Next Article in Journal
One Health Approach to Study the Occurrence and Antimicrobial Resistance of Extended-Spectrum β-Lactamase- and Carbapenemase-Producing Escherichia coli and Klebsiella spp. in Urban Agriculture in Burkina Faso
Previous Article in Journal
Evaluating Sequence Alignment Tools for Antimicrobial Resistance Gene Detection in Assembly Graphs
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

In Vitro Assessment of Penicillium expansum Sensitivity to Difenoconazole

1
Phytopathology Unit, Department of Plant Protection, Ecole Nationale d’Agriculture de Meknès, Km10, Rte Haj Kaddour, BP S/40, Meknes 50001, Morocco
2
Laboratory of Microbial Biotechnologies and Plant Protection, Faculty of Sciences, Ibn Zhor University, BP 8106, Agadir 8000, Morocco
3
Laboratory of Biotechnology and Valorization of Bio-Resources (BioVaR), Department of Biology, Faculty of Sciences, Moulay Ismail University, BP 11201, Zitoune, Meknes 50000, Morocco
4
Microbiology Unit, Laboratory of Bioresources, Biotechnology, Ethnopharmacology and Health, Faculty of Medicine and Pharmacy Oujda, University Mohammed Premier, Oujda 60000, Morocco
5
Laboratory of Environment and Valorization of Microbial and Plant Resources, Faculty of Sciences, Moulay Ismail University, BP 11201, Zitoune, Meknes 50000, Morocco
6
Laboratory of Biotechnology, Conservation and Valorisation of Natural Resources (LBCVNR), Faculty of Sciences Dhar El Mehraz, Sidi Mohamed Ben Abdallah University, Fez 30000, Morocco
7
Biotechnology Unit, Nematology Laboratory, Regional Center of Agricultural Research of Rabat, National Institute of Agricultural Research, Avenue Ennasr, BP 415 Rabat Principale, Rabat 10090, Morocco
8
Induced Resistance and Plant Biosection Research Unit, EA 4707-USC INRAE1488, Reims Champagne-Ardenne University, 51687 Reims, France
*
Authors to whom correspondence should be addressed.
Microorganisms 2024, 12(11), 2169; https://doi.org/10.3390/microorganisms12112169
Submission received: 29 September 2024 / Revised: 23 October 2024 / Accepted: 25 October 2024 / Published: 28 October 2024
(This article belongs to the Section Antimicrobial Agents and Resistance)

Abstract

Penicillium expansum causes blue mold, a major post-harvest disease affecting apples. This disease is commonly managed using fungicides, including Difenoconazole (Dif), a demethylation inhibitor (DMI) approved for its control. This investigation aims to evaluate the baseline sensitivity of 100 P. expansum isolates to Difenoconazole. The isolates were collected from symptomatic apples in 34 storage warehouses across the Fes-Meknes and Draa-Tafilalet regions over three years (2020, 2021, and 2022). The study revealed an increase in the percentage of inhibition of mycelial growth and spore germination of P. expansum proportional to the increasing concentration of the fungicide. Moreover, the results indicate that 46 isolates were able to develop even at a concentration of 5 µg/mL of Dif (the suggested discriminatory dose), indicating reduced sensitivity to this fungicide. The analysis of the values of the effective concentration to inhibit 50% (EC50) of mycelial growth of P. expansum ranging from 0.027 to 1.673 µg/mL (mean: 0.263 µg/mL, variation factor: 62.507) and for spore germination from 0.0002 to 0.787 µg/mL (mean: 0.048 µg/mL, variation factor: 4113.835). The wide variation in EC50 values indicates significant variability in the isolates’ responses to Dif, likely due to diverse sampling in space and time. Our results showed that some P. expansum isolates could grow even at high concentrations of Dif, indicating limited efficacy of this treatment. The EC50 of five isolates exceeded 0.92 µg/mL, suggesting potential resistance. This study indicates reduced sensitivity and possible emergence of resistant strains. Notably, it is the first evaluation of P. expansum sensitivity to Dif in Morocco.

1. Introduction

P. expansum is a member of the ascomycetes that cause blue rot, a severe post-harvest disease of apples and pears worldwide [1]. P. expansum is considered the main post-harvest pathogen of pome fruits, damaging apples and other deciduous fruits in the field, during harvesting, packaging, or storage [2]. A study of post-harvest diseases in Washington State showed that blue rot accounted for 28% of fruit rots in warehouses. As a result, blue mold causes between 50 and 250 million US dollars’ worth of damage every year [3]. This disease is represented by a soft, watery, slightly brown rot that is also characterized by the appearance of blue-green conidia covering the surface of the fruit, which manifests itself in the advanced stages of the rot [4].
The presence of pathogenic fungi on fruit can considerably elevate the risk of causing serious illness in human consumers. P. expansum causes blue rot in fruit while producing toxic secondary metabolites such as patulin and citrinin [5]. Patulin, a cyclic tetraketide, has been shown to have a highly toxic impact on both plant and animal cells, due to its interactions with the cellular sulfhydryl groups essential for proteins, as well as with glutathione. Patulin has been linked to a range of adverse effects, including mutagenic risks, genotoxic consequences, actions hurting the immune system, teratogenic potential, and neurotoxic results [6]. The same toxic effects can be attributed to citrinin, in particular, it is associated with nephrotoxic effects, immunotoxic effects, and potential teratogenic effects, making this mycotoxin potentially harmful to human health [7].
Fungicides have been widely used to combat blue rot and other post-harvest diseases. Worldwide, post-harvest treatment against P. expansum primarily relies on thiabendazole (Figure S1), which belongs to the benzimidazole family, and imazalil, an inhibitor of sterol demethylation (DMI). These substances are typically applied through pre-storage dipping or as an in-line treatment during the packaging process as part of the effort to combat post-harvest diseases in apples [8]. In 2004, the USA also registered two new fungicides for pome fruit: fludioxonil (FDL) and pyrimethanil (PYR). Both are effective against blue rot [9].
In 2016, difenoconazole (Figure S1), a new fungicidal demethylation inhibitor (DMI) molecule, was registered for post-harvest use on pome fruits. This product forms part of the mixture with FDL and is marketed under the name AcademyTM by Syngenta Crop Protection [1]. Furthermore, Jurick et al. [10] reported that difenoconazole exhibited both curative and protective activities, effectively controlling Penicillium spp., which is responsible for blue mold in stored apples. Difenoconazole (DIF) has a systematic action as well as an important ability to control fungal infections, as recently illustrated [1]. DMIs, like DIF, attack sterol 14a-demethylase Cytochrome P450 (CYP51), an essential component of fungal membrane sterols required for proper membrane function [11].
P. expansum is a fungus with a significant risk of fungicide resistance. As a result, resistance against TBZ, associated with various mutations in the b-tubulin gene, is reported worldwide in many production regions [12]. The presence of PYR resistance has recently been noted in the USA in north-western regions, but it is still not significant. Recently, low levels of resistance to FDL or reductions in susceptibility have appeared sporadically in a few apple packinghouses [1]. For fungicides belonging methylation inhibitor (DMI) family, a recent study of laboratory mutants of P. expansum resistant to the DMI difenoconazole revealed that resistance was linked to a mutation in the PeCYP51 gene [13].
In a previous study, an assessment of apple storage conditions in Moroccan facilities was conducted, along with a sampling of rotten apples [14]. This study revealed that post-harvest treatments were primarily based on three active ingredients: thiophanate-methyl, carbendazim, and difenoconazole. However, given that the first two substances have been withdrawn from the market, it is crucial to evaluate the sensitivity of pathogens to difenoconazole [14]. Furthermore, the study also reported that 72% of apple rots were caused by Penicillium expansum, emphasizing the need to assess the response of this pathogen to the chemical treatment, considering the increasing resistance of pathogens to certain active substances [13]. In this context, the present study aims to evaluate the sensitivity of 100 Penicillium expansum isolates, obtained from rotten apples collected from various storage facilities in Morocco.

2. Materials and Methods

2.1. Sampling Locations and Fungal Isolation

Rotten apples from various cultivars were collected from 34 storage warehouses in the Fes-Meknes (Meknes, El Hajeb, Sefrou, and Ifrane) and Draa-Tafilalet (Midelt) regions of Morocco over a period of 3 years, namely, 2020, 2021, and 2022 (Figure 1, Table 1). These apples are characterized by a brown mold with distinct edges, developing in cushion-like patches on the surface, first white and then blue-green (Figure S2). All samples were placed in sterile plastic bags and transported to the Laboratory of Phytopathology at the National School of Agriculture in Meknes. The process of isolating fungal pathogens involved disinfecting symptomatic samples with a 2% sodium hypochlorite solution, followed by two rinses with sterile distilled water. Subsequently, the samples were air-dried under a laminar flow hood. Using a sterile scalpel, three pieces were carefully excised from the margin of decay on each apple. These pieces were placed in Petri dishes containing Potato-Dextrose-Agar (PDA) culture medium. The dishes were then incubated at 25 °C for seven days in the dark using an IN 30 cultivator (Memmert GmbH Co., Cologne, Germany). Several subcultures on PDA medium were performed to obtain pure isolates [15,16]. In this study, 100 isolates were identified as Penicillium expansum using appropriate identification keys [17,18,19]. The isolates obtained were stored at 4 °C until use.

2.2. Molecular Identification of Fungal Isolates

To confirm the morphological identification of the fungal isolates, molecular identification was also conducted. Genomic DNA extraction followed the method outlined by Doyle and Doyle [20]. Approximately one square centimeter of each sample was placed in an extraction tube with 500 µL of extraction buffer. The mixture was crushed with a pestle, vortexed, and incubated at 65 °C for 30 min with intermittent rocking. After incubation, the samples were centrifuged at 13,000 rpm for 5 min, and 400 µL of the supernatant was mixed with 400 µL of chloroform/isoamyl alcohol (24:1). This mixture was gently agitated for 5 min and centrifuged again at 14,000 rpm for 5 min. Then, 350 µL of the supernatant was precipitated with an equal volume of isopropanol, mixed by rocking and centrifuged at 14,000 rpm for 10 min. The supernatant was discarded, and the pellet was washed with 500 µL of 70% ethanol, vortexed, and centrifuged for 5 min at 14,000 rpm. The pellet was dried at 60 °C for 30 to 45 min and resuspended in 50 µL of sterile distilled water (SDW). The extracted DNA was stored at −20 °C. DNA quantification and quality were assessed using a NanoDrop spectrophotometer (Jenway Genova Nano, Serial No 67281, Cole-Parmer, Stone, Staffordshire, UK). Polymerase chain reaction (PCR) was performed using specific primers of Penicillium expansum: PatF (GenBank Accession No. AIG62137): patF-F (ATGAAATCCTCCCTGTGGGTTAGT, Eurogentec 7412543) and patF-R (GAAGGATAATTTCCGGGGTAGTCATT, Eurogentec 7412544), A final volume of 25 μL was used for each PCR reaction. The reaction mix included 5 µL of PCR buffer (5×), 1 µL (10 µM) of each primer, 0.2 µL (5 U/µL) of EnzimaGoTaq DNA polymerase (Bioline, London, UK), 15.3 µL of SDW and 2.5 µL of genomic DNA. For the negative control, genomic DNA was replaced by SDW. The PCR was carried out using a thermocycler according to the following conditions: an initial denaturation at 94 °C for 5 min, followed by 40 cycles of amplification, each cycle of which consisted of denaturation at 94 °C for 45 s, primer annealing at 65 °C for 45 s and extension at 72 °C for 30 s and the last cycle was followed by a final extension for 10 min at 72 °C [21]. PCR products were visualized on a 1.5% agarose gel (Bioline: Agarose, Molecular Grade, Meridian Bioscience, Memphis, Tennessee, TN, USA) using a UV transilluminator (Quantum CX5 Edge—Gel Documentation System, France) to assess the presence and size of amplicons following electrophoresis. The electrophoresis was conducted using a Tris-Borate EDTA (TBE) buffer (0.5×), prepared by dissolving 5.39 g of Tris (Sigma Life Science, Alexandria, VA, USA), 2.75 g of boric acid (Fisher Scientific International Company, Waltham, MA, USA), and 0.29 g of EDTA (Polysciences, INC., Warrington, PA, USA) in 1 L of distilled water [14].

2.3. Fungicide

The commercial fungicide formulated with Difenoconazole (Score 250EC, Syngenta, L1042661 MOR/05W-PPE 4095375), distributed by Syngenta Morocco and manufactured by Syngenta Plant Protection S.A. Basel, Switzerland, was used to assess the sensitivity of 100 isolates of P. expansum to this active substance belonging to the Demethylation Inhibitors (DMI) family.

2.4. Sensitivity Assay of Mycelial Growth to Difenoconazole

One hundred isolates of P. expansum collected from different apple storage warehouses were tested for the sensitivity of their mycelial growth to Difenoconazole (Dif). Indeed, concentrations 0.00, 0.01, 0.5, 1, 5, and 10 µg/mL of Dif were obtained by adding appropriate quantities of fungicide to an autoclaved PDA medium cooled to approximately 50 °C. The concentration of 5 µg/mL was considered the discriminatory dose [10]. The inoculum was prepared by transferring spores from a 7-day-old PDA culture of each isolate to a tube containing 1 mL of sterile distilled water with 0.01% Tween 20. The concentration was adjusted to 1 × 106 spores/mL using a hematocytometer. The spore suspension was poured into PDA medium and the cultures were incubated at 25 °C for 24 h. Afterward, mycelial plugs of 5 mm in diameter were cut out and placed in the center of the PDA plates modified with the different concentrations of Dif. PDA plates without fungicide were used as a control [9,22]. Four Petri dishes were used for each isolate. Colony diameter was measured after 10 days at 25 °C. The experiment was performed twice. Then, for each isolate, percentage inhibition of mycelial growth PI (MG) was calculated according to the following formula: PI (MG) = (Dc − Df)/Dc × 100; with Dc representing the average diameter of the fungal colonies in the control (medium without fungicide) and Df corresponding to the average diameter of the fungal colonies in the medium amended with the fungicide for all concentrations examined [23]. The effective concentration that reduced mycelial growth to half (EC50) was calculated from the regression equation (y = ax + b) between the percentage inhibition and the log10 of the fungicide concentration [24].

2.5. Spore Germination Assay

Spore suspensions were prepared in tubes containing potato dextrose broth (PDB) medium using the same method described previously. This PDB medium containing P. expansum spores was amended with Dif to obtain final concentrations of 0.00, 0.01, 0.5, 1, 5, and 10 µg/mL. The tubes without fungicide were used as a control. Four repetitions per isolate were made. After 24 h of incubation at 25 °C, germination inhibition of 100 spores in each isolate was examined for each dose using a light microscope (at a magnification of 10× 40×). A spore was considered germinated if the length of the germ tube was equal to or greater than the diameter of the spore. The percentage inhibition of spore germination PI (GI) was calculated as follows: PI (GI) = (Gc − Gf/Gc) × 100; where Gc and Gf represent respectively the average number of spores germinated in the control and the medium amended with the fungicide [25,26,27]. This experiment was conducted twice. The effective concentration to inhibit 50% of spore germination (EC50) were calculated in the same manner described in the previous section.

2.6. Statistical Analyses

EC50 values were calculated for each isolate based on the regression equation between percentage inhibition and Log10 of fungicide concentration. All data were subjected to statistical analysis of variance (ANOVA) using SPSS software (version 25, IBM SPSS Statistics 25). Separation of means was carried out using the Tukey test with a significance level of p < 0.05.

3. Results

3.1. Molecular Identification of Penicillium expansum Strains

PCR conducted with the patF gene-specific primers confirmed that all 100 fungal isolates analyzed belong to the species Penicillium expansum. These isolates were collected from symptomatic apples in 34 storage facilities located within five Provincial Agriculture Directorates (PAD) in the main apple-producing regions of Morocco, indicating significant geographical diversity. The positive control used in this study, Aby4, had previously been identified as P. expansum through molecular sequencing of the ITS region of rDNA (accession number OR426630), ensuring the reliability of the results obtained with the molecular marker patF (Figure 2).

3.2. Effect of Difenoconazole on Mycelial Growth of P. expansum

Analysis of variance revealed a significant effect of fungicide concentration on the percentage of mycelial growth inhibition among the 100 isolates tested (Table S1). The inhibition percentage increased with higher concentrations of difenoconazole, with complete inhibition observed for some isolates at a concentration of 5 µg/mL (the suggested discriminatory dose). Additionally, the results indicate that 46 isolates (out of the 100 studied) were able to grow even at 5 µg/mL of difenoconazole (Table 2, Figure 3). These P. expansum isolates were sampled from symptomatic apples collected from various storage stations across the five PADs of this investigation: Meknès, El Hajeb, Sefrou, Midelt, and Ifrane. In contrast, a concentration of 10 µg/mL inhibited the growth of all P. expansum isolates (Table 2, Figure 3).

3.3. Effect of Difenoconazole on Spore Germination of P. expansum

Statistical analysis of the results revealed a significant difference in spore germination inhibition percentages among the different P. expansum isolates (Table S1), with inhibition increasing proportionally to the rising fungicide concentration. Total inhibition was observed at a concentration of 0.5 µg/mL for four isolates: IT2 (Meknes), MA6 (Ifrane), At2 (Sefrou), and AH1 (Midelt). In contrast, at this same concentration, no complete inhibition of mycelial growth was observed for any isolate. Additionally, 1 µg/mL of difenoconazole prevented the germination of 56 P. expansum isolates. However, only nine isolates were able to germinate at a concentration of 5 µg/mL, specifically: M7a from Ifrane, Tl2 and Tl4 from Midelt, ZA2 and ZA3 from Sefrou, DN3 and BNS5 from Meknes, and AML13 and AML25b from El Hajeb. Among these nine isolates, four are the same whose mycelium was able to grow at this concentration (among the 46), however the remaining five are different. None of the isolates was able to germinate at a concentration of 10 µg/mL (Table 2). These findings indicate that P. expansum’s response to difenoconazole varies between developmental stages, with spore germination showing significantly higher sensitivity to the fungicide than mycelial growth.

3.4. Analysis of EC50 Values

The EC50 values provide insights into the concentration of the fungicide needed to inhibit half of the mycelial growth and spore germination in 100 isolates of P. expansum. The results obtained showed a wide variation in the EC50 values for all the isolates studied. For the mycelial growth, the EC50 values ranged from 0.027 to 1.673 µg/mL, with a mean of 0.263 µg/mL and a variation factor of 62.507. In the spore germination test, the EC50 values spanned from 0.0002 to 0.787 µg/mL, with a mean of 0.048 µg/mL significantly lower than that of mycelial growth and a notably high variation factor of 4113.835. These findings indicate that the isolates in our study exhibit greater variability in sensitivity to difenoconazole (higher VF), with both lower and higher EC50 values compared to those reported in the reference study. Notably, our results reveal significantly lower average EC50 values for spore germination inhibition, with some isolates showing much greater sensitivity, as evidenced by the minimum value. However, the high VF reflects a broad range of responses, with certain isolates demonstrating substantial resistance (Table 3).
The results depicted in Figure 4 illustrate the distribution of EC50 values for mycelial growth and spore germination of P. expansum across different concentration intervals of Dif. The majority of isolates demonstrated EC50 values ranging from 0.027 to 0.139 µg/mL (28 isolates) and from 0.140 to 0.251 µg/mL (53 isolates) for mycelial growth. Conversely, 55 isolates displayed an EC50 below 0.027 µg/mL for spore germination, representing the minimum EC50 value for mycelial growth, while the EC50 of 42 isolates was between 0.027 and 0.139 µg/mL, indicating a high sensitivity of P. expansum spore germination to low concentrations of Dif. It is noteworthy that in the highest concentration intervals, five isolates demonstrated an effective concentration to inhibit half of the mycelial growth greater than 0.920 µg/mL. According to a reference study [1] these five P. expansum isolates exhibit resistance to difenoconazole. The EC50 values of the remaining isolates were distributed across the other intervals. These findings highlighted that almost all P. expansum isolates (98%) showed a very high sensitivity to Dif for spore germination, compared to mycelial growth, which exhibited remarkable variability with a tolerance to the fungicide even at high concentrations.
The five P. expansum isolates resistant to difenoconazole (Bs (AS3), Bs (AS7), DN9, M11, and DA7) are geographically distributed across the study regions (Figure 1). Specifically, three of these isolates are located in storage facilities under the Provincial Agriculture Directorate (PAD) of Meknes, one isolate in the PAD of Ifrane, and another in the PAD of Midelt. This distribution indicates that the majority of resistant isolates are concentrated in the storage facilities belonging to the PAD of Meknes.

4. Discussion

P. expansum, the causal agent of blue mold in post-harvest apples, is the most dominant pathogen among other fungal agents affecting apples in Morocco (72%), with an extremely high pathogenicity. It causes significant economic losses in the pomiculture sector. To control this storage disease, the chemical approach based on synthetic fungicides remains the most widely adopted in most Moroccan storage facilities, with Dif, registered under the commercial name Score, being the most commonly used currently [14]. However, the frequent use of this active substance could lead to pathogen resistance to Dif. Due to the significant lack of research regarding the evaluation of the efficacy of this fungicide in Morocco; this study holds considerable importance as it aims to assess the sensitivity of P. expansum to Dif.
The results obtained demonstrated a significant effect of Dif concentration on the inhibition percentage of mycelial growth in the 100 isolates tested. As the Dif concentration increased, so did the inhibition percentage, with complete inhibition beginning at a concentration of 5 µg/mL, which was suggested as a discriminatory dose. Interestingly, even at a concentration of 5 µg/mL, 46 isolates of P. expansum were capable of growth. However, the concentration of 10 µg/mL completely inhibited the growth of all P. expansum isolates. In this regard, the study performed by Jurick et al. [10] revealed that complete inhibition of mycelial growth, except for three isolates, occurred at 5 µg/mL Dif, while 10 µg/mL did not support growth for any of the isolates examined. The authors of that investigation recommended a concentration of 5 µg/mL Dif for phenotyping Penicillium spp. isolates with reduced sensitivity. In comparison with this research, our findings indicated that nearly half of the P. expansum isolates exhibited reduced sensitivity to Dif, suggesting a notable decrease in the fungicide’s efficacy in controlling the most prevalent post-harvest apple pathogen. Moreover, Dif has demonstrated considerable efficacy in controlling various ascomycetes, including Phacidiopycnis spp., Colletotrichum spp., and Alternaria spp. [1,28,29].
On the other hand, the results showed a proportional increase in the inhibition percentages of P. expansum spore germination with the rising fungicide concentration. Complete inhibition began at a concentration of 0.5 µg/mL for some P. expansum isolates. At 1 µg/mL, Dif prevented the germination of over half of the tested isolates, while spore germination at 5 µg/mL was observed in only 9 isolates, with total germination inhibition at 10 µg/mL. In light of these findings, it appears that P. expansum sensitivity to Dif for spore germination was significantly higher than for mycelial growth, suggesting theoretically the use of Dif as a preventive rather than curative treatment. However, in practice, it is often challenging to determine when the inoculum can infect apples (before harvest, during harvest-related manipulations, or storage in warehouses). Therefore, effective treatment must have the potential to be applied both preventively and curatively [30,31,32].
The results of our study indicate a remarkable variability in the EC50 values for mycelial growth and spore germination of 100 isolates of P. expansum. Regarding mycelial growth, the EC50 values ranged from 0.027 to 1.673 µg/mL, with a mean of 0.263 µg/mL and a variation factor of 62.507. For spore germination, the EC50 values ranged from 0.0002 to 0.787 µg/mL, with a mean of 0.048 µg/mL and a very high variation factor of approximately 4113.835. Comparatively, the study conducted by Ali and Amiri [1] focused on 130 isolates of P. expansum and revealed mean EC50 values of 0.18 µg/mL for mycelial growth and 0.32 µg/mL for spore germination. The EC50 values ranged from 0.13 to 0.29 µg/mL for mycelial growth and from 0.19 to 0.37 µg/mL for spore germination inhibition, with respective variation factors of 2.23 and 1.95. Furthermore, the study carried out by Jurick et al. [10] examined 80 isolates of P. expansum and revealed a mean EC50 value of 0.14 µg/mL for mycelial growth. The EC50 values for mycelial growth ranged between 0.040 and 0.827 µg/mL, with a variation factor of 20.67. From this comparison, it appears that the mean EC50 for mycelial growth in the isolates of our study was higher compared to that of the two referenced studies, which could indicate a reduced effectiveness of Dif against the mycelial growth of the isolates studied. However, the opposite was inferred for spore germination. Additionally, the exceptionally high variation factors may reflect a diversity in the responses of P. expansum isolates to Dif, likely stemming from the variability in sampling over time and space.
The distribution of EC50 values for mycelial growth and spore germination across different intervals further underscored the variability in the sensitivity of P. expansum isolates to Dif. The presence of certain isolates, even at high EC50 concentrations, demonstrated a tolerance of P. expansum to Dif. In this context, a previous study on the sensitivity of P. expansum to tebuconazole, belonging to the same chemical family as Dif (DMI), also reported an extensive distribution of EC50 values across multiple intervals, indicating reduced sensitivity to this fungicide [8]. It is worth noting that five isolates of P. expansum exhibited an effective concentration to inhibit half of the mycelial growth greater than 0.920 µg/mL. Based on a previous study, Dif-resistant P. expansum isolates had an EC50 between 0.92 and 1.4 µg/mL [1]; therefore, five isolates from our study could be Dif-resistant. These isolates of P. expansum resistant to difenoconazole are primarily concentrated in the Meknes region. This situation can be explained by the frequent use of this fungicide for post-harvest treatments of apples in this area, especially after the withdrawal of several active substances such as thiophanate-methyl and carbendazim from the list of authorized plant protection products for controlling post-harvest diseases. This finding is supported by the study conducted by Khadiri et al. [14], which found that the majority of treatments used prior to apple storage in the conservation stations of the Meknes region are based on difenoconazole (commercial product Score). Therefore, the repeated use of the same fungicide contributes to the emergence of resistant strains. Considering that Dif is an active substance belonging to the demethylation inhibitors family, acting by inhibiting a specific enzyme known as 14-α-demethylase, encoded by the fungus’s CYP51 gene. This enzyme is indispensable in the sterol biosynthesis process [11]. The main mechanisms of resistance to DMIs involve mutations in the Cyp51 gene encoding for 14α-demethylase, such as I309T, E297K, I330T, P384S, Glu169, E170, I387 M, L144F, and Y464S [33,34,35,36], or an overexpression of the Cyp51 gene [37]. According to the findings of the study conducted by Ali and Amiri [1], repeated use of Dif may lead to the emergence of resistance in P. expansum. The analysis of the complete sequences of the CYP51 gene, performed on wild and resistant isolates, revealed a mutation in codon 126, where tyrosine was replaced by phenylalanine (Y126F).
Several studies have demonstrated the emergence of resistant strains of P. expansum to other families of fungicides. For instance, Errampalli et al. [38] reported the development of resistance of P. expansum to Thiabendazole, which belongs to the benzimidazole class. Additionally, a study conducted in the State of Washington documented the occurrence of resistance to pyrimethanil (anilinopyrimidines) in P. expansum strains [39]. Similarly, authors have reported resistance to boscalid in the succinate dehydrogenase B (SdhB) subunit of the respiratory complex II of P. expansum [7]. Faced with the challenge of the emergence of resistant strains due to the repeated use of the same active ingredient with a single mode of action, the adoption of fungicides combining active ingredients with diverse modes of action may be effective in controlling P. expansum. Academy, containing Fludioxonil and Dif, serves as a good example illustrating the effectiveness of combining two active ingredients against P. expansum [10].

5. Conclusions

This study represents the first assessment of the sensitivity of P. expansum isolates to difenoconazole (Dif), a demethylation inhibitor (DMI), in Morocco. Our results reveal significant diversity in P. expansum responses to this fungicide. Nearly half of the tested isolates showed reduced sensitivity to Dif, and based on a reference study, five isolates could be considered resistant to this active ingredient. Notably, these resistant isolates are primarily concentrated in the Meknes region, a situation that can be attributed to the frequent use of this fungicide for post-harvest treatments of apples in the area, especially after the withdrawal of several active substances such as thiophanate-methyl and carbendazim from the list of authorized phytosanitary products for combating post-harvest diseases. Consequently, the repeated use of the same fungicide contributes to the emergence of resistant strains. In light of the increasing emergence of resistant pathogenic strains, the use of fungicides that combine multiple active ingredients targeting different sites of fungal action could be an effective solution among other strategies to control this post-harvest apple pathogen. These findings provide a solid foundation for the development of future apple fungal disease management programs during storage. However, in-depth research is needed to molecularly characterize difenoconazole-resistant isolates to better understand their resistance mechanisms to this DMI.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microorganisms12112169/s1, Figure S1. Chemical structure of difenoconazole (A) and thiabendazole (B), [40,41]; Figure S2. Symptomatic apple sampled from the cold storage rooms of storage facilities in Morocco; Table S1. The variance analysis of the fungicide concentration on the inhibition percentage of different isolates.

Author Contributions

Conceptualization, M.K., H.B. and R.L.; methodology, M.K., H.B. and R.L.; software, M.K., S.E., R.E. and M.R.; validation, H.B. and R.L.; formal analysis, M.K. and A.F.; investigation, F.M. and M.K.; resources, R.L.; data curation, M.K., R.L. and H.B.; writing—original draft preparation, M.K., S.E., M.R., R.E. and A.F.; writing—review and editing, F.M., E.A.B., H.B. and R.L.; visualization, H.B. and R.L.; supervision, H.B. and R.L.; project administration, R.L.; funding acquisition, E.A.B. and R.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained within the article.

Acknowledgments

The authors are grateful to ENA-Meknes for providing this study with the necessary facilities and funding.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Ali, E.; Amiri, A. Selection Pressure Pathways and Mechanisms of Resistance to the Demethylation Inhibitor-Difenoconazole in Penicillium expansum. Front. Microbiol. 2018, 9, 2472. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Malandrakis, A.A.; Markoglou, A.N.; Konstantinou, S.; Doukas, E.G.; Kalampokis, J.F.; Karaoglanidis, G.S. Molecular Characterization, Fitness and Mycotoxin Production of Benzimidazole-Resistant Isolates of Penicillium Expansum. Int. J. Food Microbiol. 2013, 162, 237–244. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Luciano-Rosario, D.; Keller, N.P.; Jurick, W.M. Penicillium expansum: Biology, Omics, and Management Tools for a Global Postharvest Pathogen Causing Blue Mould of Pome Fruit. Mol. Plant Pathol. 2020, 21, 1391–1404. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Rosenberger, D.A.; Engle, C.A.; Meyer, F.W.; Watkins, C.B. Penicillium expansum Invades Apples Through Stems During Controlled Atmosphere Storage. Plant Health Prog. 2006, 7, 1. [Google Scholar] [CrossRef] [Scilit]
  5. Yu, L.; Qiao, N.; Zhao, J.; Zhang, H.; Tian, F.; Zhai, Q.; Chen, W. Postharvest Control of Penicillium expansum in Fruits: A Review. Food Biosci. 2020, 36, 100633. [Google Scholar] [CrossRef] [Scilit]
  6. Ritieni, A. Patulin in Italian Commercial Apple Products. J. Agric. Food Chem. 2003, 51, 6086–6090. [Google Scholar] [CrossRef] [Scilit]
  7. Malandrakis, A.A.; Vattis, K.N.; Markoglou, A.N.; Karaoglanidis, G.S. Characterization of Boscalid-Resistance Conferring Mutations in the SdhB Subunit of Respiratory Complex II and Impact on Fitness and Mycotoxin Production in Penicillium Expansum Laboratory Strains. Pestic. Biochem. Physiol. 2017, 138, 97–103. [Google Scholar] [CrossRef] [Scilit]
  8. Karaoglanidis, G.S.; Markoglou, A.N.; Bardas, G.A.; Doukas, E.G.; Konstantinou, S.; Kalampokis, J.F. Sensitivity of Penicillium expansum Field Isolates to Tebuconazole, Iprodione, Fludioxonil and Cyprodinil and Characterization of Fitness Parameters and Patulin Production. Int. J. Food Microbiol. 2011, 145, 195–204. [Google Scholar] [CrossRef] [Scilit]
  9. Li, H.X.; Xiao, C.L. Baseline Sensitivities to Fludioxonil and Pyrimethanil in Penicillium expansum Populations from Apple in Washington State. Postharvest Biol. Technol. 2008, 47, 239–245. [Google Scholar] [CrossRef] [Scilit]
  10. Jurick, W.M.; Macarisin, O.; Gaskins, V.L.; Janisiewicz, W.J.; Peter, K.A.; Cox, K.D. Baseline Sensitivity of Penicillium spp. to Difenoconazole. Plant Dis. 2019, 103, 331–337. [Google Scholar] [CrossRef] [Scilit]
  11. Birr, T.; Hasler, M.; Verreet, J.A.; Klink, H. Temporal Changes in Sensitivity of Zymoseptoria Tritici Field Populations to Different Fungicidal Modes of Action. Agriculture 2021, 11, 269. [Google Scholar] [CrossRef] [Scilit]
  12. Yin, Y.N.; Xiao, C.-L. Molecular Characterization and a Multiplex Allele-Specific PCR Method for Detection of Thiabendazole Resistance in Penicillium expansum from Apple. Eur. J. plant Pathol. 2013, 136, 703–713. [Google Scholar] [CrossRef] [Scilit]
  13. Samaras, A.; Ntasiou, P.; Myresiotis, C.; Karaoglanidis, G. Multidrug Resistance of Penicillium expansum to Fungicides: Whole Transcriptome Analysis of MDR Strains Reveals Overexpression of Efflux Transporter Genes. Int. J. Food Microbiol. 2020, 335, 108896. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Khadiri, M.; Boubaker, H.; Laasli, S.-E.; Farhaoui, A.; Ezrari, S.; Radouane, N.; Radi, M.; Askarne, L.; Barka, E.A.; Lahlali, R. Unlocking Nature’s Secrets: Molecular Insights into Postharvest Pathogens Impacting Moroccan Apples and Innovations in the Assessment of Storage Conditions. Plants 2024, 13, 553. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Konstantinou, S.; Karaoglanidis, G.S.; Bardas, G.A.; Minas, I.S.; Doukas, E.; Markoglou, A.N. Postharvest Fruit Rots of Apple in Greece: Pathogen Incidence and Relationships between Fruit Quality Parameters, Cultivar Susceptibility, and Patulin Production. Plant Dis. 2011, 95, 666–672. [Google Scholar] [CrossRef] [Scilit]
  16. Wenneker, M.; Köhl, J. Postharvest Decay of Apples and Pears in the Netherlands. Acta Hortic. 2014, 1053, 107–112. [Google Scholar] [CrossRef] [Scilit]
  17. Frisvad, J.C.; Samson, R.A. Polyphasic Taxonomy of Penicillium Subgenus Penicillium. A Guide to Identification of Food and Air-Borne Terverticillate Penicillia and Their Mycotoxins. Stud. Mycol. 2004, 49, 1–174. [Google Scholar]
  18. Pitt, J.I. A Laboratory Guide to Common Penicillium Species, 3rd ed.; Commonwealth Scientific and Industrial Research Organization, Division of Food Processing: North Ryde, NSW, Australia, 2000; p. 197. ISBN 9780643048379. [Google Scholar]
  19. Pitt, J.I.; Hocking, A.D. Fungi and Food Spoilage; Springer: New York, NY, USA, 2009; Volume 519. [Google Scholar]
  20. Doyl, J.J.; Doyle, J.L. Isolation of Plant DNA from Fresh Tissue. Focus 1990, 12, 13–15. [Google Scholar]
  21. Tannous, J.; Atoui, A.; El Khoury, A.; Kantar, S.; Chdid, N.; Oswald, I.P.; Puel, O.; Lteif, R. Development of a Real-Time PCR Assay for Penicillium expansum Quantification and Patulin Estimation in Apples. Food Microbiol. 2015, 50, 28–37. [Google Scholar] [CrossRef] [Scilit]
  22. Zhang, J.; Zhang, B.; Zhu, F.; Fu, Y. Baseline Sensitivity and Fungicidal Action of Propiconazole against Penicillium digitatum. Pestic. Biochem. Physiol. 2021, 172, 104752. [Google Scholar] [CrossRef] [Scilit]
  23. Boubaker, H.; Saadi, B.; Boudyach, E.H.; Benaoumar, A.A. Sensitivity of Penicillium digitatum and P. Italicum to Imazalil and Thiabendazole in Morocco. Plant Pathol. J. 2009, 8, 152–158. [Google Scholar] [CrossRef] [Scilit]
  24. El Housni, Z.; Tahiri, A.; Ezrari, S.; Radouane, N.; Ouijja, A. Occurrence of Cercospora beticola Sacc Populations Resistant to Benzimidazole, Demethylation-Inhibiting, and Quinone Outside Inhibitors Fungicides in Morocco. Eur. J. Plant Pathol. 2023, 165, 73–83. [Google Scholar] [CrossRef] [Scilit]
  25. Qin, G.Z.; Tian, S.P.; Xu, Y.; Wan, Y.K. Enhancement of Biocontrol Efficacy of Antagonistic Yeasts by Salicylic Acid in Sweet Cherry Fruit. Physiol. Mol. Plant Pathol. 2003, 62, 147–154. [Google Scholar] [CrossRef] [Scilit]
  26. Cabañas, R.; Abarca, M.L.; Bragulat, M.R.; Cabañes, F.J. In Vitro Activity of Imazalil against Penicillium expansum: Comparison of the CLSI M38-A Broth Microdilution Method with Traditional Techniques. Int. J. Food Microbiol. 2009, 129, 26–29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Khadiri, M.; Boubaker, H.; Askarne, L.; Ezrari, S.; Radouane, N.; Farhaoui, A.; El Hamss, H.; Tahiri, A.; Barka, E.A.; Lahlali, R. Bacillus cereus B8W8 an Effective Bacterial Antagonist against Major Postharvest Fungal Pathogens of Fruit. Postharvest Biol. Technol. 2023, 200, 112315. [Google Scholar] [CrossRef] [Scilit]
  28. Fonseka, D.L.; Gudmestad, N.C. Spatial and Temporal Sensitivity of Alternaria Species Associated with Potato Foliar Diseases to Demethylation Inhibiting and Anilino-Pyrimidine Fungicides. Plant Dis. 2016, 100, 1848–1857. [Google Scholar] [CrossRef] [Scilit]
  29. Cao, X.; Xu, X.; Che, H.; West, J.S.; Luo, D. Distribution and Fungicide Sensitivity of Colletotrichum Species Complexes from Rubber Tree in Hainan, China. Plant Dis. 2017, 101, 1774–1780. [Google Scholar] [CrossRef] [Scilit]
  30. Ivic, D. Curative and Eradicative Effects of Fungicides. In Fungicides; IntechOpen: Londen, UK, 2010; pp. 3–22. [Google Scholar]
  31. Darolt, J.C.; da Rocha Neto, A.C.; Di Piero, R.M. Effects of the Protective, Curative, and Eradicative Applications of Chitosan against Penicillium expansum in Apples. Braz. J. Microbiol. 2016, 47, 1014–1019. [Google Scholar] [CrossRef] [Scilit]
  32. Song, Y.; Li, L.; Li, C.; Lu, Z.; Men, X.; Chen, F. Evaluating the Sensitivity and Efficacy of Fungicides with Different Modes of Action against Botryosphaeria dothidea. Plant Dis. 2018, 102, 1785–1793. [Google Scholar] [CrossRef] [Scilit]
  33. Nikou, D.; Malandrakis, A.; Konstantakaki, M.; Vontas, J.; Markoglou, A.; Ziogas, B. Molecular Characterization and Detection of Overexpressed C-14 Alpha-Demethylase-Based DMI Resistance in Cercospora beticola Field Isolates. Pestic. Biochem. Physiol. 2009, 95, 18–27. [Google Scholar] [CrossRef] [Scilit]
  34. Kumar, R.; Mazakova, J.; Ali, A.; Sur, V.P.; Sen, M.K.; Bolton, M.D.; Manasova, M.; Rysanek, P.; Zouhar, M. Characterization of the Molecular Mechanisms of Resistance against DMI Fungicides in Cercospora beticola Populations from the Czech Republic. J. Fungi 2021, 7, 1062. [Google Scholar] [CrossRef] [Scilit]
  35. Muellender, M.M.; Mahlein, A.; Stammler, G.; Varrelmann, M. Evidence for the Association of Target-site Resistance in Cyp51 with Reduced DMI Sensitivity in European Cercospora beticola Field Isolates. Pest Manag. Sci. 2021, 77, 1765–1774. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Spanner, R.; Taliadoros, D.; Richards, J.; Rivera-Varas, V.; Neubauer, J.; Natwick, M.; Hamilton, O.; Vaghefi, N.; Pethybridge, S.; Secor, G.A. Genome-Wide Association and Selective Sweep Studies Reveal the Complex Genetic Architecture of DMI Fungicide Resistance in Cercospora Beticola. Genome Biol. Evol. 2021, 13, evab209. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Schnabel, G.; Jones, A.L. The 14α-Demethylasse (CYP51A1) Gene Is Overexpressed in Venturia inaequalis Strains Resistant to Myclobutanil. Phytopathology 2001, 91, 102–110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Errampalli, D.; Brubacher, N.R.; DeEll, J.R. Sensitivity of Penicillium expansum to Diphenylamine and Thiabendazole and Postharvest Control of Blue Mold with Fludioxonil in “McIntosh” Apples. Postharvest Biol. Technol. 2006, 39, 101–107. [Google Scholar] [CrossRef] [Scilit]
  39. Caiazzo, R.; Kim, Y.K.; Xiao, C.L. Occurrence and Phenotypes of Pyrimethanil Resistance in Penicillium Expansum from Apple in Washington State. Plant Dis. 2014, 98, 924–928. [Google Scholar] [CrossRef] [Scilit]
  40. Rocchi, S.; Morin-Crini, N.; Léchenault-Bergerot, C.; Godeau, C.; Fourmentin, M.; Millon, L.; Crini, G. Effet de l’interaction Cyclodextrine-Difénoconazole Sur La Croissance d’une Moisissure Responsable d’infections Fongiques Graves. Environ. Risques Santé 2019, 18, 411–417. [Google Scholar]
  41. Soro, D.B.; Kouadio, D.L.; Aboua, K.N.; Diarra, M.; Meite, L.; Traore, K.S. Dégradation Photocatalytique Du Thiabendazole En Solution Aqueuse. Afr. Sci. 2018, 14, 55–63. [Google Scholar]
Figure 1. Sampling areas in the Fes-Meknes and Draa-Tafilalet regions of Morocco. This map was generated using ArcGIS Pro version 2.6. The black crosses indicate the locations of P. expansum isolates resistant to difenoconazole.
Figure 1. Sampling areas in the Fes-Meknes and Draa-Tafilalet regions of Morocco. This map was generated using ArcGIS Pro version 2.6. The black crosses indicate the locations of P. expansum isolates resistant to difenoconazole.
Microorganisms 12 02169 g001
Figure 2. Agarose gel electrophoresis profiles (1.5%) showing PCR-amplified products with P. expansum-specific primers; patF-F and patF-R of the patF gene. Lane M: GeneRuler 100 bp DNA Ladder (Thermo Scientific). Lane C-: negative control. Lane C+ (Aby4): positive control with the Aby4 strain of P. expensum identified through molecular sequencing of the internal transcribed spacer (ITS) region of rDNA (accession number: OR426630).
Figure 2. Agarose gel electrophoresis profiles (1.5%) showing PCR-amplified products with P. expansum-specific primers; patF-F and patF-R of the patF gene. Lane M: GeneRuler 100 bp DNA Ladder (Thermo Scientific). Lane C-: negative control. Lane C+ (Aby4): positive control with the Aby4 strain of P. expensum identified through molecular sequencing of the internal transcribed spacer (ITS) region of rDNA (accession number: OR426630).
Microorganisms 12 02169 g002
Figure 3. Effect of different difenoconazole concentrations on Mycelial Growth of P. expansum.
Figure 3. Effect of different difenoconazole concentrations on Mycelial Growth of P. expansum.
Microorganisms 12 02169 g003
Figure 4. Distribution of EC50 values for mycelial growth and spore germination of 100 isolates of P. expansum.
Figure 4. Distribution of EC50 values for mycelial growth and spore germination of 100 isolates of P. expansum.
Microorganisms 12 02169 g004
Table 1. Data from P. expansum isolates tested for their sensitivity to difenoconazole.
Table 1. Data from P. expansum isolates tested for their sensitivity to difenoconazole.
IsolateYearCultivar or SourceGPS Coordinates of Storage StationsPAD
IT22020SDN 33°58′8.54976″; W 5°15′48.798″Meknes
IT32020GDN 33°58′8.54976″; W 5°15′48.798″Meknes
IT42020GDN 33°58′8.54976″; W 5°15′48.798″Meknes
IT52020GDN 33°58′8.54976″; W 5°15′48.798″Meknes
IT92020GDN 33°58′8.54976″; W 5°15′48.798″Meknes
IT102020GDN 33°58′8.54976″; W 5°15′48.798″Meknes
T5a2020GDN 33°22′29.50392″; W 5°22′38.24184″Ifrane
T102020GDN 33°22′29.50392″; W 5°22′38.24184″Ifrane
T12b2020GDN 33°22′29.50392″; W 5°22′38.24184″Ifrane
M7a2020FN 33°24′52.4106″; W 5°17′40.58628″Ifrane
M112020SDN 33°24′52.4106″; W 5°17′40.58628″Ifrane
MA22020GDN 33°25′31.72944″; W 5°14′37.7826″Ifrane
MA52020SDN 33°25′31.72944″; W 5°14′37.7826″Ifrane
MA62020SDN 33°25′31.72944″; W 5°14′37.7826″Ifrane
A112020SDN 33°25′31.72944″; W 5°14′37.7826″Ifrane
S22020GDN 33°21′49.25448″; W 5°22′5.33568″Ifrane
S32020GDN 33°21′49.25448″; W 5°22′5.33568″Ifrane
S52020FN 33°21′49.25448″; W 5°22′5.33568″Ifrane
BNS22020GDN 33°53′54.5208″; W 5°26′47.76864″Meknes
FMB82020GDN 33°41′10.21704″; W 5°30′7.88904″El Hajeb
Bs22020GDN 33°49′37.4″; W 5°28′2.9″Meknes
Bs32020GDN 33°49′37.4″; W 5°28′2.9″Meknes
Bs(AS3)2020CRAN 33°49′37.4″; W 5°28′2.9″Meknes
Bs(AS7)2020CRAN 33°49′37.4″; W 5°28′2.9″Meknes
V52021GDN 33°45′35.1″; W 5°19′37.1″El Hajeb
V6b2021GDN 33°45′35.1″; W 5°19′37.1″El Hajeb
V72021GDN 33°45′35.1″; W 5°19′37.1″El Hajeb
V102021GDN 33°45′35.1″; W 5°19′37.1″El Hajeb
Tg102021GDN 33°46′16.41″; W 5°20′42.0972″El Hajeb
Tg112021GDN 33°46′16.41″; W 5°20′42.0972″El Hajeb
Ag32021GDN 33°49′46.5456″; W 4°59′7.5876″Sefrou
Ag62021GDN 33°49′46.5456″; W 4°59′7.5876″Sefrou
Ag82021GDN 33°49′46.5456″; W 4°59′7.5876″Sefrou
AO12021GDN 33°45′50.3568″; W 5°0′53.5644″Sefrou
AO32021GDN 33°45′50.3568″; W 5°0′53.5644″Sefrou
AO62021GDN 33°45′50.3568″; W 5°0′53.5644″Sefrou
At12021GDN 33°46′28.4844″; W 5°1′20.3916″Sefrou
At22021GDN 33°46′28.4844″; W 5°1′20.3916″Sefrou
At32021GDN 33°46′28.4844″; W 5°1′20.3916″Sefrou
CH22021SDN 33°42′42.588″; W 5°2′29.6484″Sefrou
CH42021GDN 33°42′42.588″; W 5°2′29.6484″Sefrou
Tl12021GDN 32°49′3.4032″; W 4°57′34.9056″Midelt
Tl22021GDN 32°49′3.4032″; W 4°57′34.9056″Midelt
Tl32021GDN 32°49′3.4032″; W 4°57′34.9056″Midelt
Tl42021GDN 32°49′3.4032″; W 4°57′34.9056″Midelt
Tl52021GDN 32°49′3.4032″; W 4°57′34.9056″Midelt
Tl62021GDN 32°49′3.4032″; W 4°57′34.9056″Midelt
TM12021GDN 32°59′49.1496″; W 4°52′24.3228″Midelt
TM42021DGN 32°59′49.1496″; W 4°52′24.3228″Midelt
TM62021GDN 32°59′49.1496″; W 4°52′24.3228″Midelt
TM72021GDN 32°59′49.1496″; W 4°52′24.3228″Midelt
Aby42021GDN 32°45′2.2896″; W 5°1′45.1776″Midelt
Ml42021GDN 32°44′56.5944″; W 5°1′45.3864″Midelt
HM12021GDN 32°54′7.4664″; W 4°58′12.5256″Midelt
HM3a2021GDN 32°54′7.4664″; W 4°58′12.5256″Midelt
AH12021GDN 32°46′3.4356″; W 5°0′8.136″Midelt
AH22021GDN 32°46′3.4356″; W 5°0′8.136″Midelt
AH32021GDN 32°46′3.4356″; W 5°0′8.136″Midelt
AH42021GDN 32°46′3.4356″; W 5°0′8.136″Midelt
BK32021GDN 32°46′12.5688″; W 4°59′56.4684″Midelt
BK52021FN 32°46′12.5688″; W 4°59′56.4684″Midelt
BK72021GDN 32°46′12.5688″; W 4°59′56.4684″Midelt
ASL12021GDN 32°43′16.4028″; W 5°3′13.3488″Midelt
ASL42021GDN 32°43′16.4028″; W 5°3′13.3488″Midelt
ASL62021GDN 32°43′16.4028″; W 5°3′13.3488″Midelt
DA22021DGN 32°40′27.5052″; W 5°15′30.9204″Midelt
DA32021GDN 32°40′27.5052″; W 5°15′30.9204″Midelt
DA52021GDN 32°40′27.5052″; W 5°15′30.9204″Midelt
DA72021GDN 32°40′27.5052″; W 5°15′30.9204″Midelt
DA82021FN 32°40′27.5052″; W 5°15′30.9204″Midelt
PR22021SDN 33°47′43.5336″; W 5°29′41.226″Meknes
DN22021SDN 33°44′28.5324″; W 5°28′21.0756″Meknes
DN32021FN 33°44′28.5324″; W 5°28′21.0756″Meknes
DN92021SDN 33°44′28.5324″; W 5°28′21.0756″Meknes
DN102021GDN 33°44′28.5324″; W 5°28′21.0756″Meknes
AML82021GDN 33°48′28.6812″; W 5°22′35.2884″El Hajeb
OS142021GDN 33°55′35.526″; W 4°54′1.9584″Sefrou
OS152021DGN 33°55′35.526″; W 4°54′1.9584″Sefrou
CB12021GDN 33°51′36.2484″; W 4°29′56.94″Sefrou
ZA12021GDN 33°49′9.39″; W 4°45′58.9068″Sefrou
ZA22021GDN 33°49′9.39″; W 4°45′58.9068″Sefrou
ZA32021GDN 33°49′9.39″; W 4°45′58.9068″Sefrou
DKS2b2022SDN 33°49′39.2592″; W 5°31′8.1372″Meknes
AM22022GDN 33°45′49.4352″; W 5°20′15.2448″El Hajeb
LM12022GDN 33°46′38.1036″; W 5°22′54.2928″El Hajeb
FN12022GDN 33°58′4.116″; W 5°14′15.8928″Meknes
FN82022GDN 33°58′4.116″; W 5°14′15.8928″Meknes
MY82022GDN 33°59′36.8088″; W 5°12′2.4948″Meknes
MY102022SDN 33°59′36.8088″; W 5°12′2.4948″Meknes
BNS32022SDN 33°53′54.5208″; W 5°26′47.76864″Meknes
BNS42022GDN 33°53′54.5208″; W 5°26′47.76864″Meknes
BNS52022SDN 33°53′54.5208″; W 5°26′47.76864″Meknes
BNS82022SDN 33°53′54.5208″; W 5°26′47.76864″Meknes
BNS252022GDN 33°53′54.5208″; W 5°26′47.76864″Meknes
BNS322022GDN 33°53′54.5208″; W 5°26′47.76864″Meknes
AML132022GDN 33°48′28.6812″; W 5°22′35.2884″El Hajeb
AML172022GDN 33°48′28.6812″; W 5°22′35.2884″El Hajeb
AML182022GDN 33°48′28.6812″; W 5°22′35.2884″El Hajeb
AML25b2022GDN 33°48′28.6812″; W 5°22′35.2884″El Hajeb
TG32022GDN 33°46′16.41″; W 5°20′42.0972″El Hajeb
Cultivars: SD: “Starking Delicious”; GD: “Golden Delicious”; F: “Fuji”; DG: “Dorsett Golden”. CRA: Cold Room Atmosphere. PAD: Provincial Agriculture Directorate.
Table 2. Percentage of Inhibition (PI, %) and Effective Concentration (EC50) of Difenoconazole for 50% Inhibition of Mycelial Growth (MG) and Spore Germination (SG) in 100 P. expansum Isolates.
Table 2. Percentage of Inhibition (PI, %) and Effective Concentration (EC50) of Difenoconazole for 50% Inhibition of Mycelial Growth (MG) and Spore Germination (SG) in 100 P. expansum Isolates.
IsolatePADPI (MG) PI (SG)EC50 (MG)
µg/mL
EC50 (SG)
µg/mL
0.01 µg/mL0.5 µg/mL 1 µg/mL5 µg/mL 0.01 µg/mL0.5 µg/mL 1 µg/mL5 µg/mL
IT2Meknes18.2559.1069.9610033.961001001000.1580.027
IT3Meknes19.5363.2368.8110050.9395.061001000.1430.009
IT4Meknes21.1862.5271.9410047.9586.301001000.1300.013
IT5Meknes20.9958.5769.8310042.8195.891001000.1450.017
IT9Meknes16.8760.2167.1778.35 49.3195.141001000.2080.011
IT10Meknes20.2965.2968.7281.71 23.5140.7388.081000.1550.076
T5aIfrane9.8952.4460.1110045.4582.211001000.2620.017
T10Ifrane19.6368.1277.4510057.2593.891001000.1140.005
T12bIfrane10.4767.9778.2283.52 33.3394.101001000.1780.030
M7aIfrane18.7949.8556.6778.2932.2154.7074.8391.950.8950.095
M11Ifrane31.9444.6649.6572.86 51.8272.1279.091001.4420.011
MA2Ifrane12.7363.7573.2910035.7678.791001000.1670.033
MA5Ifrane12.1060.5668.8883.20 38.6496.271001000.2230.022
MA6Ifrane18.9058.6165.9879.43 40.401001001000.2000.019
MA11Ifrane11.6560.6968.3882.96 58.6296.261001000.2280.004
S2Ifrane14.0970.5673.8810056.8994.701001000.1410.005
S3Ifrane6.2162.9269.3010053.5795.711001000.2170.007
S5Ifrane10.9754.5164.2675.48 43.6696.831001000.3010.016
BNS2Meknes15.0962.6769.6710022.2281.2588.891000.1660.068
FMB8El Hajeb14.0557.2565.3982.22 50.0095.331001000.2380.010
Bs2Meknes9.7162.9667.2510061.7295.701001000.2020.003
Bs3Meknes13.5040.3851.3079.25 43.9496.211001000.8940.016
Bs(AS3)Meknes16.5237.9749.7971.50 63.7595.831001000.9940.002
Bs(AS7)Meknes11.0840.3047.1769.94 60.6396.561001001.6730.003
V5El Hajeb18.2668.2773.7310064.5295.561001000.1270.002
V6bEl Hajeb8.2662.2370.6810069.3294.891001000.2040.0006
V7El Hajeb26.1063.1070.6583.62 58.8775.8182.661000.1210.004
V10El Hajeb19.0569.8381.0610056.0690.911001000.1070.006
Tg10El Hajeb8.8265.6272.5410044.7494.411001000.1850.015
Tg11El Hajeb4.5054.8963.5910017.6594.491001000.2770.056
Ag3Sefrou8.5359.0566.1010080.9298.031001000.2260.013
Ag6Sefrou9.2473.4279.1910027.2796.591001000.1470.038
Ag8Sefrou4.4964.9073.1610053.8592.311001000.2100.007
AO1Sefrou3.9068.4274.46100 30.7796.631001000.1980.033
AO3Sefrou4.8258.6168.2784.41 40.0095.631001000.2830.021
AO6Sefrou13.8759.8666.0977.21 68.4273.6894.411000.2380.0002
At1Sefrou10.3976.3181.0688.07 18.2792.3197.601000.1430.058
At2Sefrou26.7281.7186.4310061.671001001000.0540.003
At3Sefrou16.6180.6184.611007.1494.201001000.0920.075
CH2Sefrou20.0672.9178.6284.0928.5796.431001000.1110.036
CH4Sefrou12.7968.7675.5483.83 16.5287.5092.861000.1690.069
Tl1Midelt10.5550.4763.1410026.6780.0093.331000.4980.054
Tl2Midelt18.4568.2872.8779.50 22.2940.2958.5795.430.1490.712
Tl3Midelt16.5370.8575.0310045.0086.671001000.1260.017
Tl4Midelt10.0755.8564.0210057.5083.3390.0094.170.2340.003
Tl5Midelt11.1467.7272.3110055.0076.6793.331000.1670.005
Tl6Midelt10.5855.1761.2710058.1872.2792.731000.2430.003
TM1Midelt4.4869.0173.5882.98 23.2169.6491.961000.2270.076
TM4Midelt2.7067.0373.9383.96 57.1482.1492.861000.2420.003
TM6Midelt3.0172.7677.2010055.4293.331001000.1840.004
TM7Midelt5.6757.4564.5682.73 24.0477.8892.791000.3020.063
Aby4Midelt10.3046.9572.3410031.5894.741001000.5200.057
Ml4Midelt6.3666.9881.3110017.6566.9196.691000.1730.095
HM1Midelt10.4540.8774.0010016.6788.8994.441000.5630.077
HM3aMidelt9.2851.6069.621006.6786.6796.251000.3580.088
AH1Midelt10.9077.0283.3710056.251001001000.1240.004
AH2Midelt4.4974.3481.2110029.0396.771001000.1630.035
AH3Midelt5.9773.3278.95100 48.9669.4483.331000.1640.012
AH4Midelt6.4870.5976.3610032.4185.8694.481000.1740.036
BK3Midelt10.1563.6570.6685.80 38.4693.751001000.2070.023
BK5Midelt9.9664.5172.6710018.7569.6476.791000.1780.116
BK7Midelt10.4363.3974.2182.72 58.3396.351001000.2160.004
ASL1Midelt11.6676.3980.0210035.7179.9387.071000.1280.033
ASL4Midelt11.1175.8079.2310018.5292.131001000.1330.056
ASL6Midelt9.5779.5483.3410038.4669.2394.231000.1240.033
DA2Midelt20.9963.2267.9885.96 50.9695.671001000.1530.009
DA3Midelt6.6762.7371.3881.70 23.5398.901001000.2470.043
DA5Midelt8.8862.0269.7184.03 36.9699.011001000.2350.024
DA7Midelt13.8526.7359.9482.84 47.5066.6793.331000.9710.011
DA8Midelt3.7060.0970.6685.32 47.0693.751001000.2720.013
PR2Meknes19.2268.9574.871006.6797.081001000.1190.074
DN2Meknes15.5966.6271.1381.36 40.2378.4391.251000.1750.025
DN3Meknes19.0563.2869.5079.36 25.5085.9193.6296.640.1710.059
DN9Meknes2.4226.1338.6871.8215.3833.1761.541001.5820.787
DN10Meknes9.5465.2877.4910013.3992.861001000.1700.065
AML8El Hajeb20.9469.2876.5110073.3396.251001000.1080.0002
OS14Sefrou15.8774.8380.6886.51 7.2555.0778.261000.1210.168
OS15Sefrou9.9550.6763.1174.68 25.0068.7590.631000.4950.073
CB1Sefrou9.1782.0986.1810055.1584.191001000.1160.004
ZA1Sefrou15.2710010010036.0894.941001000.0500.026
ZA2Sefrou10.8768.3074.9686.06 26.6760.0075.8385.000.1800.116
ZA3Sefrou12.3335.6773.8910048.5777.1482.8688.570.6840.012
DKS2bMeknes20.4368.5174.8810054.2390.911001000.1140.007
AM2El Hajeb13.8065.3476.0610051.9889.8396.891000.1510.008
LM1El Hajeb42.9571.7581.0410049.8290.8896.491000.0270.010
FN1Meknes11.4866.9269.0280.64 39.9477.6797.481000.2070.029
FN8Meknes13.9975.8979.2886.35 22.4971.0193.201000.1310.076
MY8Meknes14.7361.1467.6082.96 25.4263.0588.141000.2070.102
MY10Meknes15.2375.7378.7484.14 23.3681.5894.411000.1280.057
BNS3Meknes18.4564.3372.4884.3131.8287.341001000.1560.037
BNS4Meknes24.4961.9769.3983.02 43.7392.281001000.1390.017
BNS5Meknes22.0371.4381.0010050.3282.2893.6795.890.0920.010
BNS8Meknes19.2069.0377.2285.45 21.8275.5784.041000.1270.081
BNS25Meknes18.0264.6572.3377.06 18.6993.7797.381000.1700.056
BNS32Meknes14.7465.6773.7582.03 37.1796.171001000.1770.024
AML13El Hajeb27.0460.2370.6710026.0282.4595.3097.810.1100.062
AML17El Hajeb19.4562.9677.4382.36 23.0590.911001000.1470.049
AML18El Hajeb23.2272.1981.4610019.7585.031001000.0870.059
AML25bEl Hajeb19.0063.9274.5810044.0576.7988.9995.830.1320.018
TG3El Hajeb10.8169.9279.1710044.4191.7896.381000.1480.016
PAD: Provincial Agriculture Directorate. Each value represents the average of four replicates. The concentration of 10 µg/mL of difenoconazole completely inhibited (PI = 100%) mycelial growth and spore germination of all P. expansum isolates.
Table 3. Analysis of the effective concentration of difenoconazole required to inhibit 50% of mycelial growth and spore germination (EC50) for all P. expansum isolates (n = 100), compared to a previous study.
Table 3. Analysis of the effective concentration of difenoconazole required to inhibit 50% of mycelial growth and spore germination (EC50) for all P. expansum isolates (n = 100), compared to a previous study.
EC50 (µg/mL)Mycelial GrowthSpore GerminationReference
Mean0.2630.048This study
Min0.0270.0002
Max1.6730.787
VF *62.5074113.835
Mean0.180.32[1]
Min0.130.19
Max0.290.37
VF *2.231.95
* VF: Variation factor.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Khadiri, M.; Boubaker, H.; Farhaoui, A.; Ezrari, S.; Radi, M.; Ezzouggari, R.; Mokrini, F.; Barka, E.A.; Lahlali, R. In Vitro Assessment of Penicillium expansum Sensitivity to Difenoconazole. Microorganisms 2024, 12, 2169. https://doi.org/10.3390/microorganisms12112169

AMA Style

Khadiri M, Boubaker H, Farhaoui A, Ezrari S, Radi M, Ezzouggari R, Mokrini F, Barka EA, Lahlali R. In Vitro Assessment of Penicillium expansum Sensitivity to Difenoconazole. Microorganisms. 2024; 12(11):2169. https://doi.org/10.3390/microorganisms12112169

Chicago/Turabian Style

Khadiri, Mohammed, Hassan Boubaker, Abdelaaziz Farhaoui, Said Ezrari, Mohammed Radi, Rachid Ezzouggari, Fouad Mokrini, Essaid Ait Barka, and Rachid Lahlali. 2024. "In Vitro Assessment of Penicillium expansum Sensitivity to Difenoconazole" Microorganisms 12, no. 11: 2169. https://doi.org/10.3390/microorganisms12112169

APA Style

Khadiri, M., Boubaker, H., Farhaoui, A., Ezrari, S., Radi, M., Ezzouggari, R., Mokrini, F., Barka, E. A., & Lahlali, R. (2024). In Vitro Assessment of Penicillium expansum Sensitivity to Difenoconazole. Microorganisms, 12(11), 2169. https://doi.org/10.3390/microorganisms12112169

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop