Characterization of Bacillus pumilus Strains with Targeted Gene Editing for Antimicrobial Peptides and Sporulation Factor
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Plasmids
2.2. Media and Growth Conditions
2.3. Plasmid Construction
2.4. Dynamics of Growth and Sporulation, Proteolytic and Antagonistic Activities of the Studied Strains
2.5. Mathematical Processing of Results
3. Results and Discussion
3.1. Obtaining Plasmids Carrying Fragments of the Bacilysin, Bacteriocin, and Sporulation Factor Sigma-F Genes Based on the Shuttle Vector pJOE9282.1
3.2. Transformation of B. pumilus Cells with Obtained Plasmids
3.3. Targeted Inactivation of the bac, bact, and sigF Genes by CRISPR/Cas9 Editing
3.4. Antimicrobial Activity of B. pumilus 3-19 Strains
3.5. Growth Dynamics and Proteolytic Activity of B. pumilus 3-19 Strains
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tripathi, D.K.; Singh, V.P.; Kumar, D.; Chauhan, D.K. Impact of exogenous silicon addition on chromium uptake, growth, mineral elements, oxidative stress, antioxidant capacity, and leaf and root structures in rice seedlings exposed to hexavalent chromium. Acta Physiol. Plant. 2012, 34, 279–289. [Google Scholar] [CrossRef]
- Niazi, A.; Manzoor, S.; Asari, S.; Bejai, S.; Meijer, J.; Bongcam-Rudloff, E. Genome analysis of Bacillus amyloliquefaciens subsp. plantarum UCMB5113: A rhizobacterium that improves plant growth and stress management. PLoS ONE 2014, 9, e104651. [Google Scholar] [CrossRef]
- Goswami, D.; Thakker, J.N.; Dhandhukia, P.C. Portraying mechanics of plant growth promoting rhizobacteria (PGPR): A review. Cogent Food Agric. 2016, 2, 1127500. [Google Scholar] [CrossRef]
- Radhakrishnan, R.; Hashem, A.; Abd_Allah, E.F. Bacillus: A biological tool for crop improvement through bio-molecular changes in adverse environments. Front. Physiol. 2017, 8, 667. [Google Scholar] [CrossRef]
- Dobrzynski, J.; Jakubowska, Z.; Dybek, B. Potential of Bacillus pumilus to directly promote plant growth. Front. Microbiol. 2022, 13, 1069053. [Google Scholar] [CrossRef]
- Hashem, A.; Tabassum, B.; Abd_Allah, E.F. Bacillus subtilis: A plant-growth promoting rhizobacterium that also impacts biotic stress. Saudi J. Biol. Sci. 2019, 26, 1291–1297. [Google Scholar] [CrossRef]
- Stein, T. Bacillus subtilis antibiotics: Structures, syntheses and specific functions. Mol. Microbiol. 2005, 56, 845–857. [Google Scholar] [CrossRef]
- Chowdhury, S.P.; Dietel, K.; Rändler, M.; Schmid, M.; Junge, H.; Boriss, R.; Hartmann, A.; Grosch, R. Effects of Bacillus amyloliquefaciens FZB42 on lettuce growth and health under pathogen pressure and its impact on the rhizosphere bacterial community. PLoS ONE 2013, 8, e68818. [Google Scholar] [CrossRef]
- Sumi, C.D.; Yang, B.W.; Yeo, I.C.; Hahm, Y.Y. Antimicrobial peptides of the genus Bacillus: A new era for antibiotics. Can. J. Microbiol. 2015, 61, 93–103. [Google Scholar] [CrossRef]
- Zhao, X.; Kuipers, O.P. Identification and classification of known and putative antimicrobial compounds produced by a wide variety of Bacillales species. BMC Genom. 2016, 17, 882. [Google Scholar] [CrossRef]
- Ozcengiz, G.; Ogulur, I. Biochemistry, genetics and regulation of bacilysin biosynthesis and its significance more than an antibiotic. New Biotechnol. 2015, 32, 612–619. [Google Scholar] [CrossRef]
- Nannan, C.; Vu, H.Q.; Gillis, A.; Caulier, S.; Nguyen, T.T.T.; Mahillon, J. Bacilysin within the Bacillus subtilis group: Gene prevalence versus antagonistic activity against Gram-negative foodborne pathogens. J. Biotechnol. 2021, 327, 28–35. [Google Scholar] [CrossRef]
- Falardeau, J.; Wise, C.; Novitsky, L.; Avis, T.J. Ecological and mechanistic insights into the direct and indirect antimicrobial properties of Bacillus subtilis lipopeptides on plant pathogens. J. Chem. Ecol. 2013, 39, 869–878. [Google Scholar] [CrossRef]
- Bais, H.P.; Fall, R.; Vivanco, J.M. Biocontrol of Bacillus subtilis against infection of Arabidopsis roots by Pseudomonas syringae is facilitated by biofilm formation and surfactin production. Plant Physiol. 2004, 134, 307–319. [Google Scholar] [CrossRef]
- Hinarejos, E.; Castellano, M.; Rodrigo, I.; Bellés, J.M.; Conejero, V.; López-Gresa, M.P.; Lisón, P. Bacillus subtilis IAB/BS03 as a potential biological control agent. Eur. J. Plant Pathol. 2016, 146, 597–608. [Google Scholar] [CrossRef]
- Etchegaray, A.; de Castro Bueno, C.; de Melo, I.S.; Tsai, S.M.; de Fátima Fiore, M.; SilvaStenico, M.E.; de Moraes, L.A.B.; Teschke, O. Effect of a highly concentrated lipopeptide extract of Bacillus subtilis on fungal and bacterial cells. Arch. Microbiol. 2008, 190, 611–622. [Google Scholar] [CrossRef]
- Pudova, D.S.; Toymentseva, A.A.; Gogoleva, N.E.; Shagimardanova, E.I.; Mardanova, A.M.; Sharipova, M.R. Comparative genome analysis of two Bacillus pumilus strains producing high level of extracellular hydrolases. Genes 2022, 13, 409. [Google Scholar] [CrossRef]
- Suleimanova, A.D.; Beinhauer, A.; Valeeva, L.R.; Chastukhina, I.B.; Balaban, N.P.; Shakirov, E.V.; Greiner, R.; Sharipova, M.R. Novel glucose-1-phosphatase with high phytase activity and unusual metal ion activation from soil bacterium Pantoea sp. strain 3.5.1. Appl. Environ. Microbiol. 2015, 81, 6790–6799. [Google Scholar] [CrossRef]
- Toymentseva, A.A.; Altenbuchner, J. New CRISPR-Cas9 vectors for genetic modifications of Bacillus species. FEMS Microbiol. Lett. 2019, 366, fny284. [Google Scholar] [CrossRef]
- Harwood, C.R.; Cutting, S.M. Molecular Biological Methods for Bacillus Chichester; Wiley: New York, NY, USA, 1990; Volume 287, p. 227. [Google Scholar]
- Das, S.; Dash, H.R. Microbial Biotechnology—A Laboratory Manual for Bacterial Systems; Springer: Berlin/Heidelberg, Germany, 2015; Volume 239. [Google Scholar]
- Danilova, I.V.; Rudakova, N.L.; Vasilyeva, Y.A.; Gilmutdinova, A.I.; Diadkina, I.V.; Khasanov, D.I.; Sharipova, M.R. Optimization of Electroporation Conditions for Bacillus pumilus 3-19 Strain. BioNanoScience 2022, 13, 752–756. [Google Scholar] [CrossRef]
- Jinek, M.A.; Chylinski, K.; Fonfara, I. and others. Programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 2012, 337, 816–821. [Google Scholar] [CrossRef]
- Makarova, K.S.; Haft, D.H.; Barrangou, R.; Brouns, S.J.; Charpentier, E.; Horvath, P.; Moineau, S.; Mojica, F.J.; Wolf, Y.I.; Yakunin, A.F.; et al. Evolution and classification of the CRISPR-Cas systems. Nat. Rev. Microbiol. 2011, 9, 467–477. [Google Scholar] [CrossRef]
- Altenbuchner, J. Editing of the Bacillus subtilis genome by the CRISPR-Cas9 system. Appl. Environ. Microbiol. 2016, 82, 5421–5427. [Google Scholar] [CrossRef]
- Demidyuk, I.V.; Kalashnikov, A.E.; Gromova, T.Y.; Gasanov, E.V.; Safina, D.R.; Zabolotskaya, M.V.; Rudenskaya, G.N.; Kostrov, S.V. Cloning, sequencing, expression and characterization of protealysin, a novel neutral proteinase from Serratia proteamaculans representing a new group of thermolysin-like proteases with short N-terminal region of precursor. Protein Expr. Purif. 2006, 47, 551–561. [Google Scholar] [CrossRef]
- Hussey, M.A.; Zayaitz, A. Endospore Stain Protocol. Am. Soc. Microbiol. 2007, 5. Available online: https://asm.org/ASM/media/Protocol-Images/Endospore-Stain-Protocol.pdf?ext=.pdf (accessed on 20 March 2022).
- Balouiri, M.; Sadiki, M.; Ibnsouda, S.K. Methods for in vitro evaluating antimicrobial activity. J. Pharm. Anal. 2016, 6, 71–79. [Google Scholar] [CrossRef]
- Steel, R.G.D.; Torrie, J.H.; Dicky, D.A. Principles and Procedures of Statistics: A Biometrical Approach, 3rd ed.; McGraw-Hill: New York, NY, USA, 1997; 666p. [Google Scholar]
- Freitas-Silva, J.; de Oliveira, B.F.R.; Vigoder, F.D.M.; Muricy, G.; Dobson, A.D.; Laport, M.S. Peeling the layers away: The genomic characterization of Bacillus pumilus 64-1, an isolate with antimicrobial activity from the marine sponge Plakina cyanorosea (Porifera, Homoscleromorpha). Front. Microbiol. 2021, 11, 592735. [Google Scholar] [CrossRef]
- Vairagkar, U.; Mirza, Y. Antagonistic activity of antimicrobial metabolites produced from seaweed-associated Bacillus amyloliquefaciens MTCC 10456 against Malassezia spp. Probiotics Antimicrob. Proteins 2021, 13, 1228–1237. [Google Scholar] [CrossRef]
- Mercado, V.; Olmos, J. Bacteriocin production by Bacillus species: Isolation, characterization, and application. Probiotics Antimicrob. Proteins 2022, 4, 1151–1169. [Google Scholar] [CrossRef]
- Wang, D.; Wang, Q.; Qiu, Y.; Nomura, C.T.; Li, J.; Chen, S. Untangling the transcription regulatory network of the bacitracin synthase operon in Bacillus licheniformis DW2. Res. Microbiol. 2017, 168, 515–523. [Google Scholar] [CrossRef]
- Overkamp, W.; Kuipers, O.P. Transcriptional Profile of Bacillus subtilis sigF-Mutant during Vegetative Growth. PLoS ONE 2015, 10, e0141553. [Google Scholar] [CrossRef] [PubMed]
- Zhou, C.; Liu, H.; Yuan, F.; Chai, H.; Wang, H.; Liu, F.; Li, Y.; Zhang, H.; Lu, F. Development and application of a CRISPR/Cas9 system for Bacillus licheniformis genome editing. Int. J. Biol. Macromol. 2019, 122, 329–337. [Google Scholar] [CrossRef] [PubMed]
- Fira, D.; Dimkic, I.; Beric, T.; Lozo, J.; Stankovic, S. Biological control of plant pathogens by Bacillus species. J. Biotechnol. 2018, 285, 44–55. [Google Scholar] [CrossRef] [PubMed]
- Haavik, H.I. Possible functions of peptide antibiotics during growth of producer organisms: Bacitracin and metal(I1) ion transport. Acta Pathol. Microbiol. Scand. Sect. B Microbiol. 1976, 84, 117–124. [Google Scholar] [CrossRef]
- Haavik, H.I. On the function of the polypeptide antibiotic bacitracin in the producer strain Bacillus Zicheniformis. Acta Pathol. Microbiol. Scand. Sect. B Microbiol. 1975, 83, 519–524. [Google Scholar]
Strain | Genotype | Purpose of Use | Source |
---|---|---|---|
Bacillus pumilus 3-19 [17]; Genbank accession number NZ_CP054310 | strR | Gene deletion, recipient strain | Laboratory collection (Department of Microbiology, “Agrobioengineering” research laboratory, KFU) |
Escherichia coli DH5α; https://www.ncbi.nlm.nih.gov/nuccore/NZ_CP076470.1, (accessed on 20 March 2022) | – | Obtain recombinant plasmids | |
Pantoea brenneri 3.1, 3.2 (all-Russian collection of industrial microorganisms B-12911) [18] | – | Antagonistic activity | |
B. subtilis 168; https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=224308&lvl=3&lin=f&keep=1&srchmode=1&unlock, (accessed on 17 March 2009) | Antagonistic activity | ||
B. cereus | – | Antagonistic activity | |
P. syringae; https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&lvl=3&lin=f&keep=1&srchmode=1&unlock&id=323, (accessed on 1 November 2022) | – | Antagonistic activity | Plant Infectious Diseases Laboratory, Kazan Scientific Center of Russian Academy of Sciences |
Erwinia amylovora | – | Antagonistic activity | All-Russian research institute of phytopatology |
B. pumilus AG11.21 | strR, ΔsigF | A strain with an inactivated sigF sporulation factor gene | Received in the work |
B. pumilus ID11.21 | strR, Δbac | A strain with an inactivated bacilysin gene | Received in the work |
B. pumilus IV11.21 | strR, Δbact | A strain with an inactivated bacteriocin gene | Received in the work |
No | Primer Name | Sequence 5′→3′ |
---|---|---|
1 | bac-sgRNA-For | ctcgATTTCAAGAACAAATGC |
2 | bac-sgRNA-Rev | aaacGCATTTGTTCTTGAAAT |
3 | bact-sgRNA-For | ctcgTCTCGCTACAGATGCTG |
4 | bact-sgRNA-Rev | aaacCAGCATCTGTAGCGAGA |
5 | sigF-sgRNA-For | ctcgTCGGCTATTTCCTGGACAGT |
6 | sigF-sgRNA-Rev | aaacACTGTCCAGGAAATAGCCGA |
No | Primer Name | Sequence 5′→3′ * |
---|---|---|
1 | bacL-For | aaGGCCaacgaGGCCTTTTCTTAGTGCTGGGCGGC |
2 | bacL-Rev | aaGGCCatgttGGCCGCACATACCTAGATGTGCAGTGA |
3 | bacR-For | aaGGCCaacatGGCCCCCTCCTCACACGATCATAGAAC |
4 | bacR-Rev | aaGGCCttattGGCCCCGCTGATGCAAATGCCGATT |
5 | bactL-For | aaGGCCaacgaGGCCCATCAAGACTTGCCTACTCCCT |
6 | bactL-Rev | aaGGCCatgttGGCCTGAGAAAAGAATCGTTTTTGCTAGG |
7 | bactR-For | aaGGCCaacatGGCCTGACTCAATAGAAGGAGACTTTGTT |
8 | bactR-Rev | aaGGCCttattGGCCATGTGTTTGTGCAATGGAATATTGA |
9 | sigFL-For | aaGGCCaacgaGGCCAGCCATACAAACACAAATAAAACGG |
10 | sigFL-Rev | aaGGCCatgttGGCCACAAGTACAAGTCTCGCGGC |
11 | sigFR-For | aaGGCCaacatGGCCAAAAGCGCTGAACAACGGAC |
12 | sigFR-Rev | aaGGCCttattGGCCTATCTCGCCAGCAGTGAACC |
13 | Cas9 For | CGCGTGGCAATAGTCGTTTT |
14 | Cas9 Rev | ATGCCGCCCCATTACTTTGA |
15 | T7promoter For | TAATACGACTCACTATAGGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Danilova, I.V.; Vasileva, I.A.; Gilmutdinova, A.I.; Dyadkina, I.V.; Khusnullina, L.K.; Khasanov, D.I.; Rudakova, N.L.; Sharipova, M.R. Characterization of Bacillus pumilus Strains with Targeted Gene Editing for Antimicrobial Peptides and Sporulation Factor. Microorganisms 2023, 11, 1508. https://doi.org/10.3390/microorganisms11061508
Danilova IV, Vasileva IA, Gilmutdinova AI, Dyadkina IV, Khusnullina LK, Khasanov DI, Rudakova NL, Sharipova MR. Characterization of Bacillus pumilus Strains with Targeted Gene Editing for Antimicrobial Peptides and Sporulation Factor. Microorganisms. 2023; 11(6):1508. https://doi.org/10.3390/microorganisms11061508
Chicago/Turabian StyleDanilova, Iuliia V., Iuliia A. Vasileva, Ajgul I. Gilmutdinova, Ilona V. Dyadkina, Liya K. Khusnullina, Damir I. Khasanov, Natalia L. Rudakova, and Margarita R. Sharipova. 2023. "Characterization of Bacillus pumilus Strains with Targeted Gene Editing for Antimicrobial Peptides and Sporulation Factor" Microorganisms 11, no. 6: 1508. https://doi.org/10.3390/microorganisms11061508
APA StyleDanilova, I. V., Vasileva, I. A., Gilmutdinova, A. I., Dyadkina, I. V., Khusnullina, L. K., Khasanov, D. I., Rudakova, N. L., & Sharipova, M. R. (2023). Characterization of Bacillus pumilus Strains with Targeted Gene Editing for Antimicrobial Peptides and Sporulation Factor. Microorganisms, 11(6), 1508. https://doi.org/10.3390/microorganisms11061508