Occurrence of Aggregatibacter actinomycetemcomitans and Its JP2 Genotype in a Cohort of 220 Western Australians with Unstable Periodontitis
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Population
2.2. Bacterial DNA Extraction
2.3. Bacterial DNA Quantification
2.4. Conventional PCR
2.5. Statistical Analysis
2.6. Ethical Considerations
3. Results
3.1. Presence of A. actinomycetemcomitans and Its JP2 Genotype
3.2. Clinical Outcomes
3.3. Relationship Between Periodontitis and Potential Risk Factors
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Sedghi, L.; DiMassa, V.; Harrington, A.; Lynch, S.V.; Kapila, Y.L. The oral microbiome: Role of key organisms and complex networks in oral health and disease. Periodontol. 2000 2021, 87, 107–131. [Google Scholar] [CrossRef] [PubMed]
- Deng, Z.L.; Szafranski, S.P.; Jarek, M.; Bhuju, S.; Wagner-Dobler, I. Dysbiosis in chronic periodontitis: Key microbial players and interactions with the human host. Sci. Rep. 2017, 7, 3703. [Google Scholar] [CrossRef] [PubMed]
- Curtis, M.A.; Diaz, P.I.; Van Dyke, T.E. The role of the microbiota in periodontal disease. Periodontol. 2000 2020, 83, 14–25. [Google Scholar] [CrossRef] [PubMed]
- Hajishengallis, G.; Lamont, R.J. Beyond the red complex and into more complexity: The polymicrobial synergy and dysbiosis (PSD) model of periodontal disease etiology. Mol. Oral Microbiol. 2012, 27, 409–419. [Google Scholar] [CrossRef]
- Henderson, B.; Ward, J.M.; Ready, D. Aggregatibacter (Actinobacillus) actinomycetemcomitans: A triple A* periodontopathogen? Periodontol. 2000 2010, 54, 78–105. [Google Scholar] [CrossRef]
- Zambon, J.J. Actinobacillus actinomycetemcomitans in human periodontal disease. J. Clin. Periodontol. 1985, 12, 1–20. [Google Scholar] [CrossRef]
- Newman, M.G.; Socransky, S.S.; Savitt, E.D.; Propas, D.A.; Crawford, A. Studies of the microbiology of periodontosis. J. Periodontol. 1976, 47, 373–379. [Google Scholar] [CrossRef]
- Slots, J. The predominant cultivable organisms in juvenile periodontitis. Scand. J. Dent. Res. 1986, 84, 1–10. [Google Scholar] [CrossRef]
- Tsai, C.C.; McArthur, W.P.; Baehni, P.C.; Hammond, B.F.; Taichman, N.S. Extraction and partial characterization of a leukotoxin from a plaque-derived Gram-negative microorganism. Infect. Immun. 1979, 25, 427–439. [Google Scholar] [CrossRef]
- Huang, Y.; Kittichotirat, W.; Mayer, M.P.; Hall, R.; Bumgarner, R.; Chen, C. Comparative genomic hybridization and transcriptome analysis with a pan-genome microarray reveal distinctions between JP2 and non-JP2 genotypes of Aggregatibacter actinomycetemcomitans. Mol. Oral Microbiol. 2013, 28, 1–17. [Google Scholar] [CrossRef]
- Kaplan, J.B.; Schreiner, H.C.; Furgang, D.; Fine, D.H. Population Structure and Genetic Diversity of Actinobacillus actinomycetemcomitans Strains Isolated from Localized Juvenile Periodontitis Patients. J. Clin. Microbiol. 2002, 40, 1181–1187. [Google Scholar] [CrossRef] [PubMed]
- Kilian, M.; Frandsen, E.V.; Haubek, D.; Poulsen, K. The etiology of periodontal disease revisited by population genetic analysis. Periodontol. 2000 2006, 42, 158–179. [Google Scholar] [CrossRef] [PubMed]
- Zambon, J.J.; Slots, J.; Genco, R.J. Serology of oral Actinobacillus actinomycetemcomitans and serotype distribution in human periodontal disease. Infect. Immun. 1983, 41, 19–27. [Google Scholar] [CrossRef] [PubMed]
- Brogan, J.M.; Lally, E.T.; Poulsen, K.; Kilian, M.; Demuth, D.R. Regulation of Actinobacillus actinomycetemcomitans leukotoxin expression: Analysis of the promoter regions of leukotoxic and minimally leukotoxic strains. Infect. Immun. 1994, 62, 501–508. [Google Scholar] [CrossRef]
- Haubek, D.; Ennibi, O.K.; Poulsen, K.; Poulsen, S.; Benzarti, N.; Kilian, M. Early-onset periodontitis in Morocco is associated with the highly leukotoxic clone of Actinobacillus actinomycetemcomitans. J. Dent. Res. 2001, 80, 1580–1583. [Google Scholar] [CrossRef]
- Khzam, N.; Kujan, O.; Haubek, D.; Arslan, A.; Johansson, A.; Oscarsson, J.; Razooqi, Z.; Miranda, L.A. Prevalence of Subgingival Aggregatibacter actinomycetemcomitans: Descriptive Cross-Sectional Study. Pathogens 2024, 13, 531. [Google Scholar] [CrossRef]
- Tonetti, M.S.; Greenwell, H.; Kornman, K.S. Staging and grading of periodontitis: Framework and proposal of a new classification and case definition. J. Periodontol. 2018, 89 (Suppl. S1), S159–S172. [Google Scholar] [CrossRef]
- Razooqi, Z.; Höglund Åberg, C.; Kwamin, F.; Claesson, R.; Haubek, D.; Oscarsson, J.; Johansson, A. Aggregatibacter actinomycetemcomitans and Filifactor alocis as Associated with Periodontal Attachment Loss in a Cohort of Ghanaian Adolescents. Microorganisms 2022, 10, 2511. [Google Scholar] [CrossRef]
- Kirakodu, S.S.; Govindaswami, M.; Novak, M.J.; Ebersole, J.L.; Novak, K.F. Optimizing qPCR for the Quantification of Periodontal Pathogens in a Complex Plaque Biofilm. Open Dent. J. 2008, 2, 49–55. [Google Scholar] [CrossRef]
- Poulsen, K.; Ennibi, O.K.; Haubek, D. Improved PCR for detection of the highly leukotoxic JP2 clone of Actinobacillus actinomycetemcomitans in subgingival plaque samples. J. Clin. Microbiol. 2003, 41, 4829–4832. [Google Scholar] [CrossRef]
- Nørskov-Lauritsen, N.; Claesson, R.; Jensen, A.B.; Åberg, C.H.; Haubek, D. Aggregatibacter actinomycetemcomitans: Clinical significance of a pathobiont subjected to ample changes in classification and nomenclature. Pathogzens 2019, 8, 243. [Google Scholar] [CrossRef] [PubMed]
- Haubek, D.; Ennibi, O.K.; Poulsen, K.; Vaeth, M.; Poulsen, S.; Kilian, M. Risk of aggressive periodontitis in adolescent carriers of the JP2 clone of Aggregatibacter (Actinobacillus) actinomycetemcomitans in Morocco: A prospective longitudinal cohort study. Lancet 2008, 371, 237–242. [Google Scholar] [CrossRef] [PubMed]
- Jensen, A.B.; Isidor, F.; Lund, M.; Væth, M.; Johansson, A.; Lauritsen, N.N.; Haubek, D. Prevalence of Aggregatibacter actinomycetemcomitans and Periodontal Findings among 14 to 15-Year Old Danish Adolescents: A Descriptive Cross-Sectional Study. Pathogens 2020, 9, 1054. [Google Scholar] [CrossRef] [PubMed]
- Suprith, S.; Setty, S.; Bhat, K.; Thakur, S. Serotypes of Aggregatibacter actinomycetemcomitans in relation to periodontal status and assessment of leukotoxin in periodontal disease: A clinico-microbiological study. J. Indian Soc. Periodontol. 2018, 22, 201–208. [Google Scholar] [CrossRef]
- Müller, H.P.; Heinecke, A.; Fuhrmann, A.; Eger, T.; Zöller, L. Intraoral distribution of Actinobacillus actinomycetemcomitans in young adults with minimal periodontal disease. J. Periodontal. Res. 2001, 36, 114–123. [Google Scholar] [CrossRef]
- Orrù, G.; Marini, M.F.; Ciusa, M.L.; Isola, D.; Cotti, M.; Baldoni, M.; Piras, V.; Pisano, E.; Montaldo, C. Usefulness of real time PCR for the differentiation and quantification of 652 and JP2 Actinobacillus actinomycetemcomitans genotypes in dental plaque and saliva. BMC Infect. Dis. 2006, 6, 98. [Google Scholar] [CrossRef]
- Claesson, R.; Höglund-Åberg, C.; Haubek, D.; Johansson, A. Age-related prevalence and characteristics of Aggregatibacter actinomycetemcomitans in periodontitis patients living in Sweden. J. Oral Microbiol. 2017, 9, 1334504. [Google Scholar] [CrossRef]
- Sakellari, D.; Katsikari, A.; Slini, T.; Ioannidis, I.; Konstantinidis, A.; Arsenakis, M. Prevalence and distribution of Aggregatibacter actinomycetemcomitans serotypes and the JP2 clone in a Greek population. J. Clin. Periodontol. 2011, 38, 108–114. [Google Scholar] [CrossRef]
- Kim, T.S.; Frank, P.; Eickholz, P.; Eick, S.; Kim, C.K. Serotypes of Aggregatibacter actinomycetemcomitans in patients with different ethnic backgrounds. J. Periodontol. 2009, 80, 2020–2027. [Google Scholar] [CrossRef]
- Mombelli, A.; Gmür, R.; Lang, N.P.; Corbet, E.; Frey, J. Actinobacillus actinomycetemcomitans in Chinese adults: Serotype distribution and analysis of the leukotoxin gene promoter locus. J. Clin. Periodontol. 1999, 26, 505–510. [Google Scholar] [CrossRef]
- Tan, K.S.; Woo, C.H.; Ong, G.; Song, K.P. Prevalence of Actinobacillus actinomycetemcomitans in an ethnic adult Chinese population. J. Clin. Periodontol. 2001, 28, 886–890. [Google Scholar] [CrossRef] [PubMed]
- Haubek, D.; Dirienzo, J.M.; Tinoco EM, B.; Westergaard, J.; López, N.J.; Chung, C.-P.; Poulsen, K.; Kilian, M. Racial tropism of a highly toxic clone of Actinobacillus actinomycetemcomitans associated with juvenile periodontitis. J. Clin. Microbiol. 1997, 35, 3037–3042. [Google Scholar] [CrossRef] [PubMed]
- Bandhaya, P.; Saraithong, P.; Likittanasombat, K.; Hengprasith, B.; Torrungruang, K. Aggregatibacter actinomycetemcomitans serotypes, the JP2 clone and cytolethal distending toxin genes in a Thai population. J. Clin. Periodontol. 2012, 39, 519–525. [Google Scholar] [CrossRef] [PubMed]
- Khzam, N.; Miranda, L.A.; Kujan, O.; Shearston, K.; Haubek, D. Prevalence of the JP2 genotype of Aggregatibacter actinomycetemcomitans in the world population: A systematic review. Clin. Oral Investig. 2022, 26, 2317–2334. [Google Scholar] [CrossRef]
- Pinheiro, E.T.; Kawamoto, D.; Ota-Tsuzuki, C.; Almeida, L.R.; Nunes, A.C.; Longo, P.L.; Wikstrom, M.; Mayer, M.P. Analysis of genotypic variation in genes associated with virulence in Aggregatibacter actinomycetemcomitans clinical isolates. J. Periodontal. Res. 2011, 46, 310–317. [Google Scholar] [CrossRef]
- Mehta, J.; Eaton, C.; AlAmri, M.; Lin, G.H.; Nibali, L. The association between Aggregatibacter actinomycetemcomitans JP2 clone and periodontitis: A systematic review and meta-analysis. J. Periodontal. Res. 2023, 58, 465–482. [Google Scholar] [CrossRef]
- Jiao, J.; Jing, W.; Si, Y.; Feng, X.; Tai, B.; Hu, D.; Lin, H.; Wang, B.; Wang, C.; Zheng, S.; et al. The prevalence and severity of periodontal disease in Mainland China: Data from the Fourth National Oral Health Survey (2015–2016). J. Clin. Periodontol. 2021, 48, 168–179. [Google Scholar] [CrossRef]
- Eke, P.I.; Thornton-Evans, G.O.; Wei, L.; Borgnakke, W.S.; Dye, B.A.; Genco, R.J. Periodontitis in US Adults: National Health and Nutrition Examination Survey 2009–2014. J. Am. Dent. Assoc. 2018, 149, 576–588.e576. [Google Scholar] [CrossRef]
- Stødle, I.H.; Verket, A.; Høvik, H.; Sen, A.; Koldsland, O.C. Prevalence of periodontitis based on the 2017 classification in a Norwegian population: The HUNT study. J. Clin. Periodontol. 2021, 48, 1189–1199. [Google Scholar] [CrossRef]
- Ju, X.; Harford, J.; Luzzi, L.; Jamieson, L.M. Prevalence, extent, and severity of periodontitis among Australian older adults: Comparison of two generations. J. Periodontol. 2022, 93, 1387–1400. [Google Scholar] [CrossRef]
- Relvas, M.; López-Jarana, P.; Monteiro, L.; Pacheco, J.J.; Braga, A.C.; Salazar, F. Study of Prevalence, Severity and Risk Factors of Periodontal Disease in a Portuguese Population. J. Clin. Med. 2022, 11, 3728. [Google Scholar] [CrossRef] [PubMed]
- Sekino, S.; Takahashi, R.; Numabe, Y.; Okamoto, H. Current status of periodontal disease in adults in Takahagi, Japan: A cross-sectional study. BMC Oral Health 2020, 20, 60. [Google Scholar] [CrossRef] [PubMed]
- Holtfreter, B.; Schwahn, C.; Biffar, R.; Kocher, T. Epidemiology of periodontal diseases in the Study of Health in Pomerania. J. Clin. Periodontol. 2009, 36, 114–123. [Google Scholar] [CrossRef] [PubMed]
- Montero, E.; Herrera, D.; Sanz, M.; Dhir, S.; Van Dyke, T.; Sima, C. Development and validation of a predictive model for periodontitis using NHANES 2011–2012 data. J. Clin. Periodontol. 2019, 46, 420–429. [Google Scholar] [CrossRef] [PubMed]
- Botelho, J.; Machado, V.; Proença, L.; Alves, R.; Cavacas, M.A.; Amaro, L.; Mendes, J.J. Study of Periodontal Health in Almada-Seixal (SoPHiAS): A cross-sectional study in the Lisbon Metropolitan Area. Sci. Rep. 2019, 9, 15538. [Google Scholar] [CrossRef]
- Martu, M.A.; Luchian, I.; Mares, M.; Solomon, S.; Ciurcanu, O.; Danila, V.; Rezus, E.; Foia, L. The Effectiveness of Laser Applications and Photodynamic Therapy on Relevant Periodontal Pathogens (Aggregatibacter actinomycetemcomitans) Associated with Immunomodulating Anti-rheumatic Drugs. Bioengineering 2023, 10, 61. [Google Scholar] [CrossRef]
| Forward | Reverse | |
|---|---|---|
| Kirakodu (ltxA) | CTAGGTATTGCGAAACAATTTG | CCTGAAATTAAGCTGGTAATC |
| Forward | Reverse | |
|---|---|---|
| Poulsen ltx-promoter | GCCGACACCAAAGACAAAGTCT | GCCCATAACCAAGCCACATAC |
| Patient/Variables | Sex | Age in Years | Origin | Stage/Grade | Aa Saliva ng/μL | Aa Cheek Swabs ng/μL | Aa Plaque ng/μL |
|---|---|---|---|---|---|---|---|
| Pt 1 | F | 70 | Philippines | III/B | 72,055 | - | 848,041 |
| Pt 2 | F | 32 | Philippines | III/C | - | 119 | - |
| Pt 3 | M | 30 | Australia | III/B | - | 1956.5 | - |
| Pt 4 | M | 40 | Australia | IV/B | - | 511 | - |
| Pt 5 | F | 63 | Australia | III/B | - | 219 | - |
| Pt 6 | M | 48 | Australia | IV/C | 19,950.5 | 2679 | 22,379 |
| Pt 7 | F | 56 | England | III/B | 1075 | 161 | - |
| Pt 8 | F | 48 | Australia | III/B | 606.50 | - | 10,401 |
| Pt 9 | F | 40 | New Zealand (Māori) | IV/C | 1470 | 638.5 | 1719 |
| Pt 10 | M | 49 | New Zealand (Māori) | III/B | 8530 | - | 1680 |
| Pt 11 | M | 56 | Thailand | III/B | 14,290 | 165.5 | 1448 |
| Pt 12 | M | 54 | New Zealand (Māori) | III/B | 2500 | - | 303 |
| Pt 13 | M | 35 | Australia | III/B | 3810 | - | - |
| Pt 14 | M | 68 | Australia | IV/C | 9820 | 570.5 | 365,681 |
| Pt 15 | F | 51 | Australia | II/B | 5124 | - | - |
| Pt 16 | M | 34 | Tonga | IV/C | 8685 | 2299.5 | 851 |
| Pt 17 | M | 57 | Canada | III/B | 6865 | - | - |
| Pt 18 | F | 56 | England | III/B | - | - | 153 |
| Pt 19 | F | 65 | New Zealand (Māori) | IV/C | 13,910 | 247.5 | 10,651 |
| Pt 20 | M | 57 | Australia (Aboriginal) | III/B | 4115 | - | - |
| Pt 21 | M | 39 | England | III/B | 2415 | - | 577 |
| Pt 22 | F | 40 | Australia | III/B | 26,620 | 1219.5 | 153 |
| Pt 23 | M | 57 | Australia | III/B | 2065 | - | - |
| Pt 24 | M | 33 | Australia | III/C | 1710 | - | - |
| Pt 25 | M | 64 | Australia | III/B | 1050 | - | - |
| P 26 | F | 71 | Ireland | IV/C | 1325 | - | - |
| Pt 27 | F | 62 | Kenya | III/B | 76,820 | 2716 | 381,842 |
| Pt 28 | F | 36 | Australia | III/B | 2195 | 559 | 4624 |
| Pt 29 | M | 40 | Australia | III/B | - | - | 340 |
| Pt 30 | M | 57 | Samoa | III/B | 1255 | 204 | 56,334 |
| Pt 31 | F | 47 | Palestine | III/B | 411,735 | 604.5 | 46,227 |
| Pt 32 | M | 40 | Australia | III/B | 54,790 | 153 | 184,822 |
| Pt 33 | M | 75 | Italy | III/B | - | - | 132 |
| Pt 34 | M | 56 | South Africa | III/B | 1510 | - | 479,910 |
| Pt 35 | M | 52 | Sri Lanka | III/B | 3360 | 22,932 | 5163 |
| Pt 36 | F | 40 | Philippines | IV/C | - | 105 | - |
| Pt 37 | F | 52 | England | III/B | 120,725 | 23,264.5 | - |
| Pt 38 | F | 60 | South Africa | IV/C | 33,910 | 25,995 | 254,437 |
| Pt 39 | M | 76 | Ireland | III/B | - | 105 | - |
| Pt 40 | F | 69 | England | III/B | - | 133.50 | - |
| Pt 41 | M | 62 | England | III/B | - | 945.5 | - |
| Pt 42 | F | 40 | Ireland | III/B | 4965 | 43,559 | 81,934 |
| Pt 43 | F | 32 | Australia | III/B | 54,440 | 139.50 | - |
| Pt 44 | M | 49 | England | III/B | 13,495 | - | - |
| Pt 45 | F | 49 | Greece | IV/C | 46,010 | 503.5 | - |
| Pt 46 | M | 68 | Australia | III/B | - | 353 | 3598 |
| Pt 47 | M | 37 | England | IV/C | - | 106.5 | - |
| Pt 48 | M | 33 | Australia | III/B | 4095 | 30,455.5 | 101,611 |
| Pt 49 | M | 63 | Australia | III/B | - | 114.5 | - |
| Pt 50 | M | 66 | Australia | III/B | 1525 | - | 138.50 |
| Pt 51 | M | 40 | China | IV/C | 564 | 237 | 262 |
| Pt 52 | F | 38 | Australia | II/B | 8845 | 3782 | 3978 |
| Pt 53 | M | 38 | New Zealand (Māori) | III/B | 12,377 | 5135 | 5432 |
| Pt 54 | M | 33 | Vietnam | IV/C | 5567 | 4822 | 19,792 |
| Pt 55 | F | 36 | Libya | III/B | 4133 | 1103 | 1281 |
| Pt 56 | M | 40 | Australia | III/B | 1298 | 856 | 1234 |
| Pt 57 | F | 39 | Poland | III/B | 1593 | 1104 | 3789 |
| Pt 58 | F | 39 | Australia | III/B | 2267 | 1409 | 1817 |
| Pt 59 | F | 32 | New Zealand (Māori) | IV/C | 1621 | 1381 | 627 |
| Pt 60 | F | 36 | Italy | IV/C | 656 | 263 | 449 |
| Pt 61 | M | 38 | New Zealand | III/B | 3250 | 3063 | 5343 |
| Pt 62 | F | 32 | Italy | III/B | 996 | 429 | 419 |
| Variables | BoP (%) | PI (%) | Pus (%) | BL/Age > 1 (%) | BL > 33 (%) | V-BL (%) | PA Lesion | Endo-Perio Lesion | |
|---|---|---|---|---|---|---|---|---|---|
| Sex | M | 48.70 | 53.50 | 3.30 | 45.50 | 46.60 | 32.30 | 28.80 | 22.10 |
| F | 39.80 | 43.0 | 4.0 | 53.0 | 54.80 | 47.80 | 25.90 | 22.0 | |
| Age | ≤40 Yrs | 39.20 | 43.90 | 2.90 | 47.10 | 46.20 | 47.80 | 23.50 | 20.50 |
| >40 Yrs | 48.10 | 51.20 | 4.40 | 52.0 | 55.80 | 34.50 | 30.60 | 23.40 | |
| Aa | Present | 47.40 | 52.10 | 6.30 | 46.60 | 46.70 | 35.10 | 30.80 | 19.90 |
| Absence | 42.40 | 46.0 | 2.60 | 50.90 | 52.90 | 43.20 | 25.70 | 22.90 | |
| Variables | Periodontitis Staging and Grading | X2 | p-Value | ||
|---|---|---|---|---|---|
| Stage IV, Grade C N (%) | Other Stages, Grades N (%) | ||||
| Age group | Younger age group | 33 (60.0) | 67 (40.60) | 6.258 | 0.012 |
| Older age group | 22 (40.0) | 98 (59.40) | |||
| Family history of periodontitis | Yes | 48 (87.30) | 76 (46.10) | 30.233 | <0.001 |
| No | 4 (7.30) | 78 (47.30) | |||
| Dental visits attendance | Regular | 24 (43.60) | 126 (76.40) | 20.366 | <0.001 |
| Irregular | 31 (56.40) | 39 (23.60) | |||
| Oral hygiene method | Toothbrushing and flossing | 20 (36.40) | 107 (64.80) | 13.715 | <0.001 |
| Toothbrushing only | 35 (63.60) | 58 (35.20) | |||
| Reason of tooth loss | Periodontal | 38 (69.10) | 51 (30.90) | 25.147 | <0.001 |
| Non-periodontal | 17 (30.90) | 112 (67.90) | |||
| Variables | 95% CI for OR | |||||||
|---|---|---|---|---|---|---|---|---|
| B | S.E. | Wald | df | p | OR | LL | UL | |
| Age groups | 1.034 | 0.456 | 5.148 | 1 | 0.023 | 2.812 | 1.151 | 6.867 |
| Family history of periodontitis | 1.161 | 0.387 | 9.001 | 1 | 0.003 | 3.194 | 1.496 | 6.821 |
| Reason of tooth loss | 1.624 | 0.415 | 15.275 | 1 | <0.001 | 5.071 | 2.247 | 11.447 |
| Constant | −5.576 | 3.124 | 3.185 | 1 | 0.074 | 0.004 | ||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khzam, N.; Kujan, O.; Haubek, D.; Miranda, L.A. Occurrence of Aggregatibacter actinomycetemcomitans and Its JP2 Genotype in a Cohort of 220 Western Australians with Unstable Periodontitis. Microorganisms 2024, 12, 2354. https://doi.org/10.3390/microorganisms12112354
Khzam N, Kujan O, Haubek D, Miranda LA. Occurrence of Aggregatibacter actinomycetemcomitans and Its JP2 Genotype in a Cohort of 220 Western Australians with Unstable Periodontitis. Microorganisms. 2024; 12(11):2354. https://doi.org/10.3390/microorganisms12112354
Chicago/Turabian StyleKhzam, Nabil, Omar Kujan, Dorte Haubek, and Leticia Algarves Miranda. 2024. "Occurrence of Aggregatibacter actinomycetemcomitans and Its JP2 Genotype in a Cohort of 220 Western Australians with Unstable Periodontitis" Microorganisms 12, no. 11: 2354. https://doi.org/10.3390/microorganisms12112354
APA StyleKhzam, N., Kujan, O., Haubek, D., & Miranda, L. A. (2024). Occurrence of Aggregatibacter actinomycetemcomitans and Its JP2 Genotype in a Cohort of 220 Western Australians with Unstable Periodontitis. Microorganisms, 12(11), 2354. https://doi.org/10.3390/microorganisms12112354

