Characterization of the Human Plasma Biofilm Model (hpBIOM) to Identify Potential Therapeutic Targets for Wound Management of Chronic Infections
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacteria Strains
2.2. Preparation of the Human Plasma Biofilm Model (hpBIOM)
2.3. Histology and Immunohistochemistry
2.4. RNA and Protein Isolation from hpBIOMs
2.5. RT-qPCR
2.6. Enzyme-Linked Immunosorbent Assay for Quantitative Detection of Human IL-1β
2.7. Statistics
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Costerton, J.W.; Stewart, P.S.; Greenberg, E.P. Bacterial biofilms: A common cause of persistent infections. Science 1999, 284, 1318–1322. [Google Scholar] [CrossRef] [PubMed]
- Donlan, R.M.; Costerton, J.W. Biofilms: Survival mechanisms of clinically relevant microorganisms. Clin. Microbiol. Rev. 2002, 15, 167–193. [Google Scholar] [CrossRef] [PubMed]
- Parsek, M.R.; Singh, P.K. Bacterial biofilms: An emerging link to disease pathogenesis. Annu. Rev. Microbiol. 2003, 57, 677–701. [Google Scholar] [CrossRef] [PubMed]
- Sutherland, I.W. The biofilm matrix—An immobilized but dynamic microbial environment. Trends Microbiol. 2001, 9, 222–227. [Google Scholar] [CrossRef]
- Sutherland, I. Biofilm exopolysaccharides: A strong and sticky framework. Microbiology 2001, 147 Pt 1, 3–9. [Google Scholar] [CrossRef]
- Kania, R.E.; Lamers, G.E.M.; Vonk, M.J.; Huy, P.T.B.; Hiemstra, P.S.; Bloemberg, G.V.; Grote, J.J. Demonstration of bacterial cells and glycocalyx in biofilms on human tonsils. Arch. Otolaryngol. Head Neck Surg. 2007, 133, 115–121. [Google Scholar] [CrossRef]
- Rohde, H.; Frankenberger, S.; Zähringer, U.; Mack, D. Structure, function and contribution of polysaccharide intercellular adhesin (PIA) to Staphylococcus epidermidis biofilm formation and pathogenesis of biomaterial-associated infections. Eur. J. Cell Biol. 2010, 89, 103–111. [Google Scholar] [CrossRef]
- Mack, D.; Davies, A.P.; Harris, L.G.; Knobloch, J.K.; Rohde, H. Staphylococcus epidermidis Biofilms: Functional Molecules, Relation to Virulence, and Vaccine Potential. Top. Curr. Chem. 2009, 288, 157–182. [Google Scholar]
- Potera, C. Forging a link between biofilms and disease. Science 1999, 283, 1837–1839. [Google Scholar] [CrossRef]
- Anderl, J.N.; Zahller, J.; Roe, F.; Stewart, P.S. Role of nutrient limitation and stationary-phase existence in Klebsiella pneumoniae biofilm resistance to ampicillin and ciprofloxacin. Antimicrob. Agents Chemother. 2003, 47, 1251–1256. [Google Scholar] [CrossRef]
- Williams, P.; Winzer, K.; Chan, W.C.; Camara, M. Look who’s talking: Communication and quorum sensing in the bacterial world. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2007, 362, 1119–1134. [Google Scholar] [CrossRef]
- Bassler, B.L.; Losick, R. Bacterially speaking. Cell 2006, 125, 237–246. [Google Scholar] [CrossRef]
- Camilli, A.; Bassler, B.L. Bacterial small-molecule signaling pathways. Science 2006, 311, 1113–1116. [Google Scholar] [CrossRef] [PubMed]
- Schommer, N.N.; Christner, M.; Hentschke, M.; Ruckdeschel, K.; Aepfelbacher, M.; Rohde, H. Staphylococcus epidermidis uses distinct mechanisms of biofilm formation to interfere with phagocytosis and activation of mouse macrophage-like cells 774A.1. Infect. Immun. 2011, 79, 2267–2276. [Google Scholar] [CrossRef] [PubMed]
- Thurlow, L.R.; Hanke, M.L.; Fritz, T.; Angle, A.; Aldrich, A.; Williams, S.H.; Engebretsen, I.L.; Bayles, K.W.; Horswill, A.R.; Kielian, T. Staphylococcus aureus biofilms prevent macrophage phagocytosis and attenuate inflammation in vivo. J. Immunol. 2011, 186, 6585–6596. [Google Scholar] [CrossRef] [PubMed]
- Mittal, R.; Sharma, S.; Chhibber, S.; Harjai, K. Effect of macrophage secretory products on elaboration of virulence factors by planktonic and biofilm cells of Pseudomonas aeruginosa. Comp. Immunol. Microbiol. Infect. Dis. 2006, 29, 12–26. [Google Scholar] [CrossRef] [PubMed]
- McDevitt, D.; Francois, P.; Vaudaux, P.; Foster, T.J. Molecular characterization of the clumping factor (fibrinogen receptor) of Staphylococcus aureus. Mol. Microbiol. 1994, 11, 237–248. [Google Scholar] [CrossRef]
- Resch, A.; Rosenstein, R.; Nerz, C.; Götz, F. Differential gene expression profiling of Staphylococcus aureus cultivated under biofilm and planktonic conditions. Appl. Environ. Microbiol. 2005, 71, 2663–2676. [Google Scholar] [CrossRef]
- Hawiger, J.; Hammond, D.K.; Timmons, S.; Budzynski, A.Z. Interaction of human fibrinogen with staphylococci: Presence of a binding region on normal and abnormal fibrinogen variants and fibrinogen derivatives. Blood 1978, 51, 799–812. [Google Scholar] [CrossRef] [PubMed]
- McDevitt, D.; Nanavaty, T.; House-Pompeo, K.; Bell, E.; Turner, N.; Mcintire, L.; Foster, T.; HööK, M. Characterization of the interaction between the Staphylococcus aureus clumping factor (ClfA) and fibrinogen. Eur. J. Biochem. 1997, 247, 416–424. [Google Scholar] [CrossRef]
- Macintosh, R.L.; Brittan, J.L.; Bhattacharya, R.; Jenkinson, H.F.; Derrick, J.; Upton, M.; Handley, P.S. The terminal A domain of the fibrillar accumulation-associated protein (Aap) of Staphylococcus epidermidis mediates adhesion to human corneocytes. J. Bacteriol. 2009, 191, 7007–7016. [Google Scholar] [CrossRef]
- Rohde, H.; Burdelski, C.; Bartscht, K.; Hussain, M.; Buck, F.; Horstkotte, M.A.; Knobloch, J.K.M.; Heilmann, C.; Herrmann, M.; Mack, D. Induction of Staphylococcus epidermidis biofilm formation via proteolytic processing of the accumulation-associated protein by staphylococcal and host proteases. Mol. Microbiol. 2005, 55, 1883–1895. [Google Scholar] [CrossRef] [PubMed]
- Clarke, S.R.; Harris, L.G.; Richards, R.G.; Foster, S.J. Analysis of Ebh, a 1.1-megadalton cell wall-associated fibronectin-binding protein of Staphylococcus aureus. Infect. Immun. 2002, 70, 6680–6687. [Google Scholar] [CrossRef] [PubMed]
- Williams, R.J.; Henderson, B.; Sharp, L.J.; Nair, S.P. Identification of a fibronectin-binding protein from Staphylococcus epidermidis. Infect. Immun. 2002, 70, 6805–6810. [Google Scholar] [CrossRef] [PubMed]
- Christner, M.; Heinze, C.; Busch, M.; Franke, G.; Hentschke, M.; Bayard Dühring, S.; Büttner, H.; Kotasinska, M.; Wischnewski, V.; Kroll, G.; et al. sarA negatively regulates Staphylococcus epidermidis biofilm formation by modulating expression of 1 MDa extracellular matrix binding protein and autolysis-dependent release of eDNA. Mol. Microbiol. 2012, 86, 394–410. [Google Scholar] [CrossRef] [PubMed]
- Beenken, K.E.; Blevins, J.S.; Smeltzer, M.S. Mutation of sarA in Staphylococcus aureus limits biofilm formation. Infect. Immun. 2003, 71, 4206–4211. [Google Scholar] [CrossRef] [PubMed]
- Snowden, J.N.; Beaver, M.; Beenken, K.; Smeltzer, M.; Horswill, A.R.; Kielian, T. Staphylococcus aureus sarA regulates inflammation and colonization during central nervous system biofilm formation. PLoS ONE 2013, 8, e84089. [Google Scholar] [CrossRef] [PubMed]
- Verdrengh, M.; Tarkowski, A. Role of neutrophils in experimental septicemia and septic arthritis induced by Staphylococcus aureus. Infect. Immun. 1997, 65, 2517–2521. [Google Scholar] [CrossRef]
- Molne, L.; Verdrengh, M.; Tarkowski, A. Role of neutrophil leukocytes in cutaneous infection caused by Staphylococcus aureus. Infect. Immun. 2000, 68, 6162–6167. [Google Scholar] [CrossRef]
- Rigby, K.M.; DeLeo, F.R. Neutrophils in innate host defense against Staphylococcus aureus infections. Semin. Immunopathol. 2012, 34, 237–259. [Google Scholar] [CrossRef]
- Hong, J.S.; Greenlee, K.J.; Pitchumani, R.; Lee, S.H.; Song, L.Z.; Shan, M.; Chang, S.H.; Park, P.W.; Dong, C.; Werb, Z.; et al. Dual protective mechanisms of matrix metalloproteinases 2 and 9 in immune defense against Streptococcus pneumoniae. J. Immunol. 2011, 186, 6427–6436. [Google Scholar] [CrossRef] [PubMed]
- Nauseef, W.M. How human neutrophils kill and degrade microbes: An integrated view. Immunol. Rev. 2007, 219, 88–102. [Google Scholar] [CrossRef] [PubMed]
- Cassatella, M.A. The production of cytokines by polymorphonuclear neutrophils. Immunol. Today 1995, 16, 21–26. [Google Scholar] [CrossRef] [PubMed]
- Hajjar, A.M.; O’mahony, D.S.; Ozinsky, A.; Underhill, D.M.; Aderem, A.; Klebanoff, S.J.; Wilson, C.B. Cutting edge: Functional interactions between toll-like receptor (TLR) 2 and TLR1 or TLR6 in response to phenol-soluble modulin. J. Immunol. 2001, 166, 15–19. [Google Scholar] [CrossRef] [PubMed]
- Spaan, A.N.; Surewaard, B.G.; Nijland, R.; van Strijp, J.A. Neutrophils versus Staphylococcus aureus: A biological tug of war. Annu. Rev. Microbiol. 2013, 67, 629–650. [Google Scholar] [CrossRef] [PubMed]
- Clarke, S.R. Phenol-soluble modulins of Staphylococcus aureus lure neutrophils into battle. Cell Host Microbe 2010, 7, 423–424. [Google Scholar] [CrossRef] [PubMed]
- Parrow, N.L.; Fleming, R.E.; Minnick, M.F. Sequestration and scavenging of iron in infection. Infect. Immun. 2013, 81, 3503–3514. [Google Scholar] [CrossRef] [PubMed]
- Clarke, S.R.; Mohamed, R.; Bian, L.; Routh, A.F.; Kokai-Kun, J.F.; Mond, J.J.; Tarkowski, A.; Foster, S.J. The Staphylococcus aureus surface protein IsdA mediates resistance to innate defenses of human skin. Cell Host Microbe 2007, 1, 199–212. [Google Scholar] [CrossRef]
- Pluym, M.; Muryoi, N.; Heinrichs, D.E.; Stillman, M.J. Heme binding in the NEAT domains of IsdA and IsdC of Staphylococcus aureus. J. Inorg. Biochem. 2008, 102, 480–488. [Google Scholar] [CrossRef]
- Mazmanian, S.K.; Skaar, E.P.; Gaspar, A.H.; Humayun, M.; Gornicki, P.; Jelenska, J.; Joachmiak, A.; Missiakas, D.M.; Schneewind, O. Passage of heme-iron across the envelope of Staphylococcus aureus. Science 2003, 299, 906–909. [Google Scholar] [CrossRef]
- Clarke, S.R.; Wiltshire, M.D.; Foster, S.J. IsdA of Staphylococcus aureus is a broad spectrum, iron-regulated adhesin. Mol. Microbiol. 2004, 51, 1509–1519. [Google Scholar] [CrossRef]
- Besser, M.; Terberger, J.; Weber, L.; Ghebremedhin, B.; Naumova, E.A.; Arnold, W.H.; Stuermer, E.K. Impact of probiotics on pathogen survival in an innovative human plasma biofilm model (hpBIOM). J. Transl. Med. 2019, 17, 243. [Google Scholar] [CrossRef] [PubMed]
- Besser, M.; Dietrich, M.; Weber, L.; Rembe, J.D.; Stuermer, E.K. Efficacy of antiseptics in a novel 3-dimensional human plasma biofilm model (hpBIOM). Sci. Rep. 2020, 10, 4792. [Google Scholar] [CrossRef] [PubMed]
- Dietrich, M.; Besser, M.; Debus, E.S.; Smeets, R.; Stuermer, E.K. Human skin biofilm model: Translational impact on swabbing and debridement. J. Wound Care 2023, 32, 446–455. [Google Scholar] [CrossRef] [PubMed]
- Goerke, C.; Campana, S.; Bayer, M.G.; Döring, G.; Botzenhart, K.; Wolz, C. Direct quantitative transcript analysis of the agr regulon of Staphylococcus aureus during human infection in comparison to the expression profile in vitro. Infect. Immun. 2000, 68, 1304–1311. [Google Scholar] [CrossRef] [PubMed]
- Monk, A.B.; Archer, G.L. Use of outer surface protein repeat regions for improved genotyping of Staphylococcus epidermidis. J. Clin. Microbiol. 2007, 45, 730–735. [Google Scholar] [CrossRef] [PubMed]
- Tristan, A.; Ying, L.; Bes, M.; Etienne, J.; Vandenesch, F.; Lina, G. Use of multiplex PCR to identify Staphylococcus aureus adhesins involved in human hematogenous infections. J. Clin. Microbiol. 2003, 41, 4465–4467. [Google Scholar] [CrossRef]
- Jenkins, A.; Diep, B.A.; Mai, T.T.; Vo, N.H.; Warrener, P.; Suzich, J.; Stover, C.K.; Sellman, B.R. Differential expression and roles of Staphylococcus aureus virulence determinants during colonization and disease. mBio 2015, 6, e02272-14. [Google Scholar] [CrossRef]
- Boles, B.R.; Thoendel, M.; Singh, P.K. Rhamnolipids mediate detachment of Pseudomonas aeruginosa from biofilms. Mol. Microbiol. 2005, 57, 1210–1223. [Google Scholar] [CrossRef]
- Dittmer, M. Quantitative Insights and Visualization of Antimicrobial Tolerance in Mixed-Species Biofilms. Biomedicines 2023, 11, 2640. [Google Scholar] [CrossRef]
- Geoghegan, J.A.; Corrigan, R.M.; Gruszka, D.T.; Speziale, P.; O’Gara, J.P.; Potts, J.R.; Foster, T.J. Role of surface protein SasG in biofilm formation by Staphylococcus aureus. J. Bacteriol. 2010, 192, 5663–5673. [Google Scholar] [CrossRef]
- Formosa-Dague, C.; Speziale, P.; Foster, T.J.; Geoghegan, J.A.; Dufrêne, Y.F. Zinc-dependent mechanical properties of Staphylococcus aureus biofilm-forming surface protein SasG. Proc. Natl. Acad. Sci. USA 2016, 113, 410–415. [Google Scholar] [CrossRef]
- Chien, Y.; Manna, A.C.; Projan, S.J.; Cheung, A.L. SarA, a global regulator of virulence determinants in Staphylococcus aureus, binds to a conserved motif essential for sar-dependent gene regulation. J. Biol. Chem. 1999, 274, 37169–37176. [Google Scholar] [CrossRef]
- Valle, J.; Toledo-Arana, A.; Berasain, C.; Ghigo, J.M.; Amorena, B.; Penadés, J.R.; Lasa, I. SarA and not sigmaB is essential for biofilm development by Staphylococcus aureus. Mol. Microbiol. 2003, 48, 1075–1087. [Google Scholar] [CrossRef]
- Kong, K.F.; Vuong, C.; Otto, M. Staphylococcus quorum sensing in biofilm formation and infection. Int. J. Med. Microbiol. 2006, 296, 133–139. [Google Scholar] [CrossRef]
- Werner, S.; Grose, R. Regulation of wound healing by growth factors and cytokines. Physiol. Rev. 2003, 83, 835–870. [Google Scholar] [CrossRef] [PubMed]
- Stuermer, E.K.; Besser, M.; Brill, F.; Geffken, M.; Plattfaut, I.; Severing, A.; Wiencke, V.; Rembe, J.; Naumova, E.; Kampe, A.; et al. Comparative analysis of biofilm models to determine the efficacy of antimicrobials. Int. J. Hyg. Environ. Health 2021, 234, 113744. [Google Scholar] [CrossRef] [PubMed]
- Serra, R.; Grande, R.; Butrico, L.; Rossi, A.; Settimio, U.F.; Caroleo, B.; Amato, B.; Gallelli, L.; De Franciscis, S. Chronic wound infections: The role of Pseudomonas aeruginosa and Staphylococcus aureus. Expert. Rev. Anti Infect. Ther. 2015, 13, 605–613. [Google Scholar] [CrossRef] [PubMed]
- Glatthardt, T.; Campos, J.C.d.M.; Chamon, R.C.; Coimbra, T.F.d.S.; Rocha, G.d.A.; de Melo, M.A.F.; Parente, T.E.; Lobo, L.A.; Antunes, L.C.M.; dos Santos, K.R.N.; et al. Small Molecules Produced by Commensal Staphylococcus epidermidis Disrupt Formation of Biofilms by Staphylococcus aureus. Appl. Environ. Microbiol. 2020, 86, e02539-19. [Google Scholar] [CrossRef] [PubMed]
- McBain, A.J.; Allison, D.; Gilbert, P. Emerging strategies for the chemical treatment of microbial biofilms. Biotechnol. Genet. Eng. Rev. 2000, 17, 267–279. [Google Scholar] [CrossRef] [PubMed]







| Primer | Gen/Protein | Sequence | Reference |
|---|---|---|---|
| Reference S. aureus | DNA gyrase subunit β | fw. TTATGGTGCTGGGCAAATACA rv. CACCATGTAAACCACCAGATA | [45] |
| Reference S. epidermidis | DNA gyrase subunit β | fw. CTGACAATGGCCGTGGTATTC rv. GAAGATCCAACACCGTGAAGAC | [25] |
| Aap | Accumulation associated protein | fw. TCACTAAACAACCTGTTGACGAA rv. AATTGATTTTTATTATCTGTTGAATGC | [46] |
| EmbP | Extracellular matrix-binding protein | fw. AGCGGTACAAATGTCAATATC rv. AGAAGTGCTCTAGCATCATCC | [24] |
| Clfα | Clumping factor α | fw. ATTGGCGTGGCTTCAGTGCT rv. CGTTTCTTCCGTAGTTGCATTTG | [47] |
| IsdA | Iron-regulated surface determinant A | fw. TGCTTTTTCAAATTCCAAATGCGTAGT rv. GCAGTTGAACCTGGATATAAGAGCTTA | [48] |
| SarA | Transcriptional regulator SarA | fw. GGCTTGTTGACTGACTTGTATATGATGA rv. CAAAGTGCCTCAAACTCAACAAGTA | [48] |
| SasG | Staphylococcus aureus surface protein G | fw. GTCCATGGAACTTGTATAAATGTATCCAGT rv. GCAGAAGAATATTTAACTAATGGTGGAATCCT | [48] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dietrich, M.; Besser, M.; Stuermer, E.K. Characterization of the Human Plasma Biofilm Model (hpBIOM) to Identify Potential Therapeutic Targets for Wound Management of Chronic Infections. Microorganisms 2024, 12, 269. https://doi.org/10.3390/microorganisms12020269
Dietrich M, Besser M, Stuermer EK. Characterization of the Human Plasma Biofilm Model (hpBIOM) to Identify Potential Therapeutic Targets for Wound Management of Chronic Infections. Microorganisms. 2024; 12(2):269. https://doi.org/10.3390/microorganisms12020269
Chicago/Turabian StyleDietrich, Michael, Manuela Besser, and Ewa Klara Stuermer. 2024. "Characterization of the Human Plasma Biofilm Model (hpBIOM) to Identify Potential Therapeutic Targets for Wound Management of Chronic Infections" Microorganisms 12, no. 2: 269. https://doi.org/10.3390/microorganisms12020269
APA StyleDietrich, M., Besser, M., & Stuermer, E. K. (2024). Characterization of the Human Plasma Biofilm Model (hpBIOM) to Identify Potential Therapeutic Targets for Wound Management of Chronic Infections. Microorganisms, 12(2), 269. https://doi.org/10.3390/microorganisms12020269

