Next Article in Journal
Neobacillus terrisolis sp. nov. and Neobacillus solisequens sp. nov. Isolated from Soil
Previous Article in Journal
Presence of Microorganisms in the Environment: One Health Approach
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 13
Issue 11
10.3390/microorganisms13112436
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Association of Diarrheagenic Escherichia coli Virulence Genes and Antimicrobial Resistance Genes in an Interface Model of Swine Colonization and Human Diarrhea in Mexico

by
Elsa M. Tamayo-Legorreta
1,
Eduardo Moreno-Vazquez
1,
Jackeline Cerón-López
1,
Fabian Tellez-Figueroa
1,
Rosa M. Medina-Julián
2,
Hugo López-Gatell
1 and
Celia M. Alpuche-Aranda
1,*
1
Centro de Investigación Sobre Enfermedades Infecciosas, Instituto Nacional de Salud Pública, Cuernavaca 62100, Morelos, Mexico
2
Laboratorio Estatal de Salud Pública, Servicios de Salud Morelos, Jiutepec 62573, Morelos, Mexico
*
Author to whom correspondence should be addressed.
Microorganisms 2025, 13(11), 2436; https://doi.org/10.3390/microorganisms13112436
Submission received: 1 February 2025 / Revised: 2 March 2025 / Accepted: 12 March 2025 / Published: 23 October 2025
(This article belongs to the Special Issue Virulence Factors and Antibiotic Resistance of Enterobacterales: Third Edition)
Browse Figure
Versions Notes

Abstract

The accelerated spread of antimicrobial resistance, driven by the misuse of antibiotics in the context of ‘One Health’, is a public health concern worldwide due to the increasing number of human infections associated with foodborne and/or environmental pathogens, including multidrug-resistant Escherichia coli (E. coli). Monitoring pathogenic and multidrug-resistant E. coli isolates is essential for sustainable disease management in swine and human diarrhea cases. This study was designed to assess the multidrug resistance (MDR) profiles and virulence-associated gene (pathotypes) frequency of pathogenic and commensal E. coli strains by antimicrobial susceptibility testing and endpoint PCR among 983 E. coli isolates from swine fecal material and 425 stool isolates from human diarrhea cases, obtained from a closely monitored population between March 2015 and April 2016. Our results reveal that >50% of E. coli strains isolated from swine were resistant to nalidixic acid (78.94%), tetracycline (72%), ampicillin (55.54%), and co-trimoxazole (53.91%), and that, in humans, the highest resistance was observed in tetracycline (71.77%), nalidixic acid (65.41%), ampicillin (57.88%), and co-trimoxazole (53.88%). A lower frequency of resistance to ciprofloxacin was demonstrated in both swine (23.4%) and humans (15.3%), and minimal resistance to third-generation cephalosporins, ceftazidime (2.54%), and cefotaxime (2.44%) was observed in swine; however, resistance to these cephalosporins is much higher at 14.6% and 11.53% in humans. Among the pathotypes, EPEC was the most predominant (70.97%) in swine and DAEC (40%) in humans. In addition, pulsed-field gel electrophoresis separates the E. coli isolates into 22 patterns. Pathotypes such as EPEC and EHEC in swine highlight the need for surveillance and control in animal production to prevent zoonotic transmission. These results suggest that swine could act as a reservoir in human infection and that antimicrobial resistance could be transferred to humans from swine. Although we did not find clonal dissemination between the human and swine strains, the spread of similar multi-resistance profiles was observed, thus suggesting that multidrug resistance has been widely selected in this closed environment and may pose a public health risk.

1. Introduction

The constant evolution of infection-causing microorganisms, adapting to new hosts and environments, and crossing the barrier of specificity from colonization or infection in animals to humans or vice versa, imposes a new and additional toll of disease on health systems. These threats to human and animal health are triggered by multiple, interrelated, global factors related to human behavior, environmental changes, and the characteristics of the genetic plasticity of microorganisms. These factors reflect the complexity of ecosystems in which humans and animals share space. Understanding this complex interaction to develop and implement prevention and control measures against these infections cannot be tackled from a single angle. Therefore, the multidisciplinary approach converging in the “One Health” concept is essential. This concept recognizes the intrinsic link between human, animal, and environmental health and emphasizes a collaborative, multisectoral approach to addressing global health challenges. One Health provides a comprehensive framework for understanding and mitigating antimicrobial resistance, zoonotic diseases, and other health threats that arise at the human–animal–environment interface [1,2,3].
We have broadly discussed the selection of antimicrobial-resistant bacteria in animals and humans using various antibiotics as a clinical treatment in humans or animals or their use in animals as growth promoters. In addition, it has been suggested that the widespread use of antibiotics as growth promoters in animals exposes the human population to subtherapeutic doses through the consumption of animal products or by disseminating selected resistant strains in animals to various sources in the environment [4,5]. An example of bacteria with increasing antibiotic resistance is Enterobacteriaceae, such as Escherichia coli, one of the critical threats to global public health, generating significant morbidity and mortality and associated prolonged healthcare costs [6,7]. E. coli is a ubiquitous bacterium in the intestinal tract of humans and warm-blooded animals [8,9]. E. coli strains associated with widely community-acquired infections, such as acute enteritis, have been classified based on the presence of virulence-associated genes (VAGs) into six different pathogenic groups: Enteropathogenic E. coli (EPEC), enterohemorrhagic E. coli (EHEC), enterotoxigenic E. coli (ETEC), enteroinvasive E. coli (EIEC), enteroaggregative E. coli (EAEC), and diffusely adherent E. coli (DAEC) [10,11,12,13,14].
The emergence and persistence of multidrug-resistant (MDR) E. coli causing acute diarrhea is a serious public health problem. It causes nearly 500,000 deaths per year, especially among children up to five years of age in Asia, Africa, and Latin America [11,15]. The incidence differs between countries and regions due to recognized factors, such as socioeconomic group, sewage disposal, food safety, and close contact with animal reservoirs of potential pathogens [11,16,17,18,19].
The selection of antibiotic-resistant-pathogenic E. coli has increased due to horizontal gene transfer and exchange of mobile genetic elements, which has had significant public health implications [20]. These healthcare-acquired MDR bacteria have spread to livestock and the environment due to the persistence of antibiotic-resistance genes found in mobile genetic elements (MGEs) capable of spreading efficiently among bacteria in the community environment [21].
Identifying MDR or highly resistant bacteria (XDR) in pig farms alongside related communities could be considered as a monitoring system for the early detection of this event. Furthermore, the presence and persistence of these bacteria in swine could describe an important potential vehicle for developing and spreading antimicrobial resistance, especially in environments with inadequate sanitation [22].
This study aimed to assess the multidrug resistance (MDR) profiles and virulence-associated gene (pathotypes) frequency of pathogenic and commensal E. coli strains in the swine population of a semi-efficient farm and the simultaneous intensified epidemiological surveillance of acute diarrhea in the people living adjacent to the farm and consuming its products located in Jiutepec, Morelos, Mexico. This scientific evidence is needed to support the more specific regulation of antimicrobial use and surveillance of diarrheal disease in an interface model of swine colonization and human diarrhea in Mexico or similar countries.

2. Materials and Methods

2.1. Study

A descriptive cross-sectional study was carried out in Jiutepec, Morelos, Mexico. We included a semi-efficient swine farm (where swine production and consumption occur in the same community) and a model of epidemiological surveillance of diarrheal disease in the population attending three primary healthcare centers (PHC) located near the swine farm: Jiutepec, Huizachera, and Calera Chica. Moreover, the Cuernavaca General Hospital (HGC) “Dr. José G. Parres” was included, which referred patients with moderate and severe diarrhea cases from the region surveyed who did not attend the HCs.

2.2. Sample

Fecal samples of all pigs on the farm were obtained twice with an interval of six months. The first sampling was conducted from March to April 2015, and we collected 280 porcine fecal samples, and the second collection period took place in September 2015 with 228 fecal samples. For each pig, one rectal swab was obtained, and, using Cary–Blair transport medium (Deltalab, Barcelona, ES), the swabs were transported in cold boxes to the Laboratory of Infectious Disease Epidemiology of the National Institute of Public Health. Samples were inoculated on McConkey agar culture medium within four hours of collection. In addition, we collected 262 fecal samples from patients attending any of the three HCs or the CGH “Dr. José G. Parres”. The surveillance period was from May 2015 to April 2016. We included people with acute diarrheal disease who sought medical care from Monday through Friday from 8:00 to 16:00 at the three HCs and the General Hospital of Cuernavaca. They received routine medical care at these HCs, and we asked each of them for consent to participate in the study. From each participant, a rectal swab was taken, and, using Cary–Blair medium (Deltalab, Barcelona, ES), the swabs were transported in cold boxes (4 °C) to the State Public Health Laboratory for processing within four hours of arrival. The Research, Ethics, and Biosafety Committees approved this study at the National Institute of Public Health with CI: 1270, CE: 1642, and CB 1261, respectively.

2.3. Isolation and Identification of Escherichia coli Strains

Fecal samples were inoculated on selective MacConkey agar medium and cultured overnight at 37 °C (Thermo Scientific, Iowa City, IA, USA) to isolate E. coli. Three separate well-defined colonies with E. coli appearance (lactose positive and colony morphology) were randomly selected and re-inoculated on MacConkey agar and cultured at 37 °C overnight. API 20E (Biomérieux, Salt Lake City, UT, USA) was used to identify E. coli, incubated at 35 °C for 18 h and identified according to the manufacturer’s reading and interpretation criteria.

2.4. Antimicrobial Susceptibility Testing

Microdilution and agar disk diffusion methods were used to perform susceptibility testing on 10 antimicrobial agents according to Clinical and Laboratory Standards Institute (CLSI) guidelines [23]. The antimicrobial agents used included ampicillin (AMP; 10 µg), ceftazidime (CAZ; 30 µg), cefotaxime (CTX; 30 µg), imipenem (IPM; 10 µg), amikacin (AMK; 30 µg), gentamicin (GEN; 10 µg), ciprofloxacin (CIP; 5 µg), nalidixic acid (NA; 30 µg), trimethoprim/sulfamethoxazole (SXT, co-trimoxazole; 25 µg), and tetracycline (TET; 30 µg). All assays were performed in duplicate. Minimum Inhibitory Concentration (MIC) and disk diffusion results were interpreted according to the breakpoints provided by the CLSI [23] and classified as susceptible, intermediate, or resistant. These antimicrobials are representative of the major antimicrobial drug classes that are important for both veterinary and human medicine. E. coli ATCC 25922 and Klebsiella pneumoniae ATCC 700603 were used as controls. Classification of MDR strains was defined as resistance to at least three or more antibiotic families [24,25].

2.5. Virulence Factor Gene Detection

Virulence genes to determine six different E. coli pathotypes were identified by conventional PCR. Bacterial boiling method was used to obtain bacteria DNA [26]. The selected virulence genes and the specific primers are shown in Table 1. Each 25 μL reaction mixture contained a final concentration of 1x reaction buffer (100 mM Tris/HCl, pH 8.5; 500 mM KCl, 1% Triton X-100), 2 mM MgCl2, 0.2 mM each dNTP (dNTP mix, 10 mM, Thermo Scientific, Iowa City, IA, USA), 10 μM each primer, 1.0 U Taq DNA polymerase (Thermo Scientific, Iowa City, IA, USA), 5 μL template DNA, and nuclease-free water. The PCR amplification conditions for all reactions were initial denaturation at 94 °C for 5 min, followed by 30 cycles of denaturation at 94 °C for 45 s, annealing at 58 °C for 45 s, and extension at 72 °C for 45 s, and a final extension at 72 °C for 7 min [16]. PCR products were visualized by electrophoresis on a 1% agarose gel stained with SYBR® Green (Invitrogen, Carlsbad, CA, USA) at 100 V for 45 min. The positive controls were EPEC O127:H6 (strain E2348/69, eae), EHEC O157:H7 (eae, stx1, stx2), ETEC O78:H11 (strain H10407, elt, est), EIEC O136:NM (ipaH), EAEC O44:H18 (strain O42, aggR), and DAEC O75:H-E66438 (daaE) (kindly donated by Dr. Carlos Eslava, Universidad Nacional Autónoma de México, Mexico City 04510, Mexico).

2.6. Pulsed-Field Gel Electrophoresis (PFGE)

MDR-EC strains were genotyped using PFGE [28,29]. We prepared the genomic DNA with the bacterial boiling method and digested it with 50 U XbaI (New England BioLabs Inc., Ipswich, MA, USA). DNA was separated by electrophoresis using a CHEF-DR II system (BioRad, Birmingham, UK). After 23 h, the gel was stained with ethidium bromide, and PFGE patterns were visualized under UV light. We used the Salmonella serotype Braenderup strain (H9812) as a control and the Lambda PFG ladder (New England BioLabs Inc., Ipswich, MA, USA) as a size marker. PFGE patterns were interpreted following the criteria of Tenover [30]. In addition, a computer analysis of PFGE profiles was performed with BioNumerics 5.10 software (Applied Maths, Sint-Martens-Latem, Belgium). Dendrograms were constructed using Dice’s similarity coefficient, a tolerance coefficient, and unweighted pair group methods with the arithmetic mean algorithm (UPGMA).

2.7. Statistical Analysis

We performed a two-sample proportion test (Z-test for proportions) to compare the antimicrobial resistance rates and Escherichia coli virulence gene frequency between farm animals and the human population. This test evaluates whether two independent proportions are significantly different by calculating a Z-score based on the standard normal distribution [31]. A two-sample test for proportions (Z-test for proportions) was used to compare the proportions of antimicrobial resistance between different groups. This statistical method is appropriate when evaluating differences between two independent groups with categorical binary outcomes (e.g., presence or absence of resistance genes). The Z-test for proportions assumes a sufficiently large sample size to approximate the normal distribution under the central limit theorem, making it a robust method for comparing proportions in microbiological and epidemiological studies [31]. The test was performed at a 95% confidence level, and significance was assessed at p < 0.05.

3. Results

3.1. Prevalence of Escherichia coli Strains Isolated from Swine and Human

A total of 1524 presumptive E. coli strains were isolated from 508 swine fecal samples, of which 983/1524 (64.5%) were confirmed by API 20E. Similarly, 786 presumptive E. coli strains were isolated from 262 human diarrheal cases, of which 425/786 (54.07%) were confirmed by API 20E. Most of the swine E. coli strains came from piglets (517/983, 52.59%) and sows (444/983, 45.17%), while human isolates were mainly obtained from patients at the Cuernavaca General Hospital “Dr. José G. Parres” (Table 2).

3.2. Antimicrobial Susceptibility Testing

Table 3 shows the antimicrobial susceptibility results for pathogenic (PCR-pathogenic-marker-positive) and non-pathogenic E. coli. A comparative resistance analysis revealed a significantly higher resistance in swine isolates to nalidixic acid (78.94% vs. 65.41%; p < 0.0001) and ciprofloxacin (23.39% vs. 15.3%; p = 0.0007). In contrast, human isolates showed a significantly higher resistance to gentamicin (46.35% vs. 37.84%; p = 0.0032), ceftazidime (14.59% vs. 2.54%; p < 0.0001), cefotaxime (11.53% vs. 0%; p < 0.0001), and ceftazidime/cefotaxime (11.29% vs. 2.44%; p < 0.0001) than porcine isolates. No significant differences were observed for ampicillin (p = 0.42) and cotrimoxazole (p = 0.95), while tetracycline resistance remained equally high in both populations (72%; p = 0.98). Multidrug resistance was detected in 66.22% of swine isolates and 64.71% of human isolates, with no significant difference (p = 0.61). Resistance to amikacin and imipenem was absent in all porcine and human isolates.

3.3. Multidrug Resistance

Table 4 shows the results of the identified multidrug resistance profiles. We observed that 25.54% of the swine isolates were resistant to three antibiotic families (251 isolates). The most common resistance profile was NAL-SXT-TET (48 isolates), followed by GEN-NAL-TET (43 isolates), while 22.35% (95 human isolates) were shown to be resistant to three antibiotic families; the most common resistance profiles were AMP-NAL-TET and GEN-NAL-TET (19 isolates). Resistance to eight antibiotics was found in only six (0.61%) swine and eighteen (4.24%) human isolates. Regarding multidrug resistance, among those resistant to three or more drugs out of the seven tested, 66.22% (651 swine isolates) and 64.71% (275 human isolates) showed multidrug resistance.

3.4. Pathotype Characterization

The determination of pathotype-specific genes showed that 6.31% (62/983) and 22.35% (95/425) of E. coli isolates from swine and humans, respectively, carried at least one pathogenicity marker (Table 5). The highest percentage of diarrheagenic E. coli (DEC) was isolated from humans. The most common pathotypes in swine were EPEC (eae), associated with diarrhea, and EHEC (stx1, stx2, and stx1: stx2), associated with hemorrhagic colitis. In humans, DAEC (daa) was the most frequent pathotype, followed by EPEC (eae).

3.5. Phylogenetic Analysis of E. coli

The PFGE analysis revealed 22 patterns among the E. coli isolates from swine and humans (A–V) with five subtypes (A1–A3, D1, and Q1). The patterns (A, A1–A3, E, R, S, and V) were present in E. coli MDR isolates from swine, whereas the patterns (B, C, D, D1, F, G, H, I, J, K, L, M, N, O, P, Q, Q1, T, and U) were present in isolates from the community population. The most represented patterns from swine were A (ten isolates) and E (five isolates), while those from humans were O and Q, each with three isolates; D and G, each with two isolates; and the remaining patterns from both swine and humans were represented by only one isolate. We found that most of the patterns (A and E) were present only in piglets and sows. At the same time, the MDR E. coli isolates did not show clonality in the human isolates, except for ten isolates (D, D1, G, O, Q, and Q1). The results of the computer analysis of the banding patterns showed similarity percentages ranging from 100% to 70% (Figure 1). When the majority of the PFGE patterns were compared with the antimicrobial susceptibility profile and pathotypes, we observed that the isolates with patterns A and E were sensitive to ceftazidime and cefotaxime and were EPEC and EHEC. Isolates with patterns G, O, and Q were resistant to third-generation cephalosporins. All isolates were sensitive to imipenem and amikacin.

4. Discussion

A comparative analysis of antimicrobial resistance between Escherichia coli isolates from swine and humans reveals distinct patterns consistent with the findings of recent studies [32,33]. In our research, swine isolates exhibited a significantly higher resistance to nalidixic acid (78.94% vs. 65.41%; p < 0.0001) and ciprofloxacin (23.39% vs. 15.3%; p = 0.0007) compared to human isolates. Fluoroquinolones are classified as “critically important antimicrobials” due to their significance in human and animal medicine [34,35]. The widespread use of fluoroquinolones and enrofloxacin (nalidixic acid precursor) in veterinary medicine may explain this increased resistance in swine. Similarly, a study correlating antimicrobial resistance patterns of E. coli in livestock and humans reported lower resistance rates to nalidixic acid in E. coli strains isolated from swine (21.1%) and humans (15.8%) [36]. Ciprofloxacin resistance in humans (15.3%) was low compared to other studies that reported a 32% resistance to ciprofloxacin in E. coli isolates from children < 5 years of age from the National Institute of Pediatrics in Mexico City [37]. Our results for the nalidixic acid resistance (78.94%, 65.41%) of E. coli isolates from swine and humans, respectively, were higher than those of other countries, e.g., Netherlands: 1.0%, and Korea: 65.6% [33,38]. High quinolone resistance in swine is a critical problem, suggesting an extensive use of antibiotics in animal husbandry. It could drive a high selective pressure towards bacteria resistant to these antibiotics. Since quinolone resistance can be transmitted from swine to humans, this becomes a public health hazard. A possible explanation for the high proportion of bacteria resistant to quinolones and ampicillin, even though these antibiotics are not administered directly to the swine, could be the presence of certain antibiotics (e.g., tetracyclines) in their feed. This may be indirectly selected for resistant bacteria through resistance cassettes, contributing to the persistence and dissemination of antimicrobial resistance within the swine population. Reducing antimicrobial resistance is crucial for preventing the transmission of resistant strains from animals to humans and maintaining treatment efficacy [39].
In contrast, human isolates in our study had a significantly higher resistance to gentamicin (46.35% vs. 37.84%; p = 0.0032), ceftazidime (14.59% vs. 2.54%; p < 0.0001), and cefotaxime (11.53% vs. 0%; p < 0.0001) than porcine isolates. This trend is consistent with the results of another study in which higher levels of resistance to most antimicrobial agents were found in humans than in swine isolates [40]. In contrast, data published in Korea showed that E. coli strains isolated from swine showed a 51.6% resistance to gentamicin, whereas those isolated from human patients showed a lower resistance [33,41]. A U.S. study also observed a high gentamicin resistance in porcine E. coli strains [9]. The contrast with the current published data could indicate geographic variations or differences in antibiotic use among the populations studied.
One of the resistances that stood out in our study was that of third-generation cephalosporins (3GC), particularly ceftazidime (CAZ) and cefotaxime (CTX) in swine; this highlights an emerging problem in this farm animal model. The frequency of CAZ and CTX resistance in swine is like that in Thailand [42], and the resistance observed in humans was lower than that reported in other studies [37]. Recent studies have indicated that resistance to 3GC, especially those mediated by extended-spectrum β-lactamases (ESBL), is a worldwide concern in humans and production animals [43,44]. Previous studies suggest that resistance to β-lactams in animals intended for human consumption may indicate their role as a reservoir of resistance genes within mobile genetic elements. The transfer of resistant bacteria to humans is possible through direct contact with animals or the food chain, as suggested by these studies [45]. Thus, it is unlikely that the selection for resistance occurred on the farm, which corroborates the multiclonality results, as selection in a closed environment such as a farm would favor clonal spread. The individuals sampled did not come from hospitalized patients but from community-acquired infections. These data suggest that 3GC resistance is spreading outside the human environment into the swine farm. The prevalence of resistance to 3GC in swine isolates suggests that human antimicrobial use may factor in the emergence of resistant bacteria in animals.
No significant differences were observed in our study for ampicillin (p = 0.42) and co-trimoxazole (p = 0.99), while resistance to tetracycline remained equally high in both populations (72%; p = 0.98). These results are, in part, consistent with those of Christodoulou (2023) [36], who also reported a high tetracycline resistance in E. coli isolates from both swine (84.2%) and humans (73.7%). However, contrary to our results, he observed a significant difference in ampicillin resistance between swine (31.6%) and humans (52.6%). The ampicillin resistance in our study suggests a pronounced and non-random issue with this antibiotic in the swine population. According to published studies, the frequency of ampicillin resistance reported in strains from animals (swine) is highly variable, with values lower or higher than those found in our study (55.44%) [46,47,48,49]. In strains isolated from patients with diarrhea, the frequency of resistance found (57.88%) was higher than in South Korea (40%) [50] and lower compared to a study conducted in Mexico, where ampicillin resistance was 69% [37]. This suggests that resistance to this antibiotic is spreading in humans, in strains colonizing animals, and, most likely, in the ecosystem in this model human–animal health interface. Although this study does not allow us to determine the direction of transfer of the resistance mechanism, they likely came from human strains, since ampicillin has long been in use. Transmission may have occurred through water or soil [51,52].
Among E. coli isolates recovered from swine and humans, a high resistance to tetracycline and co-trimoxazole (trimethoprim/sulfamethoxazole) was observed, but without statistical significance in either group (p > 95). This could indicate widespread resistance. We found a similar tetracycline resistance of 72% in swine and humans, which is high compared to other studies [50]. A comparison of our results in the case of co-trimoxazole resistance indicates a similar prevalence in E. coli strains isolated from swine and humans. A recent report by the European Food Safety Authority (EFSA) [53] indicated a high prevalence of co-trimoxazole resistance in E. coli strains of animal and human origin, reflecting a trend like the data provided. Some studies showed that co-trimoxazole resistance in E. coli of human origin may vary, but remains significant, e.g., in Mexico City (44%) [37] and South Korea (35%) [50].
Our study detected multidrug resistance (MDR) in 66.22% of swine isolates and 64.71% of human isolates, with no significant difference (p = 0.61). This high prevalence of MDR is concerning and underscores the need for the prudent use of antimicrobials in human and veterinary medicine. These results were higher than those obtained in other studies in swine [54] and humans [32,55]. In a longitudinal study, significant differences in the prevalence levels of multidrug-resistant isolates were also observed between host species, with swine being at a higher risk of carrying MDR E. coli [56]. Our results could reflect a more intensive use of antibiotics in the livestock industry. In addition, a high resistance to combinations of more than three antibiotics is more prevalent in swine, which may indicate a higher selective antibiotic pressure in these animals and more extensive or inadequate exposure to multiple antibiotics in swine. Resistance to more than five antibiotics highlights a serious multi-resistance problem in the animal population and is of concern due to the risk of transmission to humans. The interface between human and animal health is critical in the context of antimicrobial multidrug resistance. This study shows a high prevalence of MDR E. coli in swine, which may have significant implications for human health due to the possibility of transferring resistant bacteria or resistance genes [33,57]. The high level of antimicrobial multidrug resistance is directly related to the challenges in the treatment of infectious diseases, making it essential to control it. On the other hand, we did not observe a relationship between the multidrug resistance profile and the presence or absence of genes encoding enteropathogenic factors among E. coli isolated from swine and humans. Therefore, the factors that select MDR E. coli strains are independent of the pathogenicity of the microorganism.
A gene-specific pathotyping analysis revealed that 6.31% of E. coli isolates of swine-origin and 22% of those of human origin carried at least one pathogenicity marker. The prevalence of pathogenicity markers is significantly higher in humans than in swine, which may be attributed to the expected higher frequency of pathogenic E. coli in the human cases of diarrhea studied. The most common pathotypes in swine were EPEC (eae), associated with diarrhea, and EHEC (stx1, stx2, and stx1:stx2), associated with hemorrhagic colitis, suggesting a significant risk to animal health and potentially to human health if zoonotic transmission occurs. Although EPEC was most prevalent in swine, ETEC has been one of the most frequently isolated pathotypes in swine [58]. ETEC is one of the main causes of diarrhea in suckling and weaned piglets, causing essential losses in the swine industry [58,59]. The low prevalence of ETEC found in this study could be because there was no incidence of sick swine with diarrhea. A curious finding was the detection of EIEC on the farm. The detection of EIEC on swine farms could imply a possible transmission from a human source or a change in the dynamics of the pathogen in the farm environment. This issue raises concerns about the possibility of reverse zoonosis, where pathogens are transmitted from humans to animals and vice versa. Such transmission may increase the risk of disease outbreaks in animal and human populations.
In addition, the presence of EIEC in swine could indicate an adaptation of this pathogen to a new host, an example of bacterial evolution. It could suggest that EIEC is developing the ability to survive and multiply in different environments and hosts. EIEC infections can cause economic losses due to decreased animal growth, increased mortality, and costs associated with the treatment and management of outbreaks [60,61]. No swine EAEC (aat) and DAEC (daa) isolates were found. The most common pathotype in humans was DAEC (daa), followed by EPEC (eae). Both pathotypes are associated with diarrhea in humans, indicating a significant burden of gastrointestinal disease caused by pathogenic E. coli. The difference between the pathotypes suggests variability in the distribution of pathotypes between swine and human populations.
Molecular typing by PFGE investigates the clonal relationship between different bacterial isolates. We identified twenty-two distinct patterns in the E. coli isolates, and, despite the diversity, six patterns predominated; this heterogeneity of patterns and predominance of specific clones has been observed in other studies [62,63,64]. The diversity of E. coli patterns in swine and humans and the MDR strains in both groups suggest a potential for zoonotic transmission. Swine may act as reservoirs for resistant strains transmitted to humans, especially in close-contact environments such as farms and slaughterhouses. We detected clonal spread on the swine farm, where the E. coli strains with the most PFGE patterns were found in suckling piglets, weaning piglets, and sows due to the proximity of swine in the pens.

5. Conclusions

The data suggest that MDR has been widely targeted in this closed environment. In swine, dangerous pathotypes such as EPEC, EHEC, and EIEC underline the need for surveillance and control in animal production to prevent zoonotic transmission. Our study on the association of virulence genes and antimicrobial resistance in diarrheagenic and commensal E. coli in a swine colonization human diarrhea interface model in Mexico is essential in order to address the complex transmission dynamics of multidrug-resistant bacteria, highlighting the importance of genetic surveillance and the implementation of responsible antibiotic use and stewardship practices to reduce the risk of zoonotic transmission and protect public health. A “One Health” approach is vital in order to address the antimicrobial resistance, pathogenicity, and clonality of E. coli. The present study has limitations. The results analyze the sharing of patterns of antibiotic resistance but do not establish the direction of the transfer of this resistance or the mechanisms of transmission between animals and humans. Future research will focus on the whole-genome sequencing (WGS) of multidrug-resistant pathogenic and commensal E. coli strains to determine whether different resistance mechanisms are co-selected in this interface model. These efforts will further elucidate the evolutionary pathways of resistance transmission and provide valuable insights in order to improve antibiotic stewardship in human and animal health.

Author Contributions

Conceptualization, E.M.T.-L.; formal analysis, E.M.T.-L. and C.M.A.-A.; fundraising, C.M.A.-A.; research, E.M.T.-L., E.M.-V., J.C.-L. and C.M.A.-A.; methodology, E.M.T.-L., E.M.-V., J.C.-L., F.T.-F., R.M.M.-J. and H.L.-G.; project administration, C.M.A.-A.; resources, C.M.A.-A.; software, E.M.T.-L.; supervision, E.M.T.-L. and C.M.A.-A.; validation, E.M.T.-L. and C.M.A.-A.; visualization, E.M.T.-L.; writing—original draft preparation, E.M.T.-L.; writing—review and editing, E.M.T.-L. and C.M.A.-A. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by grants number 215146 PDCPN2013-01-CONACYT (Consejo Nacional de Ciencia y Tecnología) and number CF-2023-I-2223 from CF-CONAHCYT (Ciencia de Frontera-Consejo Nacional de Humanidades, Ciencia y Tecnología). J.C.-L. is a Master’s student on a CONAHCYT fellowship.

Institutional Review Board Statement

Signed informed consent was obtained from the swine farm and volunteers, as well as consent to use fecal samples for assays. All methods were conducted following NIH guidelines. The Research and Ethics Committees approved this study at the Instituto Nacional de Salud Pública with the numbers 215146 PDCPN2013-01(CI/2015/051); CF-2023-I-2223 (CI/2023/663). A sampling of swine was performed as described in the Mexican Official Standard 062-Zoo-1999 [31].

Informed Consent Statement

Written informed consent was obtained from all patients involved in the study to publish this paper.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Acknowledgments

We acknowledge Carlos Eslava (Universidad Nacional Autónoma de Mexico) for providing control strains of the E. coli pathogens, and María Hernández-Franco, and Fatima Hernández-Bonilla from Servicios de Salud de Morelos, Mexico, and Fernando Mariscal for their excellent technical assistance. We also thank Ariadna Nava-Mercado and Lorena Guerrero-Hernández from the Centro de Investigación Sobre Enfermedades Infecciosas/Instituto Nacional de Salud Pública, for their valuable administrative support in this project.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Heymann, D.L.; Brilliant, L. Surveillance in eradication and elimination of infectious diseases: A progression through the years. Vaccine 2011, 29 (Suppl. 4), D141–D144. [Google Scholar] [CrossRef]
  2. Gardy, J.L.; Loman, N.J. Towards a genomics-informed, real-time, global pathogen surveillance system. Nat. Rev. Genet. 2018, 19, 9–20. [Google Scholar] [CrossRef]
  3. Kasanga, M.; Shempela, D.M.; Daka, V.; Mwikisa, M.J.; Sikalima, J.; Chanda, D.; Mudenda, S. Antimicrobial resistance profiles of Escherichia coli isolated from clinical and environmental samples: Findings and implications. JAC Antimicrob. Resist. 2024, 6, dlae061. [Google Scholar] [CrossRef] [PubMed]
  4. Founou, L.L.; Founou, R.C.; Essack, S.Y. Antibiotic resistance in the food chain: A developing country-perspective. Front. Microbiol. 2016, 7, 1881. [Google Scholar] [CrossRef]
  5. Szmolka, A.; Nagy, B. Multidrug resistant commensal Escherichia coli in animals and its impact for public health. Front. Microbiol. 2013, 4, 258. [Google Scholar] [CrossRef] [PubMed]
  6. Logan, L.K.; Weinstein, R.A. The Epidemiology of carbapenem-resistant Enterobacteriaceae: The impact and evolution of a global menace. J. Infect. Dis. 2017, 215 (Suppl. 1), S28–S36. [Google Scholar] [CrossRef]
  7. Bartsch, S.M.; McKinnell, J.A.; Mueller, L.E.; Miller, L.G.; Gohil, S.K.; Huang, S.S.; Lee, B.Y. Potential economic burden of carbapenem-resistant Enterobacteriaceae (CRE) in the United States. Clin. Microbiol. Infect. 2017, 23, 48.e9–48.e16. [Google Scholar] [CrossRef] [PubMed]
  8. Lee, S.; Yu, J.K.; Park, K.; Oh, E.J.; Kim, S.Y.; Park, Y.J. Phylogenetic groups and virulence factors in pathogenic and commensal strains of Escherichia coli and their association with blaCTX-M. Ann. Clin. Lab. Sci. 2010, 40, 361–367. [Google Scholar]
  9. Sodagari, H.R.; Varga, C. Evaluating antimicrobial resistance trends in commensal Escherichia coli Isolated from cecal samples of swine at slaughter in the United States, 2013–2019. Microorganisms 2023, 11, 1033. [Google Scholar] [CrossRef]
  10. Bosák, J.; Hrala, M.; Pirková, V.; Micenková, L.; Čížek, A.; Smola, J.; Kučerová, D.; Vacková, Z.; Budinská, E.; Koláčková, I.; et al. Porcine pathogenic Escherichia coli strains differ from human fecal strains in occurrence of bacteriocin types. Vet. Microbiol. 2019, 232, 121–127. [Google Scholar] [CrossRef]
  11. Peirano, V.; Bianco, M.N.; Navarro, A.; Schelotto, F.; Varela, G. Diarrheagenic Escherichia coli associated with acute gastroenteritis in children from Soriano, Uruguay. Can. J. Infect. Dis. Med. Microbiol. 2018, 2018, 8387218. [Google Scholar] [CrossRef]
  12. Torres, A.G. Escherichia coli diseases in Latin America-a “One Health” multidisciplinary approach. Pathog Dis. 2017, 75, ftx012. [Google Scholar] [CrossRef] [PubMed]
  13. Kaper, J.B.; Nataro, J.P.; Mobley, H.L. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2004, 2, 123–140. [Google Scholar] [CrossRef]
  14. Nataro, J.P.; Kaper, J.B. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 1998, 11, 142–201. [Google Scholar] [CrossRef] [PubMed]
  15. Konaté, A.; Dembélé, R.; Guessennd, N.K.; Kouadio, F.K.; Kouadio, I.K.; Ouattara, M.B.; Kaboré, W.A.D.; Kagambèga, A.; Cissé, H.; Ibrahim, H.B.; et al. Epidemiology and antibiotic resistance phenotypes of diarrheagenic Escherichia coli responsible for infantile gastroenteritis in Ouagadougou, Burkina Faso. Eur. J. Microbiol. Immunol. 2017, 7, 168–175. [Google Scholar] [CrossRef] [PubMed]
  16. Tamayo-Legorreta, E.M.; García-Radilla, A.; Moreno-Vázquez, E.; Téllez-Figueroa, F.; Alpuche-Aranda, C.M. Diarrheagenic Escherichia coli pathotypes isolated from a swine farm in a region of Morelos state, Mexico. Salud Publica Mex. 2020, 63, 34–41. [Google Scholar] [CrossRef]
  17. Navarro, A.; Cauich-Sánchez, P.I.; Trejo, A.; Gutiérrez, A.; Díaz, S.P.; Díaz, C.M.; Cravioto, A.; Eslava, C. Characterization of diarrheagenic dtrains of Escherichia coli isolated from cattle raised in three regions of Mexico. Front. Microbiol. 2018, 9, 2373. [Google Scholar] [CrossRef]
  18. Patzi-Vargas, S.; Zaidi, M.B.; Perez-Martinez, I.; León-Cen, M.; Michel-Ayala, A.; Chaussabel, D.; Estrada-Garcia, T. Diarrheagenic Escherichia coli carrying supplementary virulence genes are an important cause of moderate to severe diarrhoeal disease in Mexico. PLoS Negl. Trop Dis. 2015, 9, e0003510. [Google Scholar] [CrossRef]
  19. Canizalez-Roman, A.; Gonzalez-Nuñez, E.; Vidal, J.E.; Flores-Villaseñor, H.; León-Sicairos, N. Prevalence and antibiotic resistance profiles of diarrheagenic Escherichia coli strains isolated from food items in northwestern Mexico. Int. J. Food Microbiol. 2013, 164, 36–45. [Google Scholar] [CrossRef]
  20. Partridge, S.R.; Kwong, S.M.; Firth, N.; Jensen, S.O. Mobile genetic elements associated with antimicrobial resistance. Clin. Microbiol. Rev. 2018, 31, e00088-17. [Google Scholar] [CrossRef]
  21. Berendonk, T.U.; Manaia, C.M.; Merlin, C.; Fatta-Kassinos, D.; Cytryn, E.; Walsh, F.; Bürgmann, H.; Sørum, H.; Norström, M.; Pons, M.N.; et al. Tackling antibiotic resistance: The environmental framework. Nat. Rev. Microbiol. 2015, 13, 310–317. [Google Scholar] [CrossRef] [PubMed]
  22. Medlicott, K.; Wester, A.; Gordon, B.; Montgomery, M.; Tayler, E.; Sutherland, D.; Schmoll, O.; De-Souza, M.; Koo-Oshima, S.; Da-Balogh, K.; et al. Technical Brief on Water, Sanitation, Hygiene and Wastewater Management to Prevent Infections and Reduce the Spread of Antimicrobial Resistance. WHO/FAO/OIE Recommendations Report. 2020. Available online: https://www.who.int/publications/i/item/9789240006416 (accessed on 17 September 2024).
  23. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; CLSI Supplement M100-S26; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2021. [Google Scholar]
  24. Işeri, L.; Zafer Apan, T.; Aksoy, A.; Koç, F.; Sedef Göçmen, J.; Nuristani, D. The prevalence of enterotoxigenic E. coli isolated from the stools of children aged 0-10 years with diarrhea in mid-anatolia region, Turkey. Braz. J. Microbiol. 2011, 42, 243–247. [Google Scholar] [CrossRef]
  25. Uribe-Beltrán, M.J.; Ahumada-Santos, Y.P.; Díaz-Camacho, S.P.; Eslava-Campos, C.A.; Reyes-Valenzuela, J.E.; Báez-Flores, M.E.; Osuna-Ramírez, I.; Delgado-Vargas, F. High prevalence of multidrug-resistant Escherichia coli isolates from children with and without diarrhoea and their susceptibility to the antibacterial activity of extracts/fractions of fruits native to Mexico. J. Med. Microbiol. 2017, 66, 972–980. [Google Scholar] [CrossRef]
  26. Al-Gallas, N.; Bahri, O.; Bouratbeen, A.; Ben Haasen, A.; Ben Aissa, R. Etiology of acute diarrhea in children and adults in Tunis, Tunisia, with emphasis on diarrheagenic Escherichia coli: Prevalence, phenotyping, and molecular epidemiology. Am. J. Trop Med. Hyg. 2007, 77, 571–582. [Google Scholar] [CrossRef]
  27. Souza, T.B.; Lozer, D.M.; Kitagawa, S.M.; Spano, L.C.; Silva, N.P.; Scaletsky, I.C. Real-time multiplex PCR assay and melting curve analysis for identifying diarrheagenic Escherichia coli. J. Clin. Microbiol. 2013, 51, 1031–1033. [Google Scholar] [CrossRef]
  28. CDC PulseNet. Standard Operating Procedure for PulseNet PFGE of Escherichia coli O157: H7, Escherichia coli Non-O157 (STEC), Salmonella serotypes, Shigella sonnei and Shigella flexneri; PNL05; Centers for Disease Control and Prevention: Atlanta, GA, USA, 2017; Volume 157, pp. 1–16.
  29. Durmaz, R.; Otlu, B.; Koksal, F.; Hosoglu, S.; Ozturk, R.; Ersoy, Y.; Aktas, E.; Gursoy, N.C.; Caliskan, A. The optimization of a rapid pulsed-field gel electrophoresis protocol for the typing of Acinetobacter baumannii, Escherichia coli and Klebsiella spp. Jpn. J. Infect. Dis. 2009, 62, 372–377. [Google Scholar] [CrossRef] [PubMed]
  30. Tenover, F.C.; Arbeit, R.D.; Goering, R.V.; Mickelsen, P.A.; Murray, B.E.; Persing, D.H.; Swaminathan, B. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: Criteria for bacterial strain typing. J. Clin. Microbiol. 1995, 33, 2233–2239. [Google Scholar] [CrossRef] [PubMed]
  31. Seabold, S.; Perktold, J. Statsmodels: Econometric and statistical modeling with Python. In Proceedings of the 9th Python in Science Conference, Austin, TX, USA, 28 June–3 July 2010; pp. 92–96. [Google Scholar]
  32. Pungpian, C.; Sinwat, N.; Angkititrakul, S.; Prathan, R.; Chuanchuen, R. Presence and transfer of antimicrobial resistance determinants in Escherichia coli in pigs, pork, and humans in Thailand and Lao PDR Border Provinces. Microb. Drug Resist. 2021, 27, 571–584. [Google Scholar] [CrossRef]
  33. Do, K.H.; Seo, K.; Lee, W.K. Antimicrobial resistance, virulence genes, and phylogenetic characteristics of pathogenic Escherichia coli isolated from patients and swine suffering from diarrhea. BMC Microbiol. 2022, 22, 199. [Google Scholar] [CrossRef]
  34. World Health Organization. WHO List of Critically Important Antimicrobials for Human Medicine (WHO CIA List). 5th Revision. World Health Organization. 2017. Available online: https://apps.who.int/iris/handle/10665/325036 (accessed on 17 September 2024).
  35. Aworh, M.K.; Kwaga, J.K.P.; Hendriksen, R.S.; Okolocha, E.C.; Harrell, E.; Thakur, S. Quinolone-resistant Escherichia coli at the interface between humans, poultry and their shared environment- a potential public health risk. One Health Outlook 2023, 5, 2. [Google Scholar] [CrossRef]
  36. Christodoulou, M.K. Comparison of antimicrobial resistance in Escherichia coli strains isolated from swine, poultry, and farm workers in the respective livestock farming units in Greece. Cureus 2023, 25, e51073. [Google Scholar] [CrossRef]
  37. Castro, A.M.; Santos-Balbuena, H.F.; García-García, A.E.; Arzate-Barbosa, P. Association of diarrheagenic Escherichia coli with virotypes and sensitivity to antimicrobials in children of the Mexico City. Rev. Méd. Hosp. Gen. Mex. 2019, 82, 87–97. [Google Scholar] [CrossRef]
  38. van Den Bogaard, A.E.; London, N.; Stobberingh, E.E. Antimicrobial resistance in pig faecal samples from the Netherlands (five abattoirs) and Sweden. J. Antimicrob. Chemother. 2000, 45, 663–671. [Google Scholar] [CrossRef] [PubMed]
  39. Barton, M.D. Impact of antibiotic use in the swine industry. Curr. Opin. Microbiol. 2014, 19, 9–15. [Google Scholar] [CrossRef]
  40. Mesa-Varona, O.; Boone, I.; Flor, M.; Eckmanns, T.; Kaspar, H.; Grobbel, M.; Tenhagen, B.A. Comparison of consumption data and phenotypical antimicrobial resistance in E. coli isolates of human urinary samples and of weaning and fattening pigs from surveillance and monitoring systems in Germany. Antibiotics 2022, 11, 28. [Google Scholar] [CrossRef] [PubMed]
  41. van Breda, L.K.; Dhungyel, O.P.; Ward, M.P. Antibiotic resistant Escherichia coli in southeastern Australian swine herds and implications for surveillance. Zoonoses Public Health 2018, 65, e1–e7. [Google Scholar] [CrossRef]
  42. Lunha, K.; Leangapichart, T.; Jiwakanon, J.; Angkititrakul, S.; Sunde, M.; Järhult, J.D.; Ström Hallenberg, G.; Hickman, R.A.; Van Boeckel, T.; Magnusson, U. Antimicrobial resistance in fecal Escherichia coli from humans and swines at farms at different levels of intensification. Antibiotics 2020, 9, 662. [Google Scholar] [CrossRef]
  43. Pietsch, M.; Irrgang, A.; Roschanski, N.; Brenner Michael, G.; Hamprecht, A.; Rieber, H.; Käsbohrer, A.; Schwarz, S.; Rösler, U.; Kreienbrock, L.; et al. Whole genome analyses of CMY-2-producing Escherichia coli isolates from humans, animals and food in Germany. BMC Genom. 2018, 19, 601. [Google Scholar] [CrossRef]
  44. Sauget, M.; Atchon, A.K.; Valot, B.; Garch, F.E.; Jong, A.; Moyaert, H.; Hocquet, D.; EASSA and VetPath Study Group. Genome analysis of third-generation cephalosporin-resistant Escherichia coli and Salmonella species recovered from healthy and diseased food-producing animals in Europe. PLoS ONE 2023, 18, e0289829. [Google Scholar] [CrossRef]
  45. Dang, S.T.T.; Bortolaia, V.; Tran, N.T.; Le, H.Q.; Dalsgaard, A. Cephalosporin-resistant Escherichia coli isolated from farm workers and pigs in northern Vietnam. Trop. Med. Int. Health 2018, 23, 415–424. [Google Scholar] [CrossRef]
  46. Sali, V.; Nykäsenoja, S.; Heikinheimo, A.; Hälli, O.; Tirkkonen, T.; Heinonen, M. Antimicrobial use and susceptibility of indicator Escherichia coli in finnish integrated pork production. Front. Microbiol. 2021, 12, 754894. [Google Scholar] [CrossRef]
  47. Dimitrova, L.; Kaleva, M.; Zaharieva, M.M.; Stoykova, C.; Tsvetkova, I.; Angelovska, M.; Ilieva, Y.; Kussovski, V.; Naydenska, S.; Najdenski, H. Prevalence of antibiotic-resistant Escherichia coli isolated from swine faeces and lagoons in Bulgaria. Antibiotics 2021, 10, 940. [Google Scholar] [CrossRef] [PubMed]
  48. Msolo, L.; Iweriebor, B.C.; Okoh, A.I. Antimicrobial resistance profiles of diarrheagenic E. coli (DEC) and Salmonella species recovered from diarrheal patients in selected rural communities of the Amathole District Municipality, Eastern Cape Province, South Africa. Infect. Drug Resist. 2020, 13, 4615–4626. [Google Scholar] [CrossRef]
  49. Yang, G.Y.; Guo, L.; Su, J.H.; Zhu, Y.H.; Jiao, L.G.; Wang, J.F. Frequency of diarrheagenic virulence genes and characteristics in Escherichia coli isolates from pigs with diarrhea in China. Microorganisms 2019, 7, 308. [Google Scholar] [CrossRef]
  50. Park, S.B.; Park, Y.K.; Ha, M.W.; Thompson, K.D.; Jung, T.S. Antimicrobial resistance, pathogenic, and molecular characterization of Escherichia coli from diarrheal patients in South Korea. Pathogens 2022, 11, 385. [Google Scholar] [CrossRef] [PubMed]
  51. Larsson, D.G.J.; Flach, C.F. Antibiotic resistance in the environment. Nat. Rev. Microbiol. 2022, 20, 257–269. [Google Scholar] [CrossRef] [PubMed]
  52. Ding, D.; Wang, B.; Zhang, X.; Zhang, J.; Zhang, H.; Liu, X.; Gao, Z.; Yu, Z. The spread of antibiotic resistance to humans and potential protection strategies. Ecotoxicol. Environ. Saf. 2023, 254, 114734. [Google Scholar] [CrossRef]
  53. European Food Safety Authority (EFSA); European Centre for Disease Prevention and Control (ECDC). The European Union Summary Report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2020/2021. EFSA J. 2023, 21, e07867. [Google Scholar]
  54. European Food Safety Authority (EFSA); European Centre for Disease Prevention and Control (ECDC). The European Union Summary Report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2018/2019. EFSA J. 2021, 19, e06490. [Google Scholar]
  55. Pan, Y.; Hu, B.; Bai, X.; Yang, X.; Cao, L.; Liu, Q.; Sun, H.; Li, J.; Zhang, J.; Jin, D.; et al. Antimicrobial resistance of Non-O157 Shiga toxin-producing Escherichia coli isolated from humans and domestic animals. Antibiotics 2021, 10, 74. [Google Scholar] [CrossRef]
  56. Alali, W.Q.; Scott, H.M.; Harvey, R.B.; Norby, B.; Lawhorn, D.B.; Pillai, S.D. Longitudinal study of antimicrobial resistance among Escherichia coli isolates from integrated multisite cohorts of humans and swine. Appl. Environ. Microbiol. 2008, 74, 3672–3681. [Google Scholar] [CrossRef] [PubMed]
  57. Boerlin, P.; McEwen, S.A.; Boerlin-Petzold, F.; Wilson, J.B.; Johnson, R.P.; Gyles, C.L. Associations between virulence factors of Shiga toxin-producing Escherichia coli and disease in humans. J. Clin. Microbiol. 1999, 37, 497–503. [Google Scholar] [CrossRef] [PubMed]
  58. Abdalla, S.E.; Abia, A.L.K.; Amoako, D.G.; Perrett, K.; Bester, L.A.; Essack, S.Y. Food animals as reservoirs and potential sources of multidrug-resistant diarrheagenic E. coli pathotypes: Focus on intensive pig farming in South Africa. Onderstepoort J. Vet. Res. 2022, 89, e1–e13. [Google Scholar] [CrossRef] [PubMed]
  59. Kylla, H.; Dutta, T.K.; Roychoudhury, P.; Subudhi, P.K. Coinfection of diarrheagenic bacterial and viral pathogens in piglets of Northeast region of India. Vet. World 2019, 12, 224–230. [Google Scholar] [CrossRef] [PubMed]
  60. Collins, J.; Tack, D.; Pindyck, T.; Griffin, P. Escherichia coli, Diarrheagenic. Centre for Disease Control and Prevention. Available online: https://wwwnc.cdc.gov/travel/yellowbook/2024/infections-diseases/escherichia-coli-diarrheagenic (accessed on 20 October 2024).
  61. Pasqua, M.; Michelacci, V.; Di Martino, M.L.; Tozzoli, R.; Grossi, M.; Colonna, B.; Morabito, S.; Prosseda, G. The intriguing evolutionary journey of enteroinvasive E. coli (EIEC) toward pathogenicity. Front. Microbiol. 2017, 8, 2390. [Google Scholar] [CrossRef]
  62. Blanco, M.; Lazo, L.; Blanco, J.E.; Dahbi, G.; Mora, A.; López, C.; González, E.A.; Blanco, J. Serotypes, virulence genes, and PFGE patterns of enteropathogenic Escherichia coli isolated from Cuban pigs with diarrhea. Int. Microbiol. 2006, 9, 53–60. [Google Scholar]
  63. Vu Khac, H.; Holoda, E.; Pilipcinec, E.; Blanco, M.; Blanco, J.E.; Mora, A.; Dahbi, G.; López, C.; González, E.A.; Blanco, J. Serotypes, virulence genes, and PFGE profiles of Escherichia coli isolated from pigs with postweaning diarrhoea in Slovakia. BMC Vet. Res. 2006, 2, 10. [Google Scholar] [CrossRef]
  64. Karama, M.; Cenci-Goga, B.T.; Malahlela, M.; Smith, A.M.; Keddy, K.H.; El-Ashram, S.; Kabiru, L.M.; Kalake, A. Virulence characteristics and antimicrobial resistance profiles of Shiga toxin-producing Escherichia coli isolates from humans in South Africa: 2006–2013. Toxins 2019, 11, 424. [Google Scholar] [CrossRef]
Microorganisms 13 02436 g001
Figure 1. Genetic diversity of E. coli strains isolated from swine and human fecal samples in Jiutepec, Morelos, Mexico, from 2015 to 2016. The pathotype pattern of E. coli from swine was closely associated with EPEC and EHEC pathotypes, but the PFGE pattern of human E. coli was discrete. The dendrogram was elaborated using the Dice coeIicient and the UPGMA (arithmetic mean algorithm). PFGE using XbaI endonuclease. a Health Centres for sample collection in Jiutepec, Morelos, Mexico: 1-CS Jiutepec, 2-CS Huizachera, 3-CS Calera Chica, 4-Hospital General de Cuernavaca ”Dr José G. Parres”, Cuernavaca, Morelos, Mexico.
Figure 1. Genetic diversity of E. coli strains isolated from swine and human fecal samples in Jiutepec, Morelos, Mexico, from 2015 to 2016. The pathotype pattern of E. coli from swine was closely associated with EPEC and EHEC pathotypes, but the PFGE pattern of human E. coli was discrete. The dendrogram was elaborated using the Dice coeIicient and the UPGMA (arithmetic mean algorithm). PFGE using XbaI endonuclease. a Health Centres for sample collection in Jiutepec, Morelos, Mexico: 1-CS Jiutepec, 2-CS Huizachera, 3-CS Calera Chica, 4-Hospital General de Cuernavaca ”Dr José G. Parres”, Cuernavaca, Morelos, Mexico.
Microorganisms 13 02436 g001
Table 1. Primers used in conventional PCR for virulence gene amplification were used to identify six different E. coli pathotypes isolated from swine and humans in Jiutepec, Morelos, Mexico, from 2015 to 2016.
Table 1. Primers used in conventional PCR for virulence gene amplification were used to identify six different E. coli pathotypes isolated from swine and humans in Jiutepec, Morelos, Mexico, from 2015 to 2016.
Pathotype 1Target
Gene		Primer Sequence (5′-3′)Amplicon
Size (bp)		Reference
EPECeaeF: ACTGGACTTCTTATTTCCGTTCTATG
R: CCTAAACGGGTATAATCACCAGA		189[27]
EHECstx-1F: AGTCGTACGGGGATGCAGATAAAT
R: CCGGACACATAGAAGGAAACTCAT		418[27]
stx-2F: GGCACTGTCTGAAACTGCCC
R: TCGCCAGTTATCTGACATTCTG		255[27]
ETECeltF: GGCGACAGATTATACCGTGC
R: CGGTCTCTATATTCCCTGTT		440[27]
estF: ATTTTTMTTTCTGTATTRTCTT
R: CACCCGGTACARGCAGGATT		191[27]
EIECipaHF: GTTCCTTGACCGCCTTTCCGATACCGTC
R: GCCGGTCAGCCACCCTCTGAGAGTAC		619[27]
EAECaatF: AGGTTTGATAATGATGTCCTTGAGGA
R: TCAGCTAATAATGTATAGAAATCCGCTGTT		152[27]
DAECdaaF: ATTACGTCATCCGGGAAGCACACA
R: GCTTGCTCATAAAGCCGCAGACAA		146[27]
1 Abbreviations: EPEC, enteropathogenic E. coli; EHEC, enterohaemorrhagic E. coli; ETEC, enterotoxigenic E. coli; EIEC, enteroinvasive E. coli; EAEC, enteroaggregative E. coli; DAEC, diffusely adhering E. coli.
Table 2. Sample sources of collections and Escherichia coli isolates detected in swine and humans from in Jiutepec, Morelos, Mexico, from 2015 to 2016.
Table 2. Sample sources of collections and Escherichia coli isolates detected in swine and humans from in Jiutepec, Morelos, Mexico, from 2015 to 2016.
Source (Number of Samples)Age Group and/or Healthcare Centers 1Total Number
of Fecal Samples		Total Number of Confirmed E. coli (API 20E)
(%)
Swine Farm
(N = 508)		Suckling piglets160289 (29.4)
Weaning piglets126228 (23.19)
Sows211444 (45.17)
Boar1122 (2.24)
Human
(N = 262)		HC Jiutepec3658 (13.65)
HC Huizachera4783 (19.53)
HC Calera Chica68110 (25.88)
CGH “Dr. José G. Parres”111174 (40.94)
1 Abbreviations: HC = Health Centers; CGH = Cuernavaca General Hospital “Dr. José G. Parres”.
Table 3. Antimicrobials resistance and statistical analysis of diarrheagenic and commensal E. coli strains from swine and human in Jiutepec, Morelos, Mexico, from 2015 to 2016.
Table 3. Antimicrobials resistance and statistical analysis of diarrheagenic and commensal E. coli strains from swine and human in Jiutepec, Morelos, Mexico, from 2015 to 2016.
Percentage of Antimicrobial Resistance and Statistical Comparison of Resistant Isolates (Z-Test for Proportions)
SwineHumanZ-Scorep-Value
Antimicrobial
(Family) 1		Pathogenic
n = 62 (6.31%)		Commensal
n = 921 (93.69%)		Total
N = 983 (100%)		Pathogenic
n = 95 (22.35%)		Commensal
n = 330 (77.65%)		Total
N = 425 (100%)
Ampicillin [B]4.47 (44)50.97 (501)55.44 (545)13.88 (59)44.0 (187)57.88 (246)−0.800.42
Ceftazidime [B]0.00 (0)2.54 (25)2.54 (25)3.77 (16)10.82 (46)14.59 (62)−8.74<0.0001
Cefotaxime [B]0.00 (0)2.44 (24)2.44 (24)2.82 (12)8.71 (37)11.53 (49)−7.19<0.0001
Gentamicin [A]1.42 (14)36.42 (358)37.84 (372)9.88 (42)36.47 (155)46.35 (197)−2.940.0032
Ciprofloxacin [Q]2.95 (29)20.44 (201)23.39 (230)1.65 (7)13.65 (58)15.30 (65)3.390.0007
Nalidixic acid [Q]5.49 (54)73.45 (722)78.94 (776)14.12 (60)51.29 (218)65.41 (278)5.42<0.0001
Cotrimoxazole [S] 23.96 (39)49.95 (491)53.91 (530)12.94 (55)40.94 (174)53.88 (229)0.0580.95
Tetracycline [T]5.19 (51)66.73 (656)71.92 (707)14.59 (62)57.18 (243)71.77 (305)0.0210.98
MDR 34.78 (47)61.44 (604)66.22 (651)14.82 (63)49.88 (212)64.71 (275)0.510.61
1 Abbreviations: A, aminoglycosides; B, β-lactams; Q, quinolones; S, sulfonamides; T, tetracyclines. 2 Cotrimoxazole = Trimethoprim-sulfamethoxazole. 3 MDR = multidrug resistance.
Table 4. Multidrug resistance of E. coli isolates from swine colonization and human diarrhea in Jiutepec, Morelos, Mexico, from 2015 to 2016. The antimicrobial families defined by the Clinical and Laboratory Standards Institute (CLSI) are used.
Table 4. Multidrug resistance of E. coli isolates from swine colonization and human diarrhea in Jiutepec, Morelos, Mexico, from 2015 to 2016. The antimicrobial families defined by the Clinical and Laboratory Standards Institute (CLSI) are used.
Group
(%)		Number of Antibiotic ResistancesNo. of Isolates (%)Most Frequent Pattern of Antimicrobial Resistance (No. of Isolates) 1
Swine
n = 651 (66.22)		3251 (25.54)NAL-SXT-TET (48)
GEN-NAL-TET (43)
4187 (19.02)AMP-NAL-SXT-TET (79)
5129 (13.12)AMP-CIP-NAL-SXT-TET (63)
6 70 (7.12)AMP-GEN-CIP-NAL-SXT-TET (65)
78 (0.81)AMP-CAZ-CTX-CIP-NAL-SXT-TET (4)
86 (0.61)AMP-CAZ-CTX-GEN-CIP-NAL-SXT-TET (6)
Humans
n = 275 (64.71)		395 (22.35)AMP-NAL-TET (19)
GEN-NAL-TET (19)
483 (19.53)AMP-NAL-SXT-TET (31)
543 (10.12)AMP-GEN-NAL-SXT-TET (23)
6 22 (5.18)AMP-GEN-CIP-NAL-SXT-TET (9)
714 (3.29)AMP-CAZ-CTX-CIP-NAL-SXT-TET (6)
818 (4.24)AMP-CAZ-CTX-GEN-CIP-NAL-SXT-TET (18)
1 Abbreviations: AMP, ampicillin; CAZ, ceftazidime; CTX, cefotaxime; GEN, gentamicin; CIP, ciprofloxacin; NAL, nalidixic acid; SXT, cotrimoxazole; TET, tetracycline.
Table 5. Frequency of virulence genes among isolates of multidrug-resistant diarrheagenic E. coli from swine and human diarrhea in Jiutepec, Morelos, Mexico, from 2015 to 2016.
Table 5. Frequency of virulence genes among isolates of multidrug-resistant diarrheagenic E. coli from swine and human diarrhea in Jiutepec, Morelos, Mexico, from 2015 to 2016.
Pathotypes 1Virulence GenesSwine
N = 983		Human
N = 425
Total Diarrheagenic E. coli
n = 62 (6.31%) 2		Total Diarrheagenic E. coli
n = 95 (22.35%) 2
MDR
n = 47
(75.8%) 3		No MDR
n = 15 (24.19%) 3		TotalMDR
n = 63
(66.31%) 3		No MDR
n = 32
(33.68%) 3		Total
EPECeae34 (54.84%)10 (16.13%)44 (70.97%)11 (11.58%)6 (6.32%)17 (17.90%)
EHECsxt14 (6.45%)3 (4.84%)7 (11.29%)2 (2.10%)3 (3.16%)5 (5.26%)
sxt26 (9.68%)0 (0.00%)6 (9.68%)2 (2.10%)0 (0.00%)2 (2.10%)
stx1/stx21 (1.61%)0 (0.00%)1 (1.61%)0 (0.00%)0 (0.00%)0 (0.00%)
ETECelt1 (1.61%)1 (1.61%)2 (3.22%)6 (6.32%)4 (4.21%)10 (10.53%)
est0 (0.00%)0 (0.00%)0 (0.00%)0 (0.00%)1 (1.05%)1 (1.05%)
EIECipaH1 (1.61%)1 (1.61%)2 (3.22%)7 (7.37%)5 (5.26%)12 (12.63%)
EAECaat0 (0.00%)0 (0.00%)0 (0.00%)8 (8.43%)2 (2.10%)10 (10.53%)
DAECdaa0 (0.00%)0 (0.00%)0 (0.00%)27 (28.42%)11 (11.58%)38 (40.00%)
1 Abbreviations: EPEC, enteropathogenic E. coli; EHEC, enterohemorrhagic E. coli; ETEC, enterotoxigenic E. coli; EIEC, enteroinvasive E. coli; EAEC, enteroaggregative E. coli; DAEC, diffusely adhering E. coli. 2 Frequency is calculated by dividing the numbers (n) by the total number of E. coli strains identified in sampling (N = 983, swine; N = 425, human). 3 Frequency is calculated by dividing the numbers (n) by the total number of diarrheagenic E. coli strains identified in sampling (n = 62, swine; n = 95, human).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Tamayo-Legorreta, E.M.; Moreno-Vazquez, E.; Cerón-López, J.; Tellez-Figueroa, F.; Medina-Julián, R.M.; López-Gatell, H.; Alpuche-Aranda, C.M. Association of Diarrheagenic Escherichia coli Virulence Genes and Antimicrobial Resistance Genes in an Interface Model of Swine Colonization and Human Diarrhea in Mexico. Microorganisms 2025, 13, 2436. https://doi.org/10.3390/microorganisms13112436

AMA Style

Tamayo-Legorreta EM, Moreno-Vazquez E, Cerón-López J, Tellez-Figueroa F, Medina-Julián RM, López-Gatell H, Alpuche-Aranda CM. Association of Diarrheagenic Escherichia coli Virulence Genes and Antimicrobial Resistance Genes in an Interface Model of Swine Colonization and Human Diarrhea in Mexico. Microorganisms. 2025; 13(11):2436. https://doi.org/10.3390/microorganisms13112436

Chicago/Turabian Style

Tamayo-Legorreta, Elsa M., Eduardo Moreno-Vazquez, Jackeline Cerón-López, Fabian Tellez-Figueroa, Rosa M. Medina-Julián, Hugo López-Gatell, and Celia M. Alpuche-Aranda. 2025. "Association of Diarrheagenic Escherichia coli Virulence Genes and Antimicrobial Resistance Genes in an Interface Model of Swine Colonization and Human Diarrhea in Mexico" Microorganisms 13, no. 11: 2436. https://doi.org/10.3390/microorganisms13112436

APA Style

Tamayo-Legorreta, E. M., Moreno-Vazquez, E., Cerón-López, J., Tellez-Figueroa, F., Medina-Julián, R. M., López-Gatell, H., & Alpuche-Aranda, C. M. (2025). Association of Diarrheagenic Escherichia coli Virulence Genes and Antimicrobial Resistance Genes in an Interface Model of Swine Colonization and Human Diarrhea in Mexico. Microorganisms, 13(11), 2436. https://doi.org/10.3390/microorganisms13112436

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop