Immunogenicity of Type IV Pilin Proteins from Clostridium perfringens in Chickens
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plasmid Construction, Escherichia coli M15 Transformation and Protein Expression
2.2. Protein Purification
2.3. Immunogenicity of Pilin Proteins in Chicken
2.4. Measurement of Antibody Titers (IgY and IgA)
2.5. SDS-PAGE and Immunoblotting Procedure
2.6. Experimental NE Disease Model
2.7. Quantification of C. perfringens in Ceca
2.8. DNA Extraction and Whole Genome Sequencing
2.9. Bioinformatic Analysis
2.10. Statistical Analysis
3. Results
3.1. Protein Expression and Purification
3.2. Immunization with Pilin Proteins and Serum Antibody Response
3.3. Protection Against C. perfringens in an Experimental Necrotic Enteritis Model
3.4. Comparison and Analysis of C. perfringens Pilin Sequences
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Alizadeh, M.; Shojadoost, B.; Boodhoo, N.; Astill, J.; Taha-Abdelaziz, K.; Hodgins, D.C.; Kulkarni, R.R.; Sharif, S. Necrotic enteritis in chickens: A review of pathogenesis, immune responses and prevention, focusing on probiotics and vaccination. Anim. Health Res. Rev. 2021, 22, 147–162. [Google Scholar] [CrossRef] [PubMed]
- McEwen, S.A.; Collignon, P.J. Antimicrobial Resistance: A One Health Perspective. Microbiol. Spectr. 2018, 6, 521–547. [Google Scholar] [CrossRef]
- Casewell, M.; Friis, C.; Marco, E.; McMullin, P.; Phillips, I. The European ban on growth-promoting antibiotics and emerging consequences for human and animal health. J. Antimicrob. Chemother. 2003, 52, 159–161. [Google Scholar] [CrossRef]
- Kiu, R.; Hall, L.J. An update on the human and animal enteric pathogen Clostridium perfringens. Emerg. Microbes Infect. 2018, 7, 141. [Google Scholar] [CrossRef]
- Keyburn, A.L.; Portela, R.W.; Sproat, K.; Ford, M.E.; Bannam, T.L.; Yan, X.; Rood, J.I.; Moore, R.J. Vaccination with recombinant NetB toxin partially protects broiler chickens from necrotic enteritis. Vet. Res. 2013, 44, 54. [Google Scholar] [CrossRef]
- Rood, J.I.; Adams, V.; Lacey, J.; Lyras, D.; McClane, B.A.; Melville, S.B.; Moore, R.J.; Popoff, M.R.; Sarker, M.R.; Songer, J.G.; et al. Expansion of the Clostridium perfringens toxin-based typing scheme. Anaerobe 2018, 53, 5–10. [Google Scholar] [CrossRef]
- Deslauriers, N.; Maduro, L.; Lepp, D.; Gong, J.; Abdul-Careem, M.F.; Boulianne, M. Determination of the virulence status of Clostridium perfringens strains using a chicken intestinal ligated loop model is important for understanding the pathogenesis of necrotic. Poult. Sci. 2024, 103, 103433. [Google Scholar] [CrossRef]
- Parent, E.; Archambault, M.; Charlebois, A.; Bernier-Lachance, J.; Boulianne, M. A chicken intestinal ligated loop model to study the virulence of Clostridium perfringens isolates recovered from antibiotic-free chicken flocks. Avian Pathol. 2017, 46, 138–149. [Google Scholar] [CrossRef]
- Wade, B.; Keyburn, A.L.; Haring, V.; Ford, M.; Rood, J.I.; Moore, R.J. The adherent abilities of Clostridium perfringens strains are critical for the pathogenesis of avian necrotic enteritis. Vet Microbiol 2016, 197, 53–61. [Google Scholar] [CrossRef]
- Lepp, D.; Zhou, Y.; Ojha, S.; Mehdizadeh Gohari, I.; Carere, J.; Yang, C.; Prescott, J.F.; Gong, J. Clostridium perfringens Produces an Adhesive Pilus Required for the Pathogenesis of Necrotic Enteritis in Poultry. J Bacteriol 2021, 203, e00578-20. [Google Scholar] [CrossRef]
- Melville, S.; Craig, L. Type IV pili in Gram-positive bacteria. Microbiol. Mol. Biol. Rev. 2013, 77, 323–341. [Google Scholar] [CrossRef] [PubMed]
- Singh, P.K.; Little, J.; Donnenberg, M.S. Landmark Discoveries and Recent Advances in Type IV Pilus Research. Microbiol. Mol. Biol. Rev. 2022, 86, e0007622. [Google Scholar] [CrossRef] [PubMed]
- Maldarelli, G.A.; De Masi, L.; von Rosenvinge, E.C.; Carter, M.; Donnenberg, M.S. Identification, immunogenicity, and cross-reactivity of type IV pilin and pilin-like proteins from Clostridium difficile. Pathog. Dis. 2014, 71, 302–314. [Google Scholar] [CrossRef] [PubMed]
- Voss, E.; Manning, P.A.; Attridge, S.R. The toxin-coregulated pilus is a colonization factor and protective antigen of Vibrio cholerae El Tor. Microb. Pathog. 1996, 20, 141–153. [Google Scholar] [CrossRef]
- Sun, D.X.; Mekalanos, J.J.; Taylor, R.K. Antibodies directed against the toxin-coregulated pilus isolated from Vibrio cholerae provide protection in the infant mouse experimental cholera model. J. Infect. Dis. 1990, 161, 1231–1236. [Google Scholar] [CrossRef]
- Stewart, D.J.; Clark, B.L.; Peterson, J.E.; Emery, D.L.; Smith, E.F.; Griffiths, D.A.; O’Donnell, I.J. The protection given by pilus and whole cell vaccines of Bacteroides nodosus strain 198 against ovine foot-rot induced by strains of different serogroups. Aust. Vet. J. 1985, 62, 153–159. [Google Scholar] [CrossRef]
- Lepper, A.W.; Atwell, J.L.; Lehrbach, P.R.; Schwartzkoff, C.L.; Egerton, J.R.; Tennent, J.M. The protective efficacy of cloned Moraxella bovis pili in monovalent and multivalent vaccine formulations against experimentally induced infectious bovine keratoconjunctivitis (IBK). Vet. Microbiol. 1995, 45, 129–138. [Google Scholar] [CrossRef]
- Varga, J.J.; Nguyen, V.; O’Brien, D.K.; Rodgers, K.; Walker, R.A.; Melville, S.B. Type IV pili-dependent gliding motility in the Gram-positive pathogen Clostridium perfringens and other Clostridia. Mol. Microbiol. 2006, 62, 680–694. [Google Scholar] [CrossRef]
- Qiagen. The QIAexpressionist. 2003. Available online: https://www.qiagen.com/us/resources/resourcedetail?id=79ca2f7d-42fe-4d62-8676-4cfa948c9435&lang=en (accessed on 18 December 2024).
- Jiang, Y.; Kulkarni, R.R.; Parreira, V.R.; Prescott, J.F. Immunization of broiler chickens against Clostridium perfringens-induced necrotic enteritis using purified recombinant immunogenic proteins. Avian Dis. 2009, 53, 409–415. [Google Scholar] [CrossRef]
- Heidarpanah, S.; Thibodeau, A.; Parreira, V.R.; Quessy, S.; Segura, M.; Meniai, I.; Gottschalk, M.; Gaudreau, A.; Juette, T.; Gaucher, M.L. Immunization of broiler chickens with five newly identified surface-exposed proteins unique to Clostridium perfringens causing necrotic enteritis. Sci. Rep. 2023, 13, 5254. [Google Scholar] [CrossRef]
- Bélanger, M. Mise au Point d’un Modèle D’infection Expérimentale D’entérite Nécrotique Clinique chez le Poulet de Chair par des Facteurs Prédisposants; Université de Montréal: Montreal, QC, Canada, 2009. [Google Scholar]
- Prescott, J.F.; Smyth, J.A.; Shojadoost, B.; Vince, A. Experimental reproduction of necrotic enteritis in chickens: A review. Avian Pathol. 2016, 45, 317–322. [Google Scholar] [CrossRef] [PubMed]
- Aljumaah, M.R.; Alkhulaifi, M.M.; Aljumaah, R.S.; Abudabos, A.M.; Abdullatif, A.A.; Suliman, G.M.; Al-Ghadi, M.Q.; Stanley, D. Influence of sanguinarine-based phytobiotic supplementation on post necrotic enteritis challenge recovery. Heliyon 2020, 6, e05361. [Google Scholar] [CrossRef] [PubMed]
- Prescott, J.F.; Sivendra, R.; Barnum, D.A. The use of bacitracin in the prevention and treatment of experimentally-induced necrotic enteritis in the chicken. Can. Vet. J. 1978, 19, 181–183. [Google Scholar] [PubMed]
- Johnson, J.; Reid, W.M. Anticoccidial drugs: Lesion scoring techniques in battery and floor-pen experiments with chickens. Exp. Parasitol. 1970, 28, 30–36. [Google Scholar] [CrossRef]
- Albini, S.; Brodard, I.; Jaussi, A.; Wollschlaeger, N.; Frey, J.; Miserez, R.; Abril, C. Real-time multiplex PCR assays for reliable detection of Clostridium perfringens toxin genes in animal isolates. Vet. Microbiol. 2008, 127, 179–185. [Google Scholar] [CrossRef]
- Pospiech, A.; Neumann, B. A versatile quick-prep of genomic DNA from gram-positive bacteria. Trends Genet. 1995, 11, 217–218. [Google Scholar] [CrossRef]
- Buffalo, V. Scythe—A Bayesian Adapter Trimmer. 2011. Available online: http://github.com/vsbuffalo/scythe (accessed on 18 December 2024).
- Joshi, N.A.; Fass, J.N. Sickle: A Sliding-Window, Adaptive, Quality-Based Trimming Tool for FastQ Files. 2011. Available online: https://github.com/najoshi/sickle (accessed on 18 December 2024).
- Andrew, S. FastQC: A Quality Control Tool for High Throughput Sequence Data. 2010. Available online: http://www.bioinformatics.babraham.ac.uk/projects/fastqc (accessed on 18 December 2024).
- Prjibelski, A.; Antipov, D.; Meleshko, D.; Lapidus, A.; Korobeynikov, A. Using SPAdes De Novo Assembler. Curr. Protoc. Bioinform. 2020, 70, e102. [Google Scholar] [CrossRef]
- Seemann, T. Prokka: Rapid prokaryotic genome annotation. Bioinformatics 2014, 30, 2068–2069. [Google Scholar] [CrossRef]
- Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K.; Madden, T.L. BLAST+: Architecture and applications. BMC Bioinform. 2009, 10, 421. [Google Scholar] [CrossRef]
- Edgar, R.C. Quality measures for protein alignment benchmarks. Nucleic Acids Res. 2010, 38, 2145–2153. [Google Scholar] [CrossRef]
- Waterhouse, A.M.; Procter, J.B.; Martin, D.M.; Clamp, M.; Barton, G.J. Jalview Version 2—A multiple sequence alignment editor and analysis workbench. Bioinformatics 2009, 25, 1189–1191. [Google Scholar] [CrossRef] [PubMed]
- Lepp, D.; Ojha, S.; Mehdizadeh Gohari, I.; Chakravarty, B.; Prescott, J.F.; Gong, J. Immunization with subunits of a novel pilus produced by virulent Clostridium perfringens strains confers partial protection against necrotic enteritis in chickens. Vet. Microbiol. 2019, 230, 7–13. [Google Scholar] [CrossRef] [PubMed]
- Yuan, B.; Sun, Z.; Lu, M.; Lillehoj, H.; Lee, Y.; Liu, L.; Yan, X.; Yang, D.A.; Li, C. Immunization with Pooled Antigens for Clostridium perfringens Conferred Partial Protection against Experimental Necrotic Enteritis in Broiler Chickens. Vaccines 2022, 10, 979. [Google Scholar] [CrossRef]
- Boyle, B.; Dallaire, N.; MacKay, J. Evaluation of the impact of single nucleotide polymorphisms and primer mismatches on quantitative PCR. BMC Biotechnol. 2009, 9, 75. [Google Scholar] [CrossRef]
- Foley, J. Mini-review: Strategies for Variation and Evolution of Bacterial Antigens. Comput. Struct. Biotechnol. J. 2015, 13, 407–416. [Google Scholar] [CrossRef]
- Young, P.G.; Moreland, N.J.; Loh, J.M.; Bell, A.; Atatoa Carr, P.; Proft, T.; Baker, E.N. Structural conservation, variability, and immunogenicity of the T6 backbone pilin of serotype M6 Streptococcus pyogenes. Infect. Immun. 2014, 82, 2949–2957. [Google Scholar] [CrossRef]
- Lara, L.J.; Rostagno, M.H. Impact of Heat Stress on Poultry Production. Animals 2013, 3, 356–369. [Google Scholar] [CrossRef]
- Monson, M.S.; Van Goor, A.G.; Ashwell, C.M.; Persia, M.E.; Rothschild, M.F.; Schmidt, C.J.; Lamont, S.J. Immunomodulatory effects of heat stress and lipopolysaccharide on the bursal transcriptome in two distinct chicken lines. BMC Genom. 2018, 19, 643. [Google Scholar] [CrossRef]
- Moore, R.J. Necrotic enteritis predisposing factors in broiler chickens. Avian Pathol. 2016, 45, 275–281. [Google Scholar] [CrossRef]
- Maldarelli, G.A.; Matz, H.; Gao, S.; Chen, K.; Hamza, T.; Yfantis, H.G.; Feng, H.; Donnenberg, M.S. Pilin Vaccination Stimulates Weak Antibody Responses and Provides No Protection in a C57Bl/6 Murine Model of Acute Clostridium difficile Infection. J. Vaccines Vaccin. 2016, 7, 321. [Google Scholar] [CrossRef]
- Vengadesan, K.; Narayana, S.V. Structural biology of Gram-positive bacterial adhesins. Protein Sci. 2011, 20, 759–772. [Google Scholar] [CrossRef] [PubMed]
- Soto, L.F.; Romani, A.C.; Jimenez-Avalos, G.; Silva, Y.; Ordinola-Ramirez, C.M.; Lopez Lapa, R.M.; Requena, D. Immunoinformatic analysis of the whole proteome for vaccine design: An application to Clostridium perfringens. Front. Immunol. 2022, 13, 942907. [Google Scholar] [CrossRef] [PubMed]
Target | Primers Sequences (5′-3′) |
---|---|
pilA1 (BamHi-HinDIII) | F: TGGCTGGGATCCTATGTTAAGGATAGCGCTAA R: TGGATGAAGCTTTTATACTATAGACACCGTAA |
pilA2 (BamHi-HinDIII) | F: TGGATGGGATCCTCAATTCAAAGAAAATCAAG R: TGGCTGAAGCTTCTATTGATTATTTCTTTCAT |
pilA3 (BamHi-PstI) | F: TGGATGGGATCCTCAAATTATGTAACTTTAGA R: TGGATGCTGCAGTTATTTTTTATTTCTAAAAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Charlebois, A.; Deslauriers, N.; Maduro, L.; Boulianne, M. Immunogenicity of Type IV Pilin Proteins from Clostridium perfringens in Chickens. Microorganisms 2025, 13, 120. https://doi.org/10.3390/microorganisms13010120
Charlebois A, Deslauriers N, Maduro L, Boulianne M. Immunogenicity of Type IV Pilin Proteins from Clostridium perfringens in Chickens. Microorganisms. 2025; 13(1):120. https://doi.org/10.3390/microorganisms13010120
Chicago/Turabian StyleCharlebois, Audrey, Nicolas Deslauriers, Lila Maduro, and Martine Boulianne. 2025. "Immunogenicity of Type IV Pilin Proteins from Clostridium perfringens in Chickens" Microorganisms 13, no. 1: 120. https://doi.org/10.3390/microorganisms13010120
APA StyleCharlebois, A., Deslauriers, N., Maduro, L., & Boulianne, M. (2025). Immunogenicity of Type IV Pilin Proteins from Clostridium perfringens in Chickens. Microorganisms, 13(1), 120. https://doi.org/10.3390/microorganisms13010120