities studied by denaturing gradient gel electrophoresis: Plant-dependent enrichment and seasonal shifts revealed. Appl. Environ. Microbiol. 2001, 67, 4742–4751. [Google Scholar] [CrossRef]
- Grayston, S.J.; Wang, S.; Campbell, C.D.; Edwards, A.C. Selective influence of plant species on microbial diversity in the rhizosphere. Soil Biol. Biochem. 1998, 30, 369–378. [Google Scholar] [CrossRef]
- Richardson, A.E.; Hadobas, P.A.; Hayes, J.E. Acid phosphomonoesterase and phytase activities of wheat (Triticum aestivum L.) roots and utilization of organic phosphorus substrates by seedlings grown in sterile culture. Plant Cell Environ. 2000, 23, 397–405. [Google Scholar]
- Baldwin, J.C.; Karthikeyan, A.S.; Raghothama, K.G. LEPS2, a phosphorus starvation-induced novel acid phosphatase from tomato. Plant Physiol. 2001, 125, 728–737. [Google Scholar] [CrossRef] [PubMed]
- Bozzo, G.G.; Dunn, E.L.; Plaxton, W.C. Differential synthesis of phosphate-starvation inducible purple acid phosphatase isozymes in tomato (Lycopersicon esculentum) suspension cells and seedlings. Plant Cell Environ. 2006, 29, 303–313. [Google Scholar] [CrossRef]
- Bucher, M. Functional biology of plant phosphate uptake at root and mycorrhiza interfaces. New Phytol. 2007, 173, 11–26. [Google Scholar] [CrossRef]
- Casieri, L.; Lahmidi, N.A.; Doidy, J.; Veneault-Fourrey, C.; Migeon, A.; Bonneau, L.; Courty, P.E.; Garcia, K.; Charbonnier, M.; Delteil, A.; et al. Biotrophic transportome in mutualistic plant–fungal interactions. Mycorrhiza 2013, 23, 597–625. [Google Scholar] [CrossRef]
- Smith, S.E.; Jakobsen, I.; Gronlund, M.; Smith, F.A. Roles of arbuscular mycorrhizas in plant phosphorus nutrition: Interactions between pathways of phosphorus uptake in arbuscular mycorrhizal roots have important implications for understanding and manipulating plant phosphorus acquisition. Plant Physiol. 2011, 156, 1050–1057. [Google Scholar] [CrossRef]
- Rausch, C.; Daram, P.; Brunner, S.; Jansa, J.; Laloi, M.; Leggewie, G.; Amrhein, N.; Bucher, M. A phosphate transporter expressed in arbuscule-containing cells in potato. Nature 2001, 414, 462–466. [Google Scholar] [CrossRef]
- Maeda, D.; Ashida, K.; Iguchi, K.; Chechetka, S.A.; Hijikata, A.; Okusako, Y.; Deguchi, Y.; Izui, K.; Hata, S. Knockdown of an arbuscular mycorrhiza-inducible phosphate transporter gene of Lotus japonicus suppresses mutualistic symbiosis. Plant Cell Physiol. 2006, 47, 807–817. [Google Scholar] [CrossRef]
- Yang, S.-Y.; Gronlund, M.; Jakobsen, I.; Grotemeyer, M.S.; Rentsch, D.; Miyao, A.; Hirochika, H.; Kumar, C.S.; Sundaresan, V.; Salamin, N.; et al. Nonredundant regulation of rice arbuscular mycorrhizal symbiosis by two members of the PHOSPHATE TRANSPORTER1 gene family. Plant Cell 2012, 24, 4236–4251. [Google Scholar] [CrossRef]
- Pan, Z.; Bajsa-Hirschel, J.; Vaughn, J.N.; Rimando, A.M.; Baerson, S.R.; Duke, S.O. In vivo assembly of the sorgoleone biosynthetic pathway and its impact on agroinfiltrated leaves of Nicotiana benthamiana. New Phytol. 2021, 230, 683–697. [Google Scholar] [CrossRef]
- Yoneyama, K.; Xie, X.; Kisugi, T.; Nomura, T.; Yoneyama, K. Nitrogen and phosphorus fertilization negatively affects strigolactone production and exudation in sorghum. Planta 2013, 238, 885–894. [Google Scholar] [CrossRef] [PubMed]
- Yoneyama, K.; Arakawa, R.; Ishimoto, K.; Kim, H.I.; Kisugi, T.; Xie, X.; Yoneyama, K. Difference in Striga-susceptibility is reflected in strigolactone secretion profile, but not in compatibility and host preference in arbuscular mycorrhizal symbiosis in two maize cultivars. New Phytol. 2015, 206, 983–989. [Google Scholar] [CrossRef] [PubMed]
- Borghi, L.; Liu, G.W.; Emonet, A.; Kretzschmar, T.; Martinoia, E. The importance of strigolactone transport regulation for symbiotic signaling and shoot branching. Planta 2016, 24, 1351–1360. [Google Scholar] [CrossRef] [PubMed]
- Dayan, F.E. Factors modulating the levels of the allelochemical sorgoleone in Sorghum bicolor. Planta 2006, 224, 339–346. [Google Scholar] [CrossRef]
- Tresseder, K.K. The extent of mycorrhizal colonization of roots and its influence on plant growth and phosphorus content. Plant Soil 2013, 371, 1–13. [Google Scholar] [CrossRef]
Description | Gene | Primer | Sequence (5′–3′) |
---|---|---|---|
Cytochrome P450 enzyme involved in biosynthesis of sorgoleone | CYP71AM1 | 21G12 | Fwd—AAGATCCAAGGCTACCATGTGC Rev—AACGTTGGCGACGACTATTG |
AMF colonization | AM3 | SbAM3 | Fwd—GGCAGCAACAAGGCTAATTC Rev—ACCCTTGTGACGGAGAACAC |
Rhizophagus irregulares Elongation factor | RiEF | RiEF | Fwd—TGTTGCTTTCGTCCCAATATC Rev—GGTTTATCGGTAGGTCGAG |
AMF-induced Pi transporter | Sb02g009880 | SbPT8 | Fwd—GCAGCGAGGCCAATGAGACT Rev—TTGGCTCCGGTAGGAAGCAG |
AMF-induced Pi transporter | Sb06g002560 | SbPT9 | Fwd—GAGGACGAGCCGTTCAAGAG Rev—CGCGACGGAGAAGAAGTACC |
AMF-induced Pi transporter | Sb06g002540 | SbPT10 | Fwd—CACCATGTGCTGGTTACTTC Rev—GATAATCGCCTGAGTACGTG |
AMF-induced Pi transporter | Sb03g029970 | SbPT11 | Fwd—CGTGGTTCCTTCTGGACATA Rev—TCTCGAACACCTCCTTGAGT |
Endogenous control | 18S rRNA | 18S | Fwd—AATCCCTTAACGAGGATCCATTG Rev—CGCTATTGGAGCTGGAATTACC |
Traits | AMF | Sorgoleone (µM) | |||
---|---|---|---|---|---|
0 | 20 | 40 | 80 | ||
L (cm) | Myc+ | 2472.57 ± 268.16 ABa | 3360.02 ± 579.36 Aa | 2930.90 ± 34.44 Aa | 1355.48 ± 439.70 Ba |
Myc− | 1769.02 ± 127.39 Aa | 2082.23 ± 119.22 Ab | 2830.16 ± 600.79 Aa | 1683.63 ± 128.02 Aa | |
SA (cm2) | Myc+ | 557.71 ± 20.88 Aa | 636.14 ± 96.29 Aa | 484.39 ± 52.93 Aa | 214.84 ± 59.21 Ba |
Myc− | 347.40 ± 35.85 Ab | 360.20 ± 49.57 Ab | 385.97 ± 93.79 Aa | 216.76 ± 31.95 Aa | |
D (mm) | Myc+ | 0.370 ± 0.04 Aba | 0.376 ± 0.07 ABa | 0.311 ± 0.03 Ba | 0.509 ± 0.02 Aa |
Myc− | 0.313 ± 0.02 Aa | 0.272 ± 0.02 Aa | 0.388 ± 0.08 Aa | 0.301 ± 0.12 Ab | |
SA1 (cm2) | Myc+ | 195.47 ± 22.23 ABa | 268.42 ± 54.08 Aa | 233.40 ± 7.17 Aa | 115.03 ± 33.94 Ba |
Myc− | 136.23 ± 10.80 Aa | 162.21 ± 1.96 Ab | 218.70 ± 49.54 Aa | 135.95 ± 10.20 Aa | |
SA2 (cm2) | Myc+ | 108.96 ± 11.55 ABa | 129.58 ± 20.86 Aa | 96.15 ± 13.68 ABa | 56.19 ± 16.30 Ba |
Myc− | 68.68 ± 4.82 Ab | 74.89 ± 11.64 Ab | 70.73 ± 17.11 Aa | 38.50 ± 9.90 Aa | |
SA3 (cm2) | Myc+ | 163.04 ± 22.14 Aa | 149.99 ± 13.34 Aa | 90.15 ± 29.53 ABa | 21.00 ± 1.42 Ba |
Myc− | 92.33 ± 21.30 Ab | 75.36 ± 19.38 Ab | 45.21 ± 17.78 Aa | 15.78 ± 7.29 Aa | |
RDW (g) | Myc+ | 0.87 ± 0.09 Aa | 0.92 ± 0.11 Aa | 0.62 ± 0.15 Aa | 0.19 ± 0.00 Aa |
Myc− | 0.44 ± 0.11 Aa | 0.46 ± 0.10 Aa | 0.91 ± 0.73 Aa | 0.08 ± 0.10 Aa | |
SDW (g) | Myc+ | 1.36 ± 0.16 Aba | 1.72 ± 0.43 Aa | 1.37 ± 0.27 ABa | 0.60 ± 0.10 Ba |
Myc− | 1.20 ± 0.18 Aa | 0.84 ± 0.21 Ab | 0.75 ± 0.12 Ab | 1.11 ± 1.04 Aa | |
TDW (g) | Myc+ | 2.23 ± 019 Aba | 2.64 ± 0.53 Aa | 1.99 ± 0.42 ABa | 0.79 ± 0.10 Ba |
Myc− | 1.64 ± 0.27 Aa | 1.30 ± 0.28 Ab | 1.66 ± 0.75 Aa | 1.19 ± 1.15 Aa | |
MYC (%) | Myc+ | 26.00 ± 1.82 Ba | 67.25 ± 2.99 Aa | 39.50 ± 4.58 ABa | 20.00 ± 4.24 ABa |
Myc− | 17.75 ± 1.19 Ba | 24.25 ± 1.72 Bb | 28.25 ± 2.27 Aa | 18.50 ± 2.12 ABa | |
RPCont (g) | Myc+ | 0.45 ± 0.03 Aa | 0.51 ± 0.06 Aa | 0.36 ± 0.08 Aa | 0.03 ± 0.00 Aa |
Myc− | 0.24 ± 0.06 Aa | 0.25 ± 0.05 Ab | 0.43 ± 0.37 Aa | 0.06 ± 0.08 Aa | |
SPCont (g) | Myc+ | 1.00 ± 0.09 Aa | 1.56 ± 0.44 Aa | 1.20 ± 0.08 Aa | 0.83 ± 0.35 Aa |
Myc− | 1.06 ± 0.14 Aa | 0.83 ± 1.16 Ab | 1.10 ± 0.25 Aa | 0.72 ± 1.75 Aa | |
TPCont (g) | Myc+ | 1.46 ± 0.10 Aa | 2.07 ± 0.44 Aa | 1.57 ± 0.16 Aa | 0.87 ± 0.35 Aa |
Myc− | 1.30 ± 0.21 Aa | 1.08 ± 0.18 Ab | 1.54 ± 0.36 Aa | 1.78 ± 1.84 Aa | |
Soil_PCont (g) | Myc+ | 13.50 ± 2.95 Aa | 11.27 ± 1.56 Aa | 13.45 ± 2.28 Aa | 8.60 ± 2.54 Aa |
Myc− | 12.65 ± 2.50 Aa | 11.15 ± 1.18 Aa | 15.95 ± 6.77 Aa | 10.50 ± 0.56 Aa |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Figueiredo de Oliveira, I.; Ferreira Simeone, M.L.; Gomes de Paula Lana, U.; de Carvalho Guimarães, C.; Morais de Sousa Tinôco, S. Enhancing Sorghum Growth: Influence of Arbuscular Mycorrhizal Fungi and Sorgoleone. Microorganisms 2025, 13, 423. https://doi.org/10.3390/microorganisms13020423
Figueiredo de Oliveira I, Ferreira Simeone ML, Gomes de Paula Lana U, de Carvalho Guimarães C, Morais de Sousa Tinôco S. Enhancing Sorghum Growth: Influence of Arbuscular Mycorrhizal Fungi and Sorgoleone. Microorganisms. 2025; 13(2):423. https://doi.org/10.3390/microorganisms13020423
Chicago/Turabian StyleFigueiredo de Oliveira, Isabela, Maria Lúcia Ferreira Simeone, Ubiraci Gomes de Paula Lana, Cristiane de Carvalho Guimarães, and Sylvia Morais de Sousa Tinôco. 2025. "Enhancing Sorghum Growth: Influence of Arbuscular Mycorrhizal Fungi and Sorgoleone" Microorganisms 13, no. 2: 423. https://doi.org/10.3390/microorganisms13020423
APA StyleFigueiredo de Oliveira, I., Ferreira Simeone, M. L., Gomes de Paula Lana, U., de Carvalho Guimarães, C., & Morais de Sousa Tinôco, S. (2025). Enhancing Sorghum Growth: Influence of Arbuscular Mycorrhizal Fungi and Sorgoleone. Microorganisms, 13(2), 423. https://doi.org/10.3390/microorganisms13020423