Detection of Plasmid-Mediated Resistance against Colistin in Multi-Drug-Resistant Gram-Negative Bacilli Isolated from a Tertiary Hospital
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains, Culture, Identification, and Microbial Susceptibility Testing
2.2. PCR Amplification
2.3. Conjugation Experiments
2.4. S1-Pulsed-Field Gel Electrophoresis (PFGE) and Southern Blot Analysis
3. Results
3.1. Colistin Resistance
3.2. mcr Prevalence
3.3. Conjugation Experiments
3.4. Southern Blot Analysis
4. Discussion
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Nagvekar, V.; Sawant, S.; Amey, S. Prevalence of multidrug-resistant Gram-negative bacteria cases at admission in a multispeciality hospital. J. Glob. Antimicrob. Resist. 2020, 22, 457–461. [Google Scholar] [CrossRef]
- Olaitan, A.O.; Morand, S.; Rolain, J.M. Mechanisms of polymyxin resistance: Acquired and intrinsic resistance in bacteria. Front. Microbiol. 2014, 5, 643. [Google Scholar] [CrossRef] [PubMed]
- Andrade, F.F.; Silva, D.; Rodrigues, A.; Pina-Vaz, C. Colistin Update on Its Mechanism of Action and Resistance, Present and Future Challenges. Microorganisms 2020, 8, 1716. [Google Scholar] [CrossRef] [PubMed]
- Monaco, M.; Giani, T.; Raffone, M.; Arena, F.; García-Fernández, A.; Pollini, S. Colistin resistance superimposed to endemic carbapenem-resistant Klebsiella pneumoniae: A rapidly evolving problem in Italy, November 2013 to April 2014. Euro. Surveill. 2014, 19, 20939. [Google Scholar] [CrossRef] [PubMed]
- Pena, I.; Picazo, J.J.; Rodríguez-Avial, C.; Rodríguez-Avial, I. Carbapenemase-producing Enterobacteriaceae in a tertiary hospital in Madrid, Spain: High percentage of colistin resistance among VIM-1-producing Klebsiella pneumoniae ST11 isolates. Int. J. Antimicrob. Agents 2014, 43, 460–464. [Google Scholar] [CrossRef] [PubMed]
- Meletis, G.; Oustas, E.; Botziori, C.; Kakasi, E.; Koteli, A. Containment of carbapenem resistance rates of Klebsiella pneumoniae and Acinetobacter baumannii in a Greek hospital with a concomitant increase in colistin, gentamicin and tigecycline resistance. New Microbiol. 2015, 38, 417–421. [Google Scholar]
- Binsker, U.; Käsbohrer, A.; Hammerl, J.A. Global colistin use: A review of the emergence of resistant Enterobacterales and the impact on their genetic basis. FEMS Microbiol. Rev. 2022, 46, fuab049. [Google Scholar] [CrossRef]
- Liu, Y.-Y.; Wang, Y.; Walsh, T.R.; Yi, L.-X.; Zhang, R.; Spencer, J.; Doi, Y.; Tian, G.; Dong, B.; Huang, X.; et al. Emergence of plasmid-mediated colistin resistance mechanism mcr-1 in animals and human beings in China: A microbiological and molecular biological study. Lancet Infect. Dis. 2016, 16, 161–168. [Google Scholar] [CrossRef]
- Baron, S.; Hadjadj, L.; Rolain, J.M.; Olaitan, A.O. Molecular mechanisms of polymyxin resistance: Knowns and unknowns. Int. J. Antimicrob. Agents. 2016, 48, 583–591. [Google Scholar] [CrossRef]
- Ejaz, H.; Younas, S.; Qamar, M.U.; Junaid, K.; Abdalla, A.E.; Abosalif, K.O.A.; Alameen, A.A.M.; Elamir, M.Y.M.; Ahmad, N.; Hamam, S.S.M.; et al. Molecular Epidemiology of Extensively Drug-Resistant mcr Encoded Colistin-Resistant Bacterial Strains Co-Expressing Multifarious β-Lactamases. Antibiotics 2021, 10, 467. [Google Scholar] [CrossRef]
- Hameed, F.; Khan, M.A.; Muhammad, H.; Sarwar, T.; Bilal, H.; Rehman, T.U. Plasmid-mediated mcr-1 gene in Acinetobacter baumannii and Pseudomonas aeruginosa: First report from Pakistan. Rev. Soc. Bras. Med. Trop. 2019, 52, e20190237. [Google Scholar] [CrossRef] [PubMed]
- Peirano, G.; Pitout, J.D. Molecular epidemiology of Escherichia coli producing CTX-M beta-lactamases: The worldwide emergence of clone ST131 O25:H4. Int. J. Antimicrob. Agents. 2010, 35, 316–321. [Google Scholar] [CrossRef]
- Nicolas, M.H.; Bertrand, X.; Madec, J.Y. Escherichia coli ST131, an intriguing clonal group. Clin. Microbiol. Rev. 2014, 27, 543–574. [Google Scholar] [CrossRef] [PubMed]
- Lopes, R.; Furlan, J.P.R.; Dos Santos, L.D.R.; Gallo, I.F.L.; Stehling, E.G. Colistin-Resistant mcr-1-Positive Escherichia coli ST131-H22 Carrying blaCTX-M-15 and qnrB19 in Agricultural Soil. Front. Microbiol. 2021, 12, 659900. [Google Scholar] [CrossRef]
- De la Tabla, V.O.; Ortega, A.; Buñuel, F.; Pérez-Vázquez, M.; Marcos, B.; Oteo, J. Detection of the high-risk clone ST131 of Escherichia coli carrying the colistin resistance gene mcr-1 and causing acute peritonitis. Int. J. Antimicrob. Agents. 2017, 49, 115–116. [Google Scholar] [CrossRef]
- World Health Organization. Global Action Plan on Antimicrobial Resistance; WHO: Geneva, Switzerland, 2016; p. 45. [Google Scholar]
- Clinical and Laboratory Standards Institute. M100 Performance Standards for Antimicrobial Susceptibility Testing, 33rd ed.; CLSI: Wayne, PA, USA, 2023; p. 402. [Google Scholar]
- Magiorakos, A.-P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [PubMed]
- Simner, P.J.; Bergman, Y.; Trejo, M.; Roberts, A.A.; Marayan, R.; Tekle, T.; Campeau, S.; Kazmi, A.Q.; Bell, D.T.; Lewis, S.; et al. Two-Site Evaluation of the Colistin Broth Disk Elution Test To Determine Colistin In Vitro Activity against Gram-Negative Bacilli. J. Clin Microbiol. 2019, 57, e01163-18. [Google Scholar] [CrossRef]
- BLAST Sequence Analysis Tool. National Center for Biotechnology Information. 2013. Available online: https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 17 February 2023).
- Rebelo, A.R.; Bortolaia, V.; Kjeldgaard, J.S.; Pedersen, S.K.; Leekitcharoenphon, P.; Hansen, I.M.; Guerra, B.; Malorny, B.; Borowiak, M.; Hammerl, J.A.; et al. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. Eurosurveillance 2018, 23, 17-00672. [Google Scholar] [CrossRef]
- Borowiak, M.; Fischer, J.; Hammerl, A.J.; Hendriksen, R.S.; Szabo, I.; Malorny, B. Identification of a novel transposon-associated phosphoethanolamine transferase gene, mcr-5, conferring colistin resistance in d-tartrate fermenting Salmonella enterica subsp. enterica serovar Paratyphi, B. J. Antimicrob. Chemother. 2017, 72, 3317–3324. [Google Scholar] [CrossRef]
- Clermont, O.; Dhanji, H.; Upton, M.; Gibreel, T.; Fox, A.; Boyd, D.; Mulvey, M.R.; Nordmann, P.; Ruppé, E.; Sarthou, J.L.; et al. Rapid detection of the O25b-ST131 clone of Escherichia coli encompassing the CTX-M-15-producing strains. J. Antimicrob. Chemother. 2009, 64, 274–277. [Google Scholar] [CrossRef]
- Edelstein, M.; Pimkin, M.; Palagin, I.; Edelstein, I.; Stratchounski, L. Prevalence and molecular epidemiology of CTX-M extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae in Russian hospitals. Antimicrob. Agents Chemother. 2003, 47, 3724–3732. [Google Scholar] [CrossRef] [PubMed]
- Garza-Ramos, U.; Tamayo-Legorreta, E.; Arellano-Quintanilla, D.M.; Rodriguez-Medina, N.; Silva-Sanchez, J.; Catalan-Najera, J.; Rocha-Martínez, M.K.; Bravo-Díaz, M.A.; Alpuche-Aranda, C. Draft Genome Sequence of a Multidrug- and Colistin-Resistant mcr-1-Producing Escherichia coli Isolate from a Swine Farm in Mexico. Genome Announc. 2018, 6, e00102-18. [Google Scholar] [CrossRef] [PubMed]
- Gogry, F.A.; Siddiqui, M.T.; Sultan, I.; Haq, Q.M.R. Current Update on Intrinsic and Acquired Colistin Resistance Mechanisms in Bacteria. Front. Med. 2021, 8, 677720. [Google Scholar] [CrossRef] [PubMed]
- Zafer, M.M.; El-Mahallawy, H.A.; Abdulhak, A.; Amin, M.A.; Al-Agamy, M.H.; Radwan, H.H. Emergence of colistin resistance in multi-drug resistant Klebisella pneumoniae and Escherichia coli strains isolated from cancer patients. Ann. Clin. Microbiol. Antimicrobiano. 2019, 18, 40. [Google Scholar] [CrossRef]
- Saavedra, S.Y.; Diaz, L.; Wiesner, M.; Correa, A.; Arévalo, S.A.; Reyes, J.; Hidalgo, A.M.; de la Cadena, E.; Perenguez, M.; Montaño, L.A.; et al. Genomic and Molecular Characterization of Clinical Isolates of Enterobacteriaceae Harboring mcr-1 in Colombia, 2002 to 2016. Antimicrob. Agents Chemother. 2017, 61, e00841-17. [Google Scholar] [CrossRef]
- Dadashi, M.; Sameni, F.; Bostanshirin, N.; Yaslianifard, S.; Khosravi-Dehaghi, N.; Nasiri, M.J.; Goudarzi, M.; Hashemi, A.; Hajikhani, B. Global prevalence and molecular epidemiology of mcr-mediated colistin resistance in Escherichia coli clinical isolates: A systematic review. J. Glob. Antimicrob. Resist. 2022, 29, 444–461. [Google Scholar] [CrossRef]
- Garza-Ramos, U.; Silva-Sánchez, J.; López-Jácome, L.E.; Hernández-Durán, M.; Colín-Castro, C.A.; Sánchez-Pérez, A.; Rodríguez-Santiago, J.; Morfín-Otero, R.; Rodriguez-Noriega, E.; Velázquez-Acosta, M.-D.; et al. Carbapenemase-Encoding Genes and Colistin Resistance in Gram-Negative Bacteria During the COVID-19 Pandemic in Mexico: Results from the Invifar Network. Microb. Drug Resist. 2022, 29, 239–248. [Google Scholar] [CrossRef]
- Merida-Vieyra, J.; Ranero, A.D.C.; Arzate-Barbosa, P.; De La Garza, E.A.; Méndez-Tenorio, A.; Murcia-Garzón, J.; Aquino-Andrade, A. First clinical isolate of Escherichia coli harboring mcr-1 gene in Mexico. PLoS ONE 2019, 14, e0214648. [Google Scholar] [CrossRef]
- El-Baky, R.M.A.; Masoud, S.M.; Mohamed, D.S.; Waly, N.G.; A Shafik, E.; A Mohareb, D.; Elkady, A.; Elbadr, M.M.; Hetta, H.F. Prevalence and Some Possible Mechanisms of Colistin Resistance among Multidrug-Resistant and Extensively Drug-Resistant Pseudomonas aeruginosa. Infect. Drug Resist. 2020, 13, 323–332. [Google Scholar] [CrossRef]
- Snesrud, E.; Maybank, R.; Kwak, Y.I.; Jones, A.R.; Hinkle, M.K.; McGann, P. Chromosomally Encoded mcr-5 in Colistin-Nonsusceptible Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 2018, 62, e00679-18. [Google Scholar] [CrossRef]
- Chen, H.; Mai, H.; Lopes, B.; Wen, F.; Patil, S. Novel Pseudomonas aeruginosa Strains Co-Harbouring blaNDM-1 Metallo β-Lactamase and mcr-1 Isolated from Immunocompromised Paediatric Patients. Infect. Drug Resist. 2022, 15, 2929–2936. [Google Scholar] [CrossRef]
- Yap, P.S.-X.; Cheng, W.-H.; Chang, S.-K.; Lim, S.-H.E.; Lai, K.-S. MgrB Mutations and Altered Cell Permeability in Colistin Resistance in Klebsiella pneumoniae. Cells 2022, 11, 2995. [Google Scholar] [CrossRef] [PubMed]
- Azimi, L.; Lari, A.R. Colistin-resistant Pseudomonas aeruginosa clinical strains with defective biofilm formation. GMS Hyg. Infect. Control. 2019, 14, Doc12. [Google Scholar] [CrossRef] [PubMed]
- Anan, M.M.G.; El-Seidi, E.A.; Mostafa, M.S.; Rashed, L.A.; El-Wakil, D.M. Detection of Plasmid-Mediated Mobile Colistin Resistance Gene (mcr-1) in Enterobacterales Isolates from a University Hospital. Infect Drug Resist. 2021, 14, 3063–3070. [Google Scholar] [CrossRef]
- Ortega-Paredes, D.; Barba, P.; Zurita, J. Colistin-resistant Escherichia coli clinical isolate harbouring the mcr-1 gene in Ecuador. Epidemiol. Infect. 2016, 144, 2967–2970. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Karki, D.; Dhungel, B.; Bhandari, S.; Kunwar, A.; Joshi, P.R.; Shrestha, B.; Rijal, K.R.; Ghimire, P.; Banjara, M.R. Antibiotic resistance and detection of plasmid mediated colistin resistance mcr-1 gene among Escherichia coli and Klebsiella pneumoniae isolated from clinical samples. Gut. Pathog. 2021, 13, 45. [Google Scholar] [CrossRef] [PubMed]
- Ugarte, R.G.; Olivo, J.M.; Corso, A.; Pasteran, F.; Albornoz, E.; Sahuanay, Z.P. Resistencia a colistín mediado por el gen mcr-1 identificado en cepas de Escherichia coli y Klebsiella pneumoniae. Primeros reportes en el Perú. An. Fac. Med. 2018, 79, 213–217. [Google Scholar] [CrossRef][Green Version]
- Carroll, L.M.; Gaballa, A.; Guldimann, C.; Sullivan, G.; Henderson, L.O.; Wiedmann, M. Identification of Novel Mobilized Colistin Resistance Gene mcr-9 in a Multidrug-Resistant, Colistin-Susceptible Salmonella enterica Serotype Typhimurium Isolate. mBio 2019, 10, e00853-19. [Google Scholar] [CrossRef]
- Terveer, E.M.; Nijhuis, R.H.T.; Crobach, M.J.T.; Knetsch, C.W.; Veldkamp, K.E.; Gooskens, J.; Kuijper, E.J.; Claas, E.C.J. Prevalence of colistin resistance gene (mcr-1) containing Enterobacteriaceae in feces of patients attending a tertiary care hospital and detection of a mcr-1 containing, colistin susceptible E. coli. PLoS ONE 2017, 12, e0178598. [Google Scholar] [CrossRef]
- Mendes, A.C.; Novais, Â.; Campos, J.; Rodrigues, C.; Santos, C.; Antunes, P.; Ramos, H.; Peixe, L. mcr-1 in Carbapenemase-Producing Klebsiella pneumoniae with Hospitalized Patients, Portugal, 2016–2017. Emerg. Infect. Dis. 2018, 24, 762–766. [Google Scholar] [CrossRef]
- Östholm, Å.; Tärnberg, M.; Monstein, H.J.; Hällgren, A.; Hanberger, H.; Nilsson, L.E. High frequency of co-resistance in CTX-M-producing Escherichia coli to non-beta-lactam antibiotics, with the exceptions of amikacin, nitrofurantoin, colistin, tigecycline, and fosfomycin, in a county of Sweden. Scand. J. Infect. Dis. 2013, 45, 271–278. [Google Scholar] [CrossRef]
- Tsui, C.K.; Sundararaju, S.; Al Mana, H.; Hasan, M.R.; Tang, P.; Perez-Lopez, A. Plasmid-mediated colistin resistance encoded by mcr-1 gene in Escherichia coli co-carrying blaCTX-M-15 and blaNDM-1 genes in pediatric patients in Qatar. J. Glob. Antimicrob. Resist. 2020, 22, 662–663. [Google Scholar] [CrossRef]
- Yauri-Condor, K.; Apestegui, M.Z.; Sevilla-Andrade, C.R.; Sara, J.P.; Espinoza, C.V.; Taboada, W.V.; Gonzales-Escalante, E. Extended-spectrum beta-lactamase-producing Enterobacterales carrying the mcr-1 gene in Lima, Peru. Rev. Perú. Med. Exp. Salud Publica 2020, 37, 711–715. [Google Scholar] [CrossRef]
- Leroy, A.; Naze, F.; Dortet, L.; Naas, T.; Jaubert, J. Plasmid-mediated colistin resistance gene mcr-1 in a clinical Escherichia coli isolate in the Indian Ocean Commission. Med. Mal. Infect. 2018, 48, 426–428. [Google Scholar] [CrossRef] [PubMed]
- Luo, X.; Matthews, K.R. The conjugative transfer of plasmid-mediated mobile colistin resistance gene, mcr-1, to Escherichia coli O157:H7 and Escherichia coli O104:H4 in nutrient broth and in mung bean sprouts. Food Microbiol. 2023, 111, 104188. [Google Scholar] [CrossRef] [PubMed]
- Li, X.P.; Sun, R.Y.; Song, J.Q.; Fang, L.X.; Zhang, R.M.; Lian, X.L.; Liao, X.P.; Liu, Y.H.; Lin, J.; Sun, J. Within-host heterogeneity and flexibility of mcr-1 transmission in chicken gut. Int. J. Antimicrob. Agents 2020, 55, 105806. [Google Scholar] [CrossRef]
- Novais, A.; Pires, J.; Ferreira, H.; Costa, L.; Montenegro, C.; Vuotto, C.; Donelli, G.; Coque, T.M.; Peixe, L. Characterization of globally spread Escherichia coli ST131 isolates (1991 to 2010). Antimicrob. Agents Chemother. 2012, 56, 3973–3976. [Google Scholar] [CrossRef] [PubMed]
- Li, G.; Li, X.; Wu, Y.; Xu, J.; He, F. Genomic Insights into the Colistin Resistant mcr-Carrying Escherichia coli Strains in a Tertiary Hospital in China. Antibiotics 2022, 11, 1522. [Google Scholar] [CrossRef]
- Kudinha, T.; Kong, F. Possible step-up in prevalence for Escherichia coli ST131 from fecal to clinical isolates: Inferred virulence potential comparative studies within phylogenetic group B2. J. Biomed. Sci. 2022, 29, 78. [Google Scholar] [CrossRef] [PubMed]
Amplified Gene | Primers Sequence (5′–3′) | Reference |
---|---|---|
mcr-1-fw | AGTCCGTTTGTTCTTGTGGC | [21] |
mcr-1-rv | AGATCCTTGGTCTCGGCTTG | |
mcr-2-fw | CAAGTGTGTTGGTCGCAGTT | [21] |
mcr-2-rv | TCTAGCCCGACAAGCATACC | |
mcr-3-fw | AAATAAAAATTGTTCCGCTTATG | [21] |
mcr-3-rv | AATGGAGATCCCCGTTTTT | |
mcr-4-fw | TCACTTTCATCACTGCGTTG | [21] |
mcr-4-rv | TTGGTCCATGACTACCAATG | |
mcr-5-fw | ATGCGGTTGTCTGCATTTATC | [22] |
mcr-5-rv | TCATTGTGGTTGTCCTTTTCTG | |
pabB-fw | TCCAGCAGGTGCTGGATCGT | [23] |
pabB-rv | GCGAAATTTTTCGCCGTACTGT | |
blaCTX-M-fw | TTTGCGATGTGCAGTACCAGTA | [24] |
blaCTX-M-rv | CGATATCGTTGGTGGTGCCATA |
Strain | Micoorganism | Colistin MIC (µg/mL) | Isolation Site |
---|---|---|---|
744 | P. aeruginosa | 8 | Blood |
1308 | K. pneumoniae | 16 | Respiratory secretions |
2207 | E. coli | 4 | Respiratory secretions |
2230 | E. coli | 4 | Urine |
2445 | E. coli | 8 | Renal abscess |
2892 | P. aeruginosa | 16 | Respiratory secretions |
3148 | P. aeruginosa | 8 | Urine |
3172 | K. pneumoniae | 4 | Blood |
3196 | P. aeruginosa | 4 | Urine |
3202 | K. pneumoniae | 4 | Respiratory secretions |
3271 | E. cloacae | 16 | Respiratory secretions |
5891 | E. coli | 4 | Urine |
Colistin Resistant Bacteria | Antibiotic | Antibiotic Resistance Prevalence | Acquired Resistance Profile |
---|---|---|---|
P. aeruginosa (n = 4) | Ceftazidime | 4/4 (100%) | MDR: 0 |
Cefepime | 4/4 (100%) | XDR: 3 | |
Amikacin | 4/4 (100%) | PDR: 1 | |
Ciprofloxacin | 4/4 (100%) | ||
Piperacillin/tazobactam | 2/4 (50.0%) | ||
Imipenem | 4/4 (100%) | ||
Ceftazidime | 4/4 (100%) | ||
Meropenem | 4/4 (100%) | ||
Gentamicin | 4/4 (100%) | ||
Tigecycline | 1/4 (25%) | ||
E. coli (n = 4) | Ampicillin/sulbactam | 3/4 (75%) | MDR: 2 |
Cefuroxime | 3/4 (75%) | XDR: 2 | |
Cefotaxime | 3/4 (75%) | PDR: 0 | |
Ceftazidime | 3/4 (75%) | ||
Ceftriaxone | 3/4 (75%) | ||
Cefepime | 2/4 (50%) | ||
Ertapenem | 1/4 (25%) | ||
Meropenem | 0/4 (0%) | ||
Amikacin | 0/4 (0%) | ||
Gentamicin | 2/4 (50%) | ||
Ciprofloxacin | 4/4 (100%) | ||
Trimethoprim/sulfamethoxazole | 4/4 (100%) | ||
K. pneumoniae (n = 3) | Ampicillin/sulbactam | 3/3 (100%) | MDR: 1 |
Cefuroxime | 2/3 (66.7%) | XDR: 2 | |
Cefotaxime | 2/3 (66.7%) | PDR: 0 | |
Ceftazidime | 2/3 (66.7%) | ||
Ceftriaxone | 2/3 (66.7%) | ||
Cefepime | 2/3 (66.7%) | ||
Ertapenem | 1/3 (33.3%) | ||
Meropenem | 0/3 (0%) | ||
Amikacin | 0/3 (0%) | ||
Gentamicin | 2/3 (66.7%) | ||
Ciprofloxacin | 3/3 (100%) | ||
Trimethoprim/sulfamethoxazole | 3/3 (100%) | ||
E. cloacae (n = 1) | Cefuroxime | 1/1 (100%) | MDR: 1 |
Cefotaxime | 0/1 (0%) | XDR: 0 | |
Ceftazidime | 0/1 (0%) | PDR: 0 | |
Ceftriaxone | 0/1 (0%) | ||
Cefepime | 0/1 (0%) | ||
Ertapenem | 0/1 (0%) | ||
Meropenem | 0/1 (0%) | ||
Amikacin | 0/1 (0%) | ||
Gentamicin | 1/1 (100%) | ||
Ciprofloxacin | 1/1 (100%) | ||
Trimethoprim/sulfamethoxazole | 0/1 (100%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Galindo-Méndez, M.; Navarrete-Salazar, H.; Pacheco-Vásquez, R.; Quintas-de la Paz, D.; Baltazar-Jiménez, I.; Santiago-Luna, J.D.; Guadarrama-Monroy, L. Detection of Plasmid-Mediated Resistance against Colistin in Multi-Drug-Resistant Gram-Negative Bacilli Isolated from a Tertiary Hospital. Microorganisms 2023, 11, 1996. https://doi.org/10.3390/microorganisms11081996
Galindo-Méndez M, Navarrete-Salazar H, Pacheco-Vásquez R, Quintas-de la Paz D, Baltazar-Jiménez I, Santiago-Luna JD, Guadarrama-Monroy L. Detection of Plasmid-Mediated Resistance against Colistin in Multi-Drug-Resistant Gram-Negative Bacilli Isolated from a Tertiary Hospital. Microorganisms. 2023; 11(8):1996. https://doi.org/10.3390/microorganisms11081996
Chicago/Turabian StyleGalindo-Méndez, Mario, Humberto Navarrete-Salazar, Reinaldo Pacheco-Vásquez, Devanhí Quintas-de la Paz, Isabel Baltazar-Jiménez, José David Santiago-Luna, and Laura Guadarrama-Monroy. 2023. "Detection of Plasmid-Mediated Resistance against Colistin in Multi-Drug-Resistant Gram-Negative Bacilli Isolated from a Tertiary Hospital" Microorganisms 11, no. 8: 1996. https://doi.org/10.3390/microorganisms11081996
APA StyleGalindo-Méndez, M., Navarrete-Salazar, H., Pacheco-Vásquez, R., Quintas-de la Paz, D., Baltazar-Jiménez, I., Santiago-Luna, J. D., & Guadarrama-Monroy, L. (2023). Detection of Plasmid-Mediated Resistance against Colistin in Multi-Drug-Resistant Gram-Negative Bacilli Isolated from a Tertiary Hospital. Microorganisms, 11(8), 1996. https://doi.org/10.3390/microorganisms11081996