Agricultural Soil as a Reservoir of Pseudomonas aeruginosa with Potential Risk to Public Health
Abstract
:1. Introduction
2. Materials and Methods
2.1. Samples Collection
2.2. Isolation and Identification of Pseudomonas aeruginosa
- (a)
- PCR identification: DNA was extracted from bacterial culture using the cell lysis method [29]. One-day-old colonies were picked, suspended in 500 µL MiliQ water and lysed by incubation at 95 °C for 15 min. Afterwards they were centrifugated at 13,000 for 3 min. The supernatant was used to perform the PCR. DNA was stored at −20 °C until use.
- (b)
- MALDI-TOF identification: Isolated colonies were identified using the Vitek MS Plus mass spectrometer (bioMerieux, Marcy l’Etoile, France) with the mass spectrum ranged from 2000 to 20,000 Da. A fresh colony isolated on trypticase soy agar (TSA) plates (Becton Dickson & Co., Cuautitlán Izcalli, Mexico) and incubated 24 h at 37 °C was directly spotted on the MALDI plate with the help of a sterile toothpick and placed onto a steel micro scout plate following the manufacturer’s instructions. After the plate was placed in the instrument and the system was operated using the method for the identification of bacteria. For each bacterial sample, mass fingerprints were processed by Compute Engine and the advanced spectrum classifier (ASC) algorithm of the Vitek MS system which automatically identifies a species by comparing the obtained spectrum (presence or absence of specific peaks) with the spectra typical of each claimed species (Vitek MS IVD version 3.0.0). A confidence interval of 98–99% was considered acceptable for species level identification (ID).
2.3. Detection of Virulence Factors
2.4. Antimicrobial Susceptibility Testing
2.5. Detection Class 1 Integrons
2.6. Detection of Heavy Metal Resistance Genes
3. Results
3.1. Samples Collection
3.2. Isolation and Identification of Pseudomonas aeruginosa
3.3. Detection of Virulence Factors
3.4. Antimicrobial Susceptibility Testing
3.5. Detection Class 1 Integrons
3.6. Detection of Heavy Metal Resistance Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Jurado-Martín, I.; Sainz-Mejías, M.; McClean, S. Pseudomonas aeruginosa: An Audacious Pathogen with an Adaptable Arsenal of Virulence Factors. Int. J. Mol. Sci. 2021, 22, 3128. [Google Scholar] [CrossRef] [PubMed]
- Martínez-Solano, L.; Macia, M.D.; Fajardo, A.; Oliver, A.; Martinez, J.L. Chronic Pseudomonas aeruginosa Infection in Chronic Obstructive Pulmonary Disease. Clin. Infect. Dis. 2008, 47, 1526–1533. [Google Scholar] [CrossRef]
- Botelho, J.; Grosso, F.; Peixe, L. Antibiotic Resistance in Pseudomonas aeruginosa—Mechanisms, Epidemiology and Evolution. Drug Resist. Updat. 2019, 44, 100640. [Google Scholar] [CrossRef] [PubMed]
- Hirsch, E.B.; Tam, V.H. Impact of Multidrug-Resistant Pseudomonas aeruginosa Infection on Patient Outcomes. Expert Rev. Pharmacoecon. Outcomes Res. 2010, 10, 441–451. [Google Scholar] [CrossRef]
- Ghorbani, G.; Rahimi, E.; Shakerian, A. Antibiotic Resistance’s Genotypic and Phenotypic Characteristics and the Frequency of Virulence Factors in P. Aeruginosa Isolates Isolated from Water Samples in Iran. BioMed Res. Int. 2022, 2022, 7076433. [Google Scholar] [CrossRef] [PubMed]
- Bocharova, Y.; Savinova, T.; Lazareva, A.; Polikarpova, S.; Gordinskaya, N.; Mayanskiy, N.; Chebotar, I. Genotypes, Carbapenemase Carriage, Integron Diversity and oprD Alterations among Carbapenem-Resistant Pseudomonas Aeruginosa from Russia. Int. J. Antimicrob. Agents 2020, 55, 105899. [Google Scholar] [CrossRef]
- Sindeldecker, D.; Stoodley, P. The Many Antibiotic Resistance and Tolerance Strategies of Pseudomonas Aeruginosa. Biofilm 2021, 3, 100056. [Google Scholar] [CrossRef]
- Gómez-Martínez, J.; Rocha-Gracia, R.D.C.; Bello-López, E.; Cevallos, M.A.; Castañeda-Lucio, M.; Sáenz, Y.; Jiménez-Flores, G.; Cortés-Cortés, G.; López-García, A.; Lozano-Zarain, P. Comparative Genomics of Pseudomonas Aeruginosa Strains Isolated from Different Ecological Niches. Antibiotics 2023, 12, 866. [Google Scholar] [CrossRef]
- Tacconelli, E.; Carrara, E.; Savoldi, A.; Harbarth, S.; Mendelson, M.; Monnet, D.L.; Pulcini, C.; Kahlmeter, G.; Kluytmans, J.; Carmeli, Y.; et al. Discovery, Research, and Development of New Antibiotics: The WHO Priority List of Antibiotic-Resistant Bacteria and Tuberculosis. Lancet Infect. Dis. 2018, 18, 318–327. [Google Scholar] [CrossRef]
- Moradali, M.F.; Ghods, S.; Rehm, B.H.A. Pseudomonas Aeruginosa Lifestyle: A Paradigm for Adaptation, Survival, and Persistence. Front. Cell. Infect. Microbiol. 2017, 7, 39. [Google Scholar] [CrossRef]
- Maurice, N.M.; Bedi, B.; Sadikot, R.T. Pseudomonas aeruginosa Biofilms: Host Response and Clinical Implications in Lung Infections. Am. J. Respir. Cell Mol. Biol. 2018, 58, 428–439. [Google Scholar] [CrossRef]
- Francis, V.I.; Stevenson, E.C.; Porter, S.L. Two-Component Systems Required for Virulence in Pseudomonas aeruginosa. FEMS Microbiol. Lett. 2017, 364, fnx104. [Google Scholar] [CrossRef] [PubMed]
- Riquelme, S.A.; Liimatta, K.; Wong Fok Lung, T.; Fields, B.; Ahn, D.; Chen, D.; Lozano, C.; Sáenz, Y.; Uhlemann, A.-C.; Kahl, B.C.; et al. Pseudomonas Aeruginosa Utilizes Host-Derived Itaconate to Redirect Its Metabolism to Promote Biofilm Formation. Cell Metab. 2020, 31, 1091–1106.e6. [Google Scholar] [CrossRef] [PubMed]
- Allel, K.; Day, L.; Hamilton, A.; Lin, L.; Furuya-Kanamori, L.; Moore, C.E.; Van Boeckel, T.; Laxminarayan, R.; Yakob, L. Global Antimicrobial-Resistance Drivers: An Ecological Country-Level Study at the Human–Animal Interface. Lancet Planet. Health 2023, 7, e291–e303. [Google Scholar] [CrossRef]
- Denissen, J.; Reyneke, B.; Waso-Reyneke, M.; Havenga, B.; Barnard, T.; Khan, S.; Khan, W. Prevalence of ESKAPE Pathogens in the Environment: Antibiotic Resistance Status, Community-Acquired Infection and Risk to Human Health. Int. J. Hyg. Environ. Health 2022, 244, 114006. [Google Scholar] [CrossRef]
- Lopez, N.V.; Farsar, C.J.; Harmon, D.E.; Ruiz, C. Urban and Agricultural Soils in Southern California Are a Reservoir of Carbapenem-resistant Bacteria. MicrobiologyOpen 2020, 9, 1247–1263. [Google Scholar] [CrossRef] [PubMed]
- Butiuc-Keul, A.; Carpa, R.; Podar, D.; Szekeres, E.; Muntean, V.; Iordache, D.; Farkas, A. Antibiotic Resistance in Pseudomonas spp. Through the Urban Water Cycle. Curr. Microbiol. 2021, 78, 1227–1237. [Google Scholar] [CrossRef]
- Irfan, M.; Almotiri, A.; AlZeyadi, Z.A. Antimicrobial Resistance and Its Drivers—A Review. Antibiotics 2022, 11, 1362. [Google Scholar] [CrossRef]
- Berendonk, T.U.; Manaia, C.M.; Merlin, C.; Fatta-Kassinos, D.; Cytryn, E.; Walsh, F.; Bürgmann, H.; Sørum, H.; Norström, M.; Pons, M.-N.; et al. Tackling Antibiotic Resistance: The Environmental Framework. Nat. Rev. Microbiol. 2015, 13, 310–317. [Google Scholar] [CrossRef]
- Pal, C.; Asiani, K.; Arya, S.; Rensing, C.; Stekel, D.J.; Larsson, D.G.J.; Hobman, J.L. Metal Resistance and Its Association With Antibiotic Resistance. In Advances in Microbial Physiology; Elsevier: Amsterdam, The Netherlands, 2017; Volume 70, pp. 261–313. ISBN 978-0-12-812386-7. [Google Scholar]
- Samanta, I.; Bandyopadhyay, S. The Emergence of Antimicrobial-Resistant Bacteria in Livestock, Poultry and Agriculture. In Antimicrobial Resistance in Agriculture; Elsevier: Amsterdam, The Netherlands, 2020; pp. 19–27. ISBN 978-0-12-815770-1. [Google Scholar]
- Park, J.-H.; Kim, Y.-J.; Binn-Kim; Seo, K.-H. Spread of Multidrug-Resistant Escherichia coli Harboring Integron via Swine Farm Waste Water Treatment Plant. Ecotoxicol. Environ. Saf. 2018, 149, 36–42. [Google Scholar] [CrossRef]
- Zhang, S.; Abbas, M.; Rehman, M.U.; Huang, Y.; Zhou, R.; Gong, S.; Yang, H.; Chen, S.; Wang, M.; Cheng, A. Dissemination of Antibiotic Resistance Genes (ARGs) via Integrons in Escherichia coli: A Risk to Human Health. Environ. Pollut. 2020, 266, 115260. [Google Scholar] [CrossRef] [PubMed]
- Ghosh, C.; Sarkar, P.; Issa, R.; Haldar, J. Alternatives to Conventional Antibiotics in the Era of Antimicrobial Resistance. Trends Microbiol. 2019, 27, 323–338. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, L.; Garcia, J.; Gruenberg, K.; MacDougall, C. Multidrug-Resistant Pseudomonas Infections: Hard to Treat, But Hope on the Horizon? Curr. Infect. Dis. Rep. 2018, 20, 23. [Google Scholar] [CrossRef]
- Ruiz-Garbajosa, P.; Cantón, R. Epidemiology of Antibiotic Resistance in Pseudomonas aeruginosa. Implications for Empiric and Definitive Therapy. Rev. Esp. Quimioter. 2017, 30 (Suppl. S1), 8–12. [Google Scholar]
- Hernando-Amado, S.; Coque, T.M.; Baquero, F.; Martínez, J.L. Defining and Combating Antibiotic Resistance from One Health and Global Health Perspectives. Nat. Microbiol. 2019, 4, 1432–1442. [Google Scholar] [CrossRef] [PubMed]
- Laborda, P.; Sanz-García, F.; Hernando-Amado, S.; Martínez, J.L. Pseudomonas Aeruginosa: An Antibiotic Resilient Pathogen with Environmental Origin. Curr. Opin. Microbiol. 2021, 64, 125–132. [Google Scholar] [CrossRef] [PubMed]
- Güssow, D.; Clackson, T. Direct Clone Characterization from Plaques and Colonies by the Polymerase Chain Reaction. Nucleic Acids Res. 1989, 17, 4000. [Google Scholar] [CrossRef] [PubMed]
- Talukder, A.; Rahman, M.M.; Chowdhury, M.M.H.; Mobashshera, T.A.; Islam, N.N. Plasmid Profiling of Multiple Antibiotic-Resistant Pseudomonas aeruginosa Isolated from Soil of the Industrial Area in Chittagong, Bangladesh. Beni Suef Univ. J. Basic Appl. Sci. 2021, 10, 44. [Google Scholar] [CrossRef]
- Lauritsen, J.G.; Hansen, M.L.; Bech, P.K.; Jelsbak, L.; Gram, L.; Strube, M.L. Identification and Differentiation of Pseudomonas Species in Field Samples Using an rpoD Amplicon Sequencing Methodology. mSystems 2021, 6, e00704-21. [Google Scholar] [CrossRef]
- Lanotte, P.; Watt, S.; Mereghetti, L.; Dartiguelongue, N.; Rastegar-Lari, A.; Goudeau, A.; Quentin, R. Genetic Features of Pseudomonas aeruginosa Isolates from Cystic Fibrosis Patients Compared with Those of Isolates from Other Origins. J. Med. Microbiol. 2004, 53, 73–81. [Google Scholar] [CrossRef]
- Pitondo-Silva, A.; Gonçalves, G.B.; Stehling, E.G. Heavy Metal Resistance and Virulence Profile in Pseudomonas aeruginosa Isolated from Brazilian Soils. Apmis 2016, 124, 681–688. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.; Bandara, R.; Conibear, T.C.R.; Thuruthyil, S.J.; Rice, S.A.; Kjelleberg, S.; Givskov, M.; Willcox, M.D.P. Pseudomonas aeruginosa with LasI Quorum-Sensing Deficiency during Corneal Infection. Investig. Opthalmology Vis. Sci. 2004, 45, 1897. [Google Scholar] [CrossRef] [PubMed]
- Weinstein, M.P. Performance Standards for Antimicrobial Susceptibility Testing: Supplement M100, 30th ed.; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2020; ISBN 978-1-68440-066-9. [Google Scholar]
- Kargar, M.; Mohammadalipour, Z.; Doosti, A.; Lorzadeh, S.; Japoni-Nejad, A. High Prevalence of Class 1 to 3 Integrons Among Multidrug-Resistant Diarrheagenic Escherichia coli in Southwest of Iran. Osong Public Health Res. Perspect. 2014, 5, 193–198. [Google Scholar] [CrossRef] [PubMed]
- Bouskill, N.J.; Barnhart, E.P.; Galloway, T.S.; Handy, R.D.; Ford, T.E. Quantification of Changing Pseudomonas aeruginosa sodA, htpX and Mt Gene Abundance in Response to Trace Metal Toxicity: A Potential in Situ Biomarker of Environmental Health: Microbial Molecular Biomarkers. FEMS Microbiol. Ecol. 2007, 60, 276–286. [Google Scholar] [CrossRef] [PubMed]
- Deredjian, A.; Colinon, C.; Brothier, E.; Favre-Bonté, S.; Cournoyer, B.; Nazaret, S. Antibiotic and Metal Resistance among Hospital and Outdoor Strains of Pseudomonas aeruginosa. Res. Microbiol. 2011, 162, 689–700. [Google Scholar] [CrossRef] [PubMed]
- Deredjian, A.; Colinon, C.; Hien, E.; Brothier, E.; Youenou, B.; Cournoyer, B.; Dequiedt, S.; Hartmann, A.; Jolivet, C.; Houot, S.; et al. Low Occurrence of Pseudomonas aeruginosa in Agricultural Soils with and without Organic Amendment. Front. Cell. Infect. Microbiol. 2014, 4, 53. [Google Scholar] [CrossRef]
- Elshafiee, E.A.; Nader, S.M.; Dorgham, S.M.; Hamza, D.A. Carbapenem-Resistant Pseudomonas aeruginosa Originating from Farm Animals and People in Egypt. J. Vet. Res. 2019, 63, 333–337. [Google Scholar] [CrossRef]
- Hosu, M.C.; Vasaikar, S.; Okuthe, G.E.; Apalata, T. Molecular Detection of Antibiotic-Resistant Genes in Pseudomonas aeruginosa from Nonclinical Environment: Public Health Implications in Mthatha, Eastern Cape Province, South Africa. Int. J. Microbiol. 2021, 2021, 8861074. [Google Scholar] [CrossRef]
- Juyal, A.; Otten, W.; Baveye, P.C.; Eickhorst, T. Influence of Soil Structure on the Spread of Pseudomonas fluorescens in Soil at Microscale. Eur. J. Soil Sci. 2021, 72, 141–153. [Google Scholar] [CrossRef]
- Armalytė, J.; Skerniškytė, J.; Bakienė, E.; Krasauskas, R.; Šiugždinienė, R.; Kareivienė, V.; Kerzienė, S.; Klimienė, I.; Sužiedėlienė, E.; Ružauskas, M. Microbial Diversity and Antimicrobial Resistance Profile in Microbiota From Soils of Conventional and Organic Farming Systems. Front. Microbiol. 2019, 10, 892. [Google Scholar] [CrossRef]
- Kumar, S.; Adhikary, A.; Saini, R.; Bhardwaj, P. Pseudomonas: A Major Bacteria in Heavy Metal Contaminated Soil of South-West Punjab, India. Int. J. Plant Environ. 2019, 5, 26–32. [Google Scholar] [CrossRef]
- Crone, S.; Vives-Flórez, M.; Kvich, L.; Saunders, A.M.; Malone, M.; Nicolaisen, M.H.; Martínez-García, E.; Rojas-Acosta, C.; Catalina Gomez-Puerto, M.; Calum, H.; et al. The Environmental Occurrence of Pseudomonas aeruginosa. Apmis 2020, 128, 220–231. [Google Scholar] [CrossRef]
- Bhasin, S.; Shukla, N.A.; Shrivastava, S. Bacterial Diversity of River Kshipra with Relation to Human Health. Environ. Conserv. J. 2020, 21, 63–74. [Google Scholar] [CrossRef]
- Govender, R.; Amoah, I.D.; Adegoke, A.A.; Singh, G.; Kumari, S.; Swalaha, F.M.; Bux, F.; Stenström, T.A. Identification, Antibiotic Resistance, and Virulence Profiling of Aeromonas and Pseudomonas Species from Wastewater and Surface Water. Environ. Monit. Assess. 2021, 193, 294. [Google Scholar] [CrossRef] [PubMed]
- Magalhães, M.J.T.L.; Pontes, G.; Serra, P.T.; Balieiro, A.; Castro, D.; Pieri, F.A.; Crainey, J.L.; Nogueira, P.A.; Orlandi, P.P. Multidrug Resistant Pseudomonas Aeruginosa Survey in a Stream Receiving Effluents from Ineffective Wastewater Hospital Plants. BMC Microbiol. 2016, 16, 193. [Google Scholar] [CrossRef]
- Gutiérrez Cárdenas, O.G.; Navarro Ibarra, L.F.; Loeza Lara, P.D.; Del Río Rodríguez, O.G.; Jiménez Mejía, R. Perfiles de Resistencia a Antibióticos y Metales Pesados En Pseudomonas aeruginosa Potencialmente Patógenas Aisladas de Agua de Uso Agrícola. Nova Sci. 2017, 9, 97. [Google Scholar] [CrossRef]
- Abdulateef, S.A.; Aal Owaif, H.A.; Department of Plant Biotechnology, College of Biotechnology, Al-Nahrain University, Baghdad, Iraq; Hussein, M.H. Department of Molecular and Medical Biotechnology, College of Biotechnology, Al-Nahrain University, Baghdad, Iraq. Importance of Virulence Factors in Bacterial Pathogenicity: A Review. Int. J. Med. Sci. Clin. Res. Stud. 2023, 3, 765–769. [Google Scholar] [CrossRef]
- Kaszab, E.; Radó, J.; Kriszt, B.; Pászti, J.; Lesinszki, V.; Szabó, A.; Tóth, G.; Khaledi, A.; Szoboszlay, S. Groundwater, Soil and Compost, as Possible Sources of Virulent and Antibiotic-Resistant Pseudomonas aeruginosa. Int. J. Environ. Health Res. 2021, 31, 848–860. [Google Scholar] [CrossRef]
- Ghanem, S.M.; Abd El-Baky, R.M.; Abourehab, M.A.; Fadl, G.F.; Gamil, N.G. Prevalence of Quorum Sensing and Virulence Factor Genes Among Pseudomonas aeruginosa Isolated from Patients Suffering from Different Infections and Their Association with Antimicrobial Resistance. Infect. Drug Resist. 2023, 16, 2371–2385. [Google Scholar] [CrossRef]
- Vadla, S.; Girija Aseervatham Selvi, S.; Mantravadi, H. Detection of Quorum Sensing Virulence Factor Genes and Its Consanguinity to Antibiotic Sensitivity Profile in the Clinical Isolates of Pseudomonas aeruginosa. Iran. J. Basic Med. Sci. 2023, 26, 899. [Google Scholar] [CrossRef]
- Pitondo-Silva, A.; Martins, V.V.; Fernandes, A.F.T.; Stehling, E.G. High Level of Resistance to Aztreonam and Ticarcillin in Pseudomonas aeruginosa Isolated from Soil of Different Crops in Brazil. Sci. Total Environ. 2014, 473–474, 155–158. [Google Scholar] [CrossRef] [PubMed]
- Partridge, S.R.; Tsafnat, G.; Coiera, E.; Iredell, J.R. Gene Cassettes and Cassette Arrays in Mobile Resistance Integrons. FEMS Microbiol. Rev. 2009, 33, 757–784. [Google Scholar] [CrossRef] [PubMed]
- Sabbagh, P.; Rajabnia, M.; Maali, A.; Ferdosi-Shahandashti, E. Integron and Its Role in Antimicrobial Resistance: A Literature Review on Some Bacterial Pathogens. Iran. J. Basic Med. Sci. 2021, 24, 136. [Google Scholar] [CrossRef] [PubMed]
- Weiner, L.M.; Webb, A.K.; Limbago, B.; Dudeck, M.A.; Patel, J.; Kallen, A.J.; Edwards, J.R.; Sievert, D.M. Antimicrobial-Resistant Pathogens Associated With Healthcare-Associated Infections: Summary of Data Reported to the National Healthcare Safety Network at the Centers for Disease Control and Prevention, 2011–2014. Infect. Control Hosp. Epidemiol. 2016, 37, 1288–1301. [Google Scholar] [CrossRef] [PubMed]
- Yu, Z.; Gunn, L.; Wall, P.; Fanning, S. Antimicrobial Resistance and Its Association with Tolerance to Heavy Metals in Agriculture Production. Food Microbiol. 2017, 64, 23–32. [Google Scholar] [CrossRef]
- Bazzi, W.; Abou Fayad, A.G.; Nasser, A.; Haraoui, L.-P.; Dewachi, O.; Abou-Sitta, G.; Nguyen, V.-K.; Abara, A.; Karah, N.; Landecker, H.; et al. Heavy Metal Toxicity in Armed Conflicts Potentiates AMR in A. Baumannii by Selecting for Antibiotic and Heavy Metal Co-Resistance Mechanisms. Front. Microbiol. 2020, 11, 68. [Google Scholar] [CrossRef]
Target Genes | Size (bp) | Primer Sequence 5′ → 3′ | Reference |
---|---|---|---|
algD | 1310 | ATGCGAATCAGCATCTTTGGT CTACCAGCAGATGCCCTCGGG | [32] |
exoS | 504 | CTTGAAGGGACTCGACAAGG TTCAGGTCCGCGTAGTGAAT | [32] |
plcH | 307 | GAAGCCATGGGCTACTTCAA AGAGTGACGAGGAGCGGTAG | [32] |
toxA | 352 | GGTAACCAGCTCAGCCACAT TGATGTCCAGGTCATGCTTC | [32] |
aprA | 140 | ACCCTGTCCTATTCGTTCC GATTGCAGCGACAACTTGG | [34] |
lasB | 300 | GGAATGAACGAAGCGTTCTC GGTCCAGTAGTAGCGGTTGG | [32] |
rhlAB | 151 | TCATGGAATTGTCACAACCGC ATACGGCAAAATCATGGCAAC | [34] |
plcN | 466 | GTTATCGCAACCAGCCCTAC AGGTCGAACACCTGGAACAC | [32] |
Target Genes | Size (bp) | Primer Sequence 5′ → 3′ | Reference |
---|---|---|---|
copA | 475 | CGGTCTCTACGAATACCGCTTCAA GAAATAGCTCATTGCCGAGGCGTT | [37] |
copB | 364 | TTCCTGCTCGACCAGTTGGAATAC GGTTGGTCAACAGGATGTCGTACT | [37] |
arsB | 410 | GGTCTATGCGCTGGAGCAATTGAA TGCTGGGCATGTTGTTCATTACCG | [37] |
arsC | 205 | GCAGCATTCTTTCCGAAGCCATGT TCGCAAACGGTGATGACGATGT | [37] |
merA | 932 | GTGCCGTCCAAGATCATGAT TAGCCYACRGTSGCSACYTG | [38] |
czcA | 206 | GTTCACCTTGCTCTTCGCCATGTT ACAGGTTGCGGATGAAGGAGATCA | [37] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Licea-Herrera, J.I.; Guerrero, A.; Mireles-Martínez, M.; Rodríguez-González, Y.; Aguilera-Arreola, G.; Contreras-Rodríguez, A.; Fernandez-Davila, S.; Requena-Castro, R.; Rivera, G.; Bocanegra-García, V.; et al. Agricultural Soil as a Reservoir of Pseudomonas aeruginosa with Potential Risk to Public Health. Microorganisms 2024, 12, 2181. https://doi.org/10.3390/microorganisms12112181
Licea-Herrera JI, Guerrero A, Mireles-Martínez M, Rodríguez-González Y, Aguilera-Arreola G, Contreras-Rodríguez A, Fernandez-Davila S, Requena-Castro R, Rivera G, Bocanegra-García V, et al. Agricultural Soil as a Reservoir of Pseudomonas aeruginosa with Potential Risk to Public Health. Microorganisms. 2024; 12(11):2181. https://doi.org/10.3390/microorganisms12112181
Chicago/Turabian StyleLicea-Herrera, Jessica I., Abraham Guerrero, Maribel Mireles-Martínez, Yuridia Rodríguez-González, Guadalupe Aguilera-Arreola, Araceli Contreras-Rodríguez, Susana Fernandez-Davila, Rocío Requena-Castro, Gildardo Rivera, Virgilio Bocanegra-García, and et al. 2024. "Agricultural Soil as a Reservoir of Pseudomonas aeruginosa with Potential Risk to Public Health" Microorganisms 12, no. 11: 2181. https://doi.org/10.3390/microorganisms12112181
APA StyleLicea-Herrera, J. I., Guerrero, A., Mireles-Martínez, M., Rodríguez-González, Y., Aguilera-Arreola, G., Contreras-Rodríguez, A., Fernandez-Davila, S., Requena-Castro, R., Rivera, G., Bocanegra-García, V., & Martínez-Vázquez, A. V. (2024). Agricultural Soil as a Reservoir of Pseudomonas aeruginosa with Potential Risk to Public Health. Microorganisms, 12(11), 2181. https://doi.org/10.3390/microorganisms12112181