Next Article in Journal
The Impact and Determinants of Mountainous Topographical Factors on Soil Microbial Community Characteristics
Previous Article in Journal
In Vitro Efficacy of Isobutyl Cyanoacrylate Nanoparticles against Fish Bacterial Pathogens and Selection Preference by Rainbow Trout (Oncorhynchus mykiss)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Impact of In-Feed versus In-Water Chlortetracycline and Tiamulin Administrations on Fecal Prevalence and Antimicrobial Susceptibilities of Campylobacter in a Population of Nursery Pigs

1
Department of Clinical Sciences, College of Veterinary Medicine, Kansas State University, Manhattan, KS 66506, USA
2
Department of Animal Sciences & Industry, College of Agriculture, Kansas State University, Manhattan, KS 66506, USA
3
Department of Diagnostic Medicine and Pathobiology, College of Veterinary Medicine, Kansas State University, Manhattan, KS 66506, USA
4
Department of Statistics, College of Arts and Sciences, Kansas State University, Manhattan, KS 66506, USA
*
Author to whom correspondence should be addressed.
Microorganisms 2023, 11(12), 2876; https://doi.org/10.3390/microorganisms11122876
Submission received: 19 October 2023 / Revised: 19 November 2023 / Accepted: 25 November 2023 / Published: 28 November 2023
(This article belongs to the Special Issue Bacteria of Animal Origin with Public Health Implications)

Abstract

Antimicrobial resistance (AMR) in bacteria is a major public health concern in the US and around the world. Campylobacter is an important foodborne pathogen that resides in the gut of pigs and is shed in feces, with the potential to be transmitted to humans. In pigs, the oral route, either in-feed or in-water, is by far the most common route of administration of antimicrobials. Because the distribution of the antibiotic in the gut and the dosages are different, the impact of in-feed vs. in-water administration of antibiotics on the development of AMR is likely to be different. Therefore, a study was conducted to compare in-feed vs. in-water administrations of chlortetracycline (CTC) and/or tiamulin on fecal prevalence and AMR profiles of Campylobacter among weaned nursery piglets. A total of 1,296 weaned piglets, allocated into 48 pens (27 piglets per pen), were assigned randomly to six treatment groups: Control (no antibiotic), in-feed CTC, in-water CTC, in-feed tiamulin, in-water tiamulin, or in-feed CTC and tiamulin. Fecal samples were collected randomly from 5 piglets from each pen during the pre-treatment (days 0, 7), treatment (days 14, 21), and post-treatment (days 28, 35) phases. Bacterial isolations and species identifications were conducted by culture and PCR, respectively. The microbroth dilution method with SensititreTM plates was used to determine the antimicrobial susceptibility and resistance of Campylobacter isolates. The results on resistance were interpreted based on the European Committee on Antimicrobial Susceptibility Testing (EUCAST) epidemiological cutoff values for Campylobacter. The overall prevalence of Campylobacter was 18.2% (262/1440). Speciation of Campylobacter isolates by PCR indicated the prevalence of only two species: Campylobacter hyointestinalis (17.9%; 258/1440) and C. coli (0.3%; 4/1440). Campylobacter isolates were resistant to tetracycline (98.5%), ciprofloxacin (89.3%), and nalidixic acid (60.3%). Neither the antibiotic nor the route of administration had an effect (p > 0.05) on the prevalence of AMR Campylobacter in the feces of piglets.

1. Introduction

Antimicrobial Resistance (AMR) has emerged as a global threat to human and animal health [1]. In 2020, the World Health Organization declared AMR among the top health challenges in the world [2]. According to the Centers for Disease Control and Prevention (CDC), more than 2.8 million AMR bacterial and fungal infections and 35,900 million deaths occur every year in the United States [3]. There is evidence that AMR infections in humans are linked to the increased and/or frequent use of antimicrobials in animal agriculture [4]. Antimicrobials have been used in swine production on a routine basis as a management tool for many years [5]. According to the United States Food and Drug Administration, approximately six million kilograms of medically important antimicrobials were used for food animal production, with the swine industry utilizing 42% of these antimicrobials [6]. The public health risks associated with the use of antimicrobials in animals have prompted the FDA to ban the use of medically important antimicrobials for growth promotion (FDA Guidance for Industry #209, 2017). The European Centre for Disease Prevention and Control (ECDC), European Food Safety Authority (EFSA), and European Medicines Agency (EMA) have jointly reported a positive association between antimicrobial use in food-producing animals and the AMR of bacteria, including Campylobacter [1]. Campylobacter is one of the leading causes of foodborne diarrheal illnesses in the US and poses a significant public health threat [7]. The thermophilic Campylobacter species are among the pathogens that are becoming increasingly resistant to important and critically important antimicrobials. In 2019, the CDC categorized drug-resistant Campylobacter as a serious-level threat. In the US, it is estimated to cause approximately 448,400 infections and about 70 deaths every year [3]. The CDCs National Outbreak Reporting System (NORS) reported a total of 813 Campylobacter outbreaks between 2008 and 2021 (https://wwwn.cdc.gov/norsdashboard/; accessed on 27 November 2023). Pigs (and also broiler chickens) are a major reservoir for Campylobacter spp., particularly Campylobacter (C.) coli, and therefore play a role in transferring the bacteria to human beings [8,9,10,11,12,13]. However, the primary species of Campylobacter pathogen in humans is C. jejuni, which is very rare in pigs, indicating that pigs are a rare source of human Campylobacteriosis [14,15].
Referring to the US, several antimicrobials, including medically important antimicrobials, are used in swine production for therapeutic and non-therapeutic purposes. Tetracyclines and tiamulin are the most commonly used antibiotics in swine [16]. Tetracyclines are widely employed either alone or in combination with other antibiotics for the prevention, control, and treatment of bacterial diseases in swine [17,18]. Tiamulin is extensively used in the swine industry to control and treat dysentery (caused by Brachyspira hyodysenteriae), respiratory diseases, and for growth promotion in some countries [19]. Tiamulin is an antibiotic that is used exclusively in swine and poultry and does not require a veterinary feed directive for its usage, which increases the likelihood of being frequently used or even overused by producers. Previous studies have shown that tiamulin and its metabolites select for resistance among C. coli [20].
Oral medication is the most commonly used route of antimicrobial administration in pig production [21,22,23]. Several studies have reported oral antimicrobial medication as a driving factor for the development of AMR [24,25,26]. Risk factors such as prolonged antimicrobial use, under-dosing, and environmental contamination with antimicrobials may favor the development of bacterial resistance [26]. Despite a broad array of AMR risks associated with oral route (in-feed and/or in-water) antimicrobial administration, its impact on the amplification and persistence of AMR in Campylobacter is a largely unexplored area. We hypothesize that a water-soluble antibiotic, administered in drinking water, is likely to be distributed more uniformly in the gut and, therefore, has a greater impact on the AMR of gut bacteria than the same antibiotic administered in dry form in the feed. Therefore, the objective of this study was to investigate the effect of two different oral administration methods (in-feed vs. in-water) on the AMR profiles of Campylobacter spp., shed in the feces of piglets.

2. Materials and Methods

2.1. Animal and Experimental Design

The Kansas State University Institutional Animal Care and Use Committee approved all experimental protocols intended for this study (IACUC # 4033; Manhattan, KS, USA). Experiments were conducted at a commercial research nursery facility located in Pipestone, Minnesota. A total of 1440 weaned piglets (L337 × 1050, PIC, Hendersonville, TN, USA) were used in a 35-day trial. The piglets were randomly allocated into 48 pens, with each pen containing 27 piglets. The distribution of piglets in pens was made to ensure the average weight between pens was approximately equal. The piglets were provided with 7 days of acclimatization, after which they were randomly assigned to six treatment groups. The treatments included the control (no antibiotic), in-water chlortetracycline (22 mg/kg) BW (CTC) (CTC-hydrochloride, Elanco Animal Health, Indianapolis, IN, USA), in-feed CTC (22 mg/kg) BW, in-water tiamulin (23 mg/kg) BW (Denagard®, Elanco, Animal Health, Indianapolis, IN, USA), in-feed tiamulin (5 mg/kg) BW, in-feed CTC (22 mg/kg) BW, and tiamulin (5 mg/kg) BW. The doses for both antibiotics were selected in accordance with legally followed guidelines for their usage. These treatments were applied for 14 days. All 48 pens were used in the trial, allowing for eight replications per treatment.

2.2. Fecal Samples

Fresh fecal weekly sample collection was carried out by gentle rectal massage of the first 5 piglets caught out of 27 piglets in the pen (convenience sampling). Fecal samples from each piglet were collected into individual sterile plastic bags (Whirl-Pak® bags, Nasco, Ft. Atkinson, WI, USA) and transported on ice in a cooler to the Pre-harvest Food Safety Laboratory, College of Veterinary Medicine, Kansas State University. Samples were stored at 4 °C and processed within 24 h of collection.

2.3. Isolation of Campylobacter from Fecal Samples

Approximately 1 g of fecal sample was mixed in 9 mL of Mueller-Hinton broth (MH broth; BD Difco, MD, USA) containing two Campylobacter selective growth supplements, Oxoid™ Campylobacter Growth Supplement (SR0232E) and Oxoid™ Modified Preston Campylobacter Selective Supplement (SR0204E) (Thermo Fisher Scientific, Fair Lawn, NJ, USA) (MH+SS agar) in 50 mL filter centrifuge tubes (TubeSpin® Bioreactor, TPP Techno Plastic Products AG, Trasadingen, Switzerland). The tubes were then incubated in a Tri-Gas incubator (BINDER, Tuttlingen, Germany) at 42 °C for 48 h in a microaerophilic atmosphere. A sterile loopful (~10 µL) of the enriched fecal suspension was streaked onto MH+SS agar and incubated in a Tri-Gas incubator at 42 °C for 48 h. Three well-isolated, circular, transparent, and glassy colonies were picked and streaked onto MH agar to confirm growth and obtain pure cultures. Plates were incubated in a Tri-Gas incubator at 42 °C for 48 h in a microaerophilic atmosphere. Pure cultures from the MH agar plate were stored in MH broth with 30% glycerol for future use at −80 °C.

2.4. DNA Isolation and Speciation

DNA was extracted as per the published procedure [27]. Two colonies from MH agar were mixed with 40 µL of single cell lysis buffer (SCLB) (Thermo Fisher Scientific, Fair Lawn, NJ, USA) in a 200 µL polymerase chain reaction (PCR) tube and mixed thoroughly. The SCLB solution contained 1 mL Tris-EDTA (1X TE) (Thermo Fisher Scientific, Fair Lawn, NJ, USA) and 10 µL proteinase K (5 mg/mL) (Sigma-Aldrich, Co., St. Louis, MO, USA). The nuclease-free water was used as a blank for our experiments. To perform cell lysis, the 200 µL PCR tubes were kept in a PCR machine at 80 °C for 10 min and 55 °C for another 10 min. For DNA elution, 40 µL of distilled water was added to the tube, mixed, and centrifuged for 2 min at 4500× g to obtain the DNA supernatant.
Speciation of Campylobacter was conducted using the multiplex polymerase chain reaction assay [28]. The procedure involved simultaneous detection of 16S rRNA for the genus Campylobacter, 23S rRNA for C. hyointestinalis subsp. hyointestinalis, askD for C. coli, cstA for C. fetus, glyA for C. lari, cj0414 for C. jejuni, and lpxA for C. upsaliensis. Primer sequences of the target genes and their amplicon sizes are shown in Table 1. The PCR reaction of 20 µL consisted of 10 µL of master mix (iQ™ Multiplex Powermix-Bio-Rad, Hercules, CA, USA), 5 µL of nuclease-free water, 4 µL of template, and 1 µL of 7 pairs of primers (100 pM) mix (7 pM for each primer). The nuclease-free water was used as a blank for our experiments. Reactions were run on a master-cycler gradient thermal cycler (Eppendorf, Germany), using the following conditions: initial denaturation at 95 °C for 3 min, followed by 25 cycles of denaturation at 95 °C for 30 s, annealing at 61 °C for 90 s, extension at 72 °C for 60 s, and final extension at 72 °C for 7 min. Analysis of PCR products was conducted by capillary gel electrophoresis in a QIAxcel Fast Analyzer system (Qiagen, Valencia, CA, USA).

2.5. Antimicrobial Susceptibility Testing

Commercial premade antimicrobial panel plates (SensititreTM CAMPY, Trek Diagnostic Systems, Thermo Scientific, Oakwood Village, OH, USA) consisting of nine antimicrobials were used to determine the minimal inhibitory concentrations (MICs) of Campylobacter isolates. The antimicrobials tested were azithromycin, ciprofloxacin, clindamycin, erythromycin, florfenicol, gentamicin, nalidixic acid, telithromycin, and tetracycline. Two to three single isolated Campylobacter colonies were mixed in demineralized water (Trek Diagnostic Systems, Thermo Scientific) to obtain 0.5 McFarland turbidity standards. Subsequently, a 10 µL aliquot of the suspension was transferred to MH broth (Trek Diagnostic Systems, Thermo Scientific) and vortexed. Then, 50 µL of the culture was inoculated into the SensititreTM plates and incubated in a Tri-Gas incubator under microaerophilic conditions for 24 h at 42 °C. The epidemiological cutoff values established by the European Committee on Antimicrobial Susceptibility Testing (EUCAST) were used to interpret the MIC values as either resistant or susceptible (https://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Breakpoint_tables/v_11.0_Breakpoint_Tables.pdf; accessed on 16 November 2023).

2.6. PCR Detection of Tetracycline Resistance Genes

A subset of 114 Campylobacter isolates [C. hyointestinalis (n = 110) and C. coli (n = 4)] across all sampling days and treatment groups were subjected to PCR detection of tetracycline resistance genes. Campylobacter was tested for the presence of tetA, tetB, tetO, and tetS genes using a PCR protocol modified from a published procedure [35]. The genes were screened individually by regular PCR using a Master-cycler gradient thermal cycler (Eppendorf, Germany). The 20 µL reaction mixture consisted of 10 µL master mix, 4 µL nuclease-free water, 4 µL of DNA template, and 1 µL of each forward and reverse primer. The reaction was carried out under the following conditions: 95 °C for 3 min, followed by 30 cycles of denaturation at 94 °C for 60 s, annealing at 56 °C for 60 s, extension at 72 °C for 60 s, and 1 cycle of final extension at 72 °C for 10 min. Information about primers and amplicon sizes is shown in Table 2. Analysis of PCR products was carried out by capillary gel electrophoresis in the QIAxcel Advanced system (Qiagen, Germantown, MD, USA). Tetracycline-resistant E. coli strains used as positive controls were acquired from the USDA (Meat Animal Research Center, Clay Center, NE, USA) and Dr. Marilyn C. Roberts at the University of Washington.

2.7. Statistical Analysis

Prevalence data were organized as a binomial response at the animal level per pen, i.e., the number of ‘+’ out of 5 samples per pen per sampling day. Binomial data were summarized by species and treatment at each sampling day. Due to the low prevalence of C. coli, only C. hyointestinalis and the overall Campylobacter prevalence were subjected to statistical analysis. The prevalence data were analyzed using the PROC GLIMMIX procedure in SAS (version 9.4; Cary, NC, USA). The binomial response post-treatment was analyzed under the logit linear mixed model with repeated measurements over time. The fixed effects of the model included treatment, sampling day, and their interactions [37,38]. Random effects of the model included blocks and pens. The random pen effect corresponded to the model intercept term and accounted for the correlation of binomial responses from the same pen. Prevalence on sampling day 0 (i.e., baseline response) served as the model covariate. All tests were conducted at the 0.05 significance level. A comparison between two levels of a model fixed effect was carried out using a 2-sided test. Distributions of test statistics were approximated by Chi-square distributions. Treatment groups were compared within and across sampling days due to no differences observed between treatment and sampling day interactions.
The MIC data were summarized by species and treatment at each sampling day, and analysis was performed using the SAS PROC MIXED procedure. Due to the limited number of isolates tested for MIC, C. coli data at sampling day 0 and C. hyointestinalis data at sampling day 7 were excluded from the statistical analysis. The MIC data of C. hyointestinalis were analyzed separately at every post-treatment sampling day under the linear model, with treatment being the fixed effect. To better achieve model assumptions, data underwent natural log transformation before statistical modeling. The treatment effect was assessed via back-transformed least squares (LS) means and mean differences. Comparisons were carried out using the 2-sided test.

3. Results

3.1. Prevalence of Campylobacter

A total of 262 (18.2%) Campylobacter isolates were recovered from 1440 samples. The majority of these were C. hyointestinalis (258; 17.9%) and (4; 0.3%). C. coli. The prevalence distributions across different treatments, treatment phases, and sampling days are summarized in Table 3. The prevalence of Campylobacter was similar between in-feed tiamulin (53; 22.1%), in-feed CTC (52; 21.7%), and control (49; 20.4%) when compared to in-water CTC (37; 15.4%), in-feed CTC + tiamulin combination (37; 15.4%), and in-water tiamulin (34; 14.2%) treatment groups. Based on treatment phases, the post-treatment phase had a numerically higher number of isolates (168; 35%) when compared to 75 (15.6%) and 19 (4.0%) in the treatment and pre-treatment phases, respectively. The four C. coli isolates were all isolated in the pre-treatment phase. Overall, there was no significant effect of treatment on the prevalence of Campylobacter (p > 0.05) (Table 4), although the sampling day effect was significant (p < 0.05). Also, there was no sampling day and treatment interaction for the prevalence of Campylobacter (p > 0.05) (Table 5).

3.2. Antimicrobial Susceptibilities

The MIC distributions and resistance percentages of Campylobacter isolates (n = 262) against the nine antimicrobials used are depicted in Table 6. The Campylobacter isolates (n = 262) were highly resistant to tetracycline (98.5%), ciprofloxacin (89.3%), and nalidixic acid (60.3%). Low resistance to gentamicin (8%), azithromycin (5%), erythromycin (3.4%), clindamycin (3.1%), telithromycin (1.9%), and florfenicol (8%) was also observed in this study. A total of six different resistance profiles were observed in this study (Table 6). The most common resistance profile was CIP_NAL_TET, which was observed in 122 (46.6%) isolates, followed by CIP_TET in 83 (31.7%), CIP_GEN_NAL_TET, and NAL_TET in 14 (5.3%) isolates, with 8 (3.1%) isolates having resistance to tetracycline alone. A total of 31 (11.8%, n = 262) isolates were resistant to more than three antimicrobial classes, thus recording multidrug resistance. Four of these isolates exhibited multidrug resistance to five or more antimicrobial classes, with the highest resistance shown by two strains to seven antimicrobial classes. Three of the isolates were resistant to four antimicrobial classes, and the rest of the 24 isolates were resistant to three antimicrobial classes.

3.3. Prevalence of Tetracycline Resistance Genes

Campylobacter isolates (n = 114) were screened for the presence of tetracycline resistance genes (tetA, tetB, tetO, and tetS) by PCR. All 114 strains were positive for the tetO gene. The tetA, tetB, and tetS genes were not detected in these strains.

4. Discussion

Swine are considered significant reservoirs of Campylobacter, particularly C. coli and C. hyointestinalis, as the predominant species [14,15,39]. Species such as C. coli, C. jejuni, C. lari, and C. hyointestinalis, which are linked to gastrointestinal illness in humans, hold significant public health significance [15]. According to the CDC, Campylobacter is one of the four major causative agents of foodborne gastroenteritis in the US (https://www.cdc.gov/foodsafety/foodborne-germs.html; accessed on 16 November 2023) with foods of animal origin being the most common source. Moreover, there is a growing concern as Campylobacter spp., are increasingly developing resistance to antimicrobials employed in treating the infections, thereby presenting an additional threat to public health [40,41,42].
Several studies have reported the use of antimicrobials in conventional swine production farms in the US [43,44]. Tetracycline and tiamulin are among the most commonly used antimicrobials in swine production [18,20]. Tetracyclines are the leading antimicrobial class used in all production stages of swine in the US and globally [20,45]. Tiamulin is commonly used in the treatment of diseases in swine, especially weaners and growers [46]. The use of antimicrobials, including tetracycline and tiamulin, is associated with AMR in Campylobacter [44,47]. A study by Quintana-Hayashi et al. [48] recorded an association between the use of tetracyclines and the AMR of Campylobacter in nursery piglets. Similarly, one study observed that tiamulin metabolites select for AMR in C. coli [21].
The overall animal-level prevalence of Campylobacter in this study was 18.2% (262/1440). A study among piglets reported a prevalence of 27.6% in conventional farms as compared to 77.3% in antibiotic-free farms [43]. But this prevalence is relatively lower than what has been reported in grower pigs [49,50], in contrast to [51] findings that nursery piglets were more likely to get colonized with Campylobacter spp. than sows. The majority of the isolates in our study were C. hyointestinalis, 17.9% (258/1440), and C. coli, only 0.3% (4/1440). Indeed, C. hyointestinalis is commonly found in swine [52]. However, most studies conducted so far have primarily focused on C. jejuni and C. coli in swine. Nevertheless, there is a consensus that C. hyointestinalis is an emerging pathogen responsible for gastrointestinal illness in humans, underscoring its significance [53,54]. The low prevalence of C. coli recorded in this study was surprising. Many studies have shown C. coli to be the most prevalent Campylobacter spp., in swine [8,14,49,51,55]. C. coli and C. jejuni are both known to be associated with causing gastroenteritis in humans [49,54].
Campylobacter isolates were highly resistant to the critically important class of antimicrobials, the fluoroquinolones (ciprofloxacin) and quinolones (nalidixic acid). Similar results were recorded in other studies that have reported high resistance to ciprofloxacin and nalidixic acid [43,56]. In addition, the majority of Campylobacter isolates were resistant to a medically important antimicrobial, tetracycline. The presence of tetO in all the isolates tested accounts for the high resistance to tetracyclines (98.5%) observed in this study. The tetO gene is both chromosomally and plasmid-associated and can be transferred between bacteria of the same and different species [57]. The ability of the tetO gene to be transferred intraspecies and interspecies explains the high prevalence of Campylobacter species reported [10].
In this study, we evaluated the impact of in-feed versus in-water antimicrobial administration and non-treated controls on the fecal prevalence and antimicrobial susceptibilities of a foodborne pathogen, Campylobacter, in nursery piglets. We initially hypothesized that the oral route of administering antimicrobials has a higher impact on Campylobacter prevalence and resistance to antimicrobials. Indeed, increased resistance in the gut microbiota was observed when mice were orally treated with antibiotics compared to cases where parenteral routes were utilized [58]. In our study, neither in-feed nor in-water routes of antibiotic administration had a significant impact on the prevalence and AMR of Campylobacter compared to untreated controls. Similarly, treating piglets with either tiamulin or tetracycline or the combination of both did not significantly influence the prevalence and AMR of Campylobacter. Similar results were recorded by a study in which tetracycline administration in pigs was not associated with a change in the resistance of Campylobacter to tetracycline, ciprofloxacin, and erythromycin [55]. High Campylobacter resistances have been recorded even in antibiotic-free farms, indicating that the development of resistance to the pathogen does not necessarily result from antimicrobial usage [44,48].
In contrast, an increased tetracycline resistance of Campylobacter spp. following tetracycline treatment in animals was reported [50]. The speculation is that the lack of distinction between treatment groups may be attributed to either an influence of the environment or the stabilization of the microbiota in response to the presence of tiamulin and tetracycline. However, this was not investigated in this study.
The effect exerted by antimicrobials on gut pathogens could be influenced by the dosage used, distribution, and their ultimate concentration in the gut [59,60,61,62]. In this study, we used the dosages as per FDA guidance for the treatment or prevention of diseases [63]. The same dosage of chlortetracycline, 22 mg/kg BW, was provided in both in-feed and in-water administration, while for tiamulin, a 23 mg/kg BW dosage was applied in-feed and 5 mg/kg BW in-water. Furthermore, there exists a linear relationship between the dosage of antimicrobials and their concentrations in the gut t [64]. However, the dose of a drug is indirectly proportional to its bioavailability [65]. Hence, the comparable gut concentrations of tetracycline and tiamulin in both in-feed and in-water may account for the observed differences in the prevalence and AMR of bacteria. In addition, the two drugs, chlortetracycline and tiamulin, have enough concentrations in the gut, which explains their use in treating enteric infections [66]. Tetracyclines have low bioavailability, making a large amount of the drug remain in the gut and exerting its effects on gut bacteria, as documented in [66]. On the other end, tiamulin has high bioavailability and is metabolized quickly and excreted in the gut via bile to exert its effect on the gut microorganisms [67]. This implies that the impact of tiamulin might be more significant due to its higher bioavailability compared to tetracycline.
In summary, the route of administration of CTC and tiamulin did not significantly impact the prevalence and AMR of Campylobacter in the feces of piglets. In contrast to what is reported in many studies, C. hyointestinalis, and not C. coli, was the dominant species in the feces of piglets. A large number of Campylobacter strains were multidrug resistant and exhibited a wide range of resistance profiles that included resistance to a fluoroquinolone (ciprofloxacin), which is frequently used to treat Campylobacter infections. Because of the high prevalence of CTC resistance in Campylobacter in the herd, the impact of the route of administration could not be measured. Our research findings support pork producers as they seek to improve their herds’ economic health and promote the welfare of pigs and public health.

Author Contributions

Conceptualization, R.G.A. and T.G.N.; methodology, R.G.A., T.G.N. and M.D.T.; software, R.G.A. and Q.K.; formal analysis, R.G.A., V.L.I. and Q.K.; investigation, R.G.A., V.L.I. and X.S.; resources, R.G.A., T.G.N., M.D.T., J.D. and R.D.G.; writing—original draft preparation, V.L.I. and R.G.A.; writing—T.G.N., M.D.T., J.W., R.D.G. and J.D.; supervision, R.G.A.; project administration, R.G.A.; funding acquisition, R.G.A. and T.G.N. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Pork Board, grant number 19-028. This research was also supported in part by the USDA National Institute of Food and Agriculture, Hatch/Multistate Project 1014385.

Data Availability Statement

The data presented in this study are available in this article.

Acknowledgments

Contribution no. 24-073-J Kansas Agricultural Experiment Station, Kansas State University, Manhattan, KS.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. ECDC/EFSA/EMA. ECDC/EFSA/EMA first joint report on the integrated analysis of the consumption of antimicrobial agents and occurrence of antimicrobial resistance in bacteria from humans and food-producing animals. EFSA J. 2015, 13, 4006. [Google Scholar] [CrossRef]
  2. WHO. Urgent Health Challenges for the Next Decade. 2020. Available online: https://www.who.int/news-room/photo-story/photo-story-detail/urgent-health-challenges-for-the-next-decade (accessed on 27 November 2023).
  3. CDC. Antibiotic Resistance Threats in the United States; U.S. Department of Health and Human Services, CDC: Atlanta, GA, USA, 2019; Volume 114. [Google Scholar]
  4. O’Neill, J. Tackling drug-resistant infections globally: Final report and recommendations. Rev. Antimicrob. Resist. 2016, 1–84. Available online: https://amr-review.org/sites/default/files/160518_Finalpaper_withcover.pdf (accessed on 15 November 2023).
  5. Aarestrup, F.M. The livestock reservoir for antimicrobial resistance: A personal view on changing patterns of risks, effects of interventions and the way forward. Phil. Trans. R. Soc. B 2015, 370, 20140085. [Google Scholar] [CrossRef] [PubMed]
  6. FDA. Summary Report on Antimicrobials Sold or Distributed for Use in Food-Producing Animals. In Center for Veterinary Medicine; FDA: Silver Spring, MD, USA, 2019. Available online: https://www.fda.gov/media/144427/download (accessed on 15 November 2023).
  7. Scallan, E.; Hoekstra, R.M.; Angulo, F.J.; Tauxe, R.V.; Widdowson, M.A.; Roy, S.L.; Jones, J.L.; Griffin, P.M. Foodborne illness acquired in the United States-Major pathogens. Emerg. Infect. Dis. 2011, 17, 7–15. [Google Scholar] [CrossRef] [PubMed]
  8. Di Donato, G.; Marotta, F.; Nuvoloni, R.; Zilli, K.; Neri, D.; Di Sabatino, D.; Calistri, P.; Di Giannatale, E. Prevalence, population diversity and antimicrobial resistance of Campylobacter coli isolated in Italian swine at slaughterhouse. Microorganisms 2020, 8, 222. [Google Scholar] [CrossRef]
  9. Weijtens, M.J.B.M.; Reinders, R.D.; Urlings, H.A.P.; Van Der Plas, J. Campylobacter infections in fattening pigs; Excretion pattern and genetic diversity. J. Appl. Microbiol. 1999, 86, 63–70. [Google Scholar] [CrossRef]
  10. Thakur, S.; Gebreyes, W.A. Campylobacter coli in swine production: Antimicrobial resistance mechanisms and molecular epidemiology. J. Clin. Microbiol. 2005, 43, 5705–5714. [Google Scholar] [CrossRef]
  11. Fosse, J.; Seegers, H.; Magras, C. Prevalence and risk factors for bacterial food-borne zoonotic hazards in slaughter pigs: A Review. Zoonoses Public Health 2009, 56, 429–454. [Google Scholar] [CrossRef]
  12. Tang, Y.; Jiang, Q.; Tang, H.; Wang, Z.; Yin, Y.; Ren, F.; Kong, L.; Jiao, X.; Huang, J. Characterization and Prevalence of Campylobacter spp. from Broiler Chicken Rearing Period to the Slaughtering Process in Eastern China. Front. Vet. Sci. 2020, 7, 227. [Google Scholar] [CrossRef]
  13. Hakeem Mohammed, J.; Lu, X. Survival and Control of Campylobacter in Poultry Production Environment. Front. Cell. Infect. Microbiol. 2021, 10, 615049. [Google Scholar] [CrossRef]
  14. Facciolà, A.; Riso, R.; Avventuroso, E.; Visalli, G.; Delia, S.A.; Laganà, P. Campylobacter: From microbiology to prevention. J. Prev. Med. Hyg. 2017, 58, E79–E92. [Google Scholar]
  15. Carrique-Mas, J.J.; Bryant, J.E.; Cuong, N.V.; Hoang, N.V.; Campbell, J.; Hoang, N.V.; Dung, T.T.; Duy, D.T.; Hoa, N.T.; Thompson, C.; et al. An epidemiological investigation of Campylobacter in pig and poultry farms in the Mekong delta of Vietnam. Epidemiol. Infect. 2014, 142, 1425–1436. [Google Scholar] [CrossRef] [PubMed]
  16. Holman, D.B.; Chénier, M.R. Impact of subtherapeutic administration of tylosin and chlortetracycline on antimicrobial resistance in farrow-to-finish swine. FEMS Microbiol. Ecol. 2013, 85, 1–13. [Google Scholar] [CrossRef] [PubMed]
  17. Phillips, I.; Casewell, M.; Cox, T.; De Groot, B.; Friis, C.; Jones, R.; Nightingale, C.; Preston, R.; Waddell, J. Does the use of antibiotics in food animals pose a risk to human health? A critical review of published data. J. Antimicrob. Chemother. 2004, 53, 28–52. [Google Scholar] [CrossRef] [PubMed]
  18. Apley, M.D.; Bush, E.J.; Morrison, R.B.; Singer, R.S.; Snelson, H. Use estimates of in-feed antimicrobials in swine production in the United States. Foodborne Pathog. Dis. 2012, 9, 272–279. [Google Scholar] [CrossRef] [PubMed]
  19. Bøsling, J.; Poulsen, S.M.; Vester, B.; Long, K.S. Resistance to the peptidyl transferase inhibitor tiamulin caused by mutation of ribosomal protein L3. Antimicrob. Agents Chemother. 2003, 47, 2892–2896. [Google Scholar] [CrossRef] [PubMed]
  20. Lykkeberg, A.K.; Halling-Sørensen, B.; Jensen, L.B. Susceptibility of bacteria isolated from pigs to tiamulin and enrofloxacin metabolites. Vet. Microbiol. 2007, 121, 116–124. [Google Scholar] [CrossRef] [PubMed]
  21. Sjölund, M.; Backhans, A.; Greko, C.; Emanuelson, U.; Lindberg, A. Antimicrobial usage in 60 Swedish farrow-to-finish pig herds. Prev. Vet. Med. 2015, 121, 257–264. [Google Scholar] [CrossRef] [PubMed]
  22. Van Rennings, L.; Von Münchhausen, C.; Ottilie, H.; Hartmann, M.; Merle, R.; Honscha, W.; Käsbohrer, A.; Kreienbrock, L. Cross-sectional study on antibiotic usage in pigs in Germany. PLoS ONE 2015, 10, e0119114. [Google Scholar] [CrossRef]
  23. NAHMS Swine Study. Antimicrobial Use and Stewardship on U.S. Swine Operations. 2017. Available online: https://www.aphis.usda.gov/animal_health/nahms/downloads/amu-feedlots.pdf (accessed on 15 November 2023).
  24. Varga, C.; Rajić, A.; McFall, M.E.; Reid-Smith, R.J.; McEwen, S.A. Associations Among Antimicrobial Use and Antimicrobial Resistance of Salmonella spp. Isolates from 60 Alberta Finishing Swine Farms. Foodborne Pathog. Dis. 2009, 6, 23–31. [Google Scholar] [CrossRef]
  25. Lutz, E.A.; McCarty, M.J.; Mollenkopf, D.F.; Funk, J.A.; Gebreyes, W.A.; Wittum, T.E. Ceftiofur use in finishing swine barns and the recovery of fecal Escherichia coli or Salmonella spp. Resistant to ceftriaxone. Foodborne Pathog. Dis. 2011, 8, 1229–1234. [Google Scholar] [CrossRef]
  26. Burow, E.; Simoneit, C.; Tenhagen, B.A.; Käsbohrer, A. Oral antimicrobials increase antimicrobial resistance in porcine E. coli—A systematic review. Prev. Vet. Med. 2014, 113, 364–375. [Google Scholar] [CrossRef] [PubMed]
  27. Olah, P.A.; Doetkott, C.; Fakhr, M.K.; Logue, C.M. Prevalence of the Campylobacter multi-drug efflux pump (CmeABC) in Campylobacter spp. Isolated from freshly processed Turkeys. Food Microbiol. 2006, 23, 453–460. [Google Scholar] [CrossRef] [PubMed]
  28. Yamazaki-Matsune, W.; Taguchi, M.; Seto, K.; Kawahara, R.; Kawatsu, K.; Kumeda, Y.; Kitazato, M.; Nukina, M.; Misawa, N.; Tsukamoto, T. Development of a multiplex PCR assay for identification of Campylobacter coli, Campylobacter fetus, Campylobacter hyointestinalis subsp. hyointestinalis, Campylobacter jejuni, Campylobacter lari and Campylobacter upsaliensis. J. Med. Microbiol. 2007, 56, 1467–1473. [Google Scholar] [CrossRef] [PubMed]
  29. Linton, D.; Owen, R.J.; Stanley, J. Rapid identification by PCR of the genus Campylobacter and of five Campylobacter species enteropathogenic for man and animals. Res. Microbiol. 1996, 147, 707–718. [Google Scholar] [CrossRef] [PubMed]
  30. Inglis, G.D.; Kalischuk, L.D. Use of PCR for direct detection of Campylobacter species in bovine feces. Appl. Environ. Microbiol. 2003, 9, 3435–3447. [Google Scholar] [CrossRef]
  31. Linton, D.; Lawson, A.J.; Owen, R.J.; Stanley, J. PCR detection, identification to species level, and fingerprinting of Campylobacter jejuni and Campylobacter coli direct from diarrheic samples. J. Clin. Microbiol. 1997, 35, 2568–2572. [Google Scholar] [CrossRef] [PubMed]
  32. Hum, S.; Quinn, K.; Brunner, J.; On, S.L. Evaluation of a PCR assay for identification and differentiation of Campylobacter fetus subspecies. Aust. Vet. J. 1997, 75, 827–831. [Google Scholar] [CrossRef]
  33. Wang, G.; Clark, G.C.; Taylor, T.M.; Pucknell, C.; Barton, C.; Price, L.; Woodward, D.L.; Rodgers, F.G. Colony multiplex PCR assay for identification and differentation of Campylobacter jejuni, C. coli, C. lari, C. upsaliensis, and C. fetus subsp. fetus. J. Clin. Microbiol. 2002, 40, 4744–4747. [Google Scholar] [CrossRef]
  34. Wang, R.-F.; Slavik, M.F.; Cao, W.-W. A rapid PCR method for the detection of low numbers of Campylobacter jejuni. J. Rapid Methods Autom. Microbiol. 1992, 1, 101–108. [Google Scholar] [CrossRef]
  35. Abdi-Hachesoo, B.; Khoshbakht, R.; Sharifiyazdi, H.; Tabatabaei, M.; Hosseinzadeh, S.; Asasi, K. Tetracycline resistance genes in Campylobacter jejuni and C. coli isolated from poultry carcasses. Jundishapur J. Microbiol. 2014, 7, 7–11. [Google Scholar] [CrossRef]
  36. Ng, L.K.; Martin, I.; Alfa, M.; Mulvey, M. Multiplex PCR for the detection of tetracycline resistant genes. Mol. Cell. Probes 2001, 15, 209–215. [Google Scholar] [CrossRef] [PubMed]
  37. Garofalo, S.; Giovagnoli, S.; Orsoni, M.; Starita, F.; Benassi, M. Interaction effect: Are you doing the right thing? PLoS ONE 2022, 17, e0271668. [Google Scholar] [CrossRef]
  38. Anouschka, M.; Bas, K.; Elizabeth, B.J. Early feeding experiences of piglets and their impact on novel environment behaviour and food neophobia. Appl. Anim. Behav. Sci. 2020, 232, 105142. [Google Scholar] [CrossRef]
  39. Dorr, P.M.; Tadesse, D.A.; Zewde, B.M.; Fry, P.; Thakur, S.; Gebreyes, W.A. Longitudinal study of Salmonella dispersion and the role of environmental contamination in commercial swine production systems. Appl. Environ. Microbiol. 2009, 75, 1478–1486. [Google Scholar] [CrossRef] [PubMed]
  40. Portes, A.B.; Panzenhagen, P.; Pereira Dos Santos, A.M.; Junior, C.A.C. Antibiotic Resistance in Campylobacter: A Systematic Review of South American Isolates. Antibiotics 2023, 12, 548. [Google Scholar] [CrossRef] [PubMed]
  41. Zhang, Q.; Beyi, A.F.; Yin, Y. Zoonotic and antibiotic-resistant Campylobacter: A view through the One Health lens. One Health Adv. 2023, 1, 4. [Google Scholar] [CrossRef]
  42. Jennifer, M.N.; Tom, M.C.; John, H.P.; Frederick, J.A. Fluoroquinolone-Resistant Campylobacter Species and the Withdrawal of Fluoroquinolones from Use in Poultry: A Public Health Success Story. Clin. Infect. Dis. 2007, 44, 977–980. [Google Scholar] [CrossRef]
  43. Thakur, S.; Gebreyes, W.A. Prevalence and antimicrobial resistance of Campylobacter in antimicrobial-free and conventional pig production systems. J. Food Prot. 2005, 68, 2402–2410. [Google Scholar] [CrossRef]
  44. Rollo, S.N.; Norby, B.; Bartlett, P.C.; Scott, H.M.; Wilson, D.L.; Fajt, V.R.; Linz, J.E.; Bunner, C.E.; Kaneene, J.B.; Huber, J.C. Prevalence and patterns of antimicrobial resistance in Campylobacter spp. isolated from pigs reared under antimicrobial-free and conventional production methods in eight states in the Midwestern United States. J. Am. Vet. Med. Assoc. 2010, 236, 201–210. [Google Scholar] [CrossRef]
  45. Van Boeckel, T.P.; Brower, C.; Gilbert, M.; Grenfell, B.T.; Levin, S.A.; Robinson, T.P.; Teillant, A.; Laxminarayan, R. Global trends in antimicrobial use in food animals. Proc. Natl. Acad. Sci. USA 2015, 112, 5649–5654. [Google Scholar] [CrossRef]
  46. Jensen, V.F.; Emborg, H.D.; Aarestrup, F.M. Indications and patterns of therapeutic use of antimicrobial agents in the Danish pig production from 2002 to 2008. J. Vet. Pharmacol. Ther. 2012, 35, 33–46. [Google Scholar] [CrossRef] [PubMed]
  47. Hlashwayo, D.F.; Sigaúque, B.; Bila, C.G. Epidemiology and antimicrobial resistance of Campylobacter spp. in animals in Sub-Saharan Africa: A systematic review. Heliyon 2020, 6, e03537. [Google Scholar] [CrossRef] [PubMed]
  48. Quintana-Hayashi, M.P.; Thakur, S. Longitudinal study of the persistence of antimicrobial-resistant Campylobacter strains in distinct Swine production systems on farms, at slaughter, and in the environment. Appl. Environ. Microbiol. 2012, 78, 2698–2705. [Google Scholar] [CrossRef]
  49. Varela, N.P.; Friendship, R.M.; Dewey, C.E. Prevalence of Campylobacter spp. isolated from grower-finisher pigs in Ontario. Can. Vet. J. 2007, 48, 515–517. [Google Scholar] [PubMed]
  50. Asai, T.; Harada, K.; Ishihara, K.; Kojima, A.; Sameshima, T.; Tamura, Y.; Takahashi, T. Association of antimicrobial resistance in Campylobacter isolated from food-producing animals with antimicrobial use on farms. Jpn. J. Infect. Dis. 2007, 60, 290–294. [Google Scholar] [PubMed]
  51. Kempf, I.; Kerouanton, A.; Bougeard, S.; Nagard, B.; Rose, V.; Mourand, G.; Osterberg, J.; Denis, M.; Bengtsson, B.O. Campylobacter coli in organic and conventional pig production in France and Sweden: Prevalence and antimicrobial resistance. Front. Microbiol. 2017, 8, 955. [Google Scholar] [CrossRef] [PubMed]
  52. Papadopoulos, D.; Petridou, E.; Filioussis, G.; Papadopoulos, T.; Papageorgiou, K.; Chatzistilianou, M.; Kritas, S.K. Prevalence and antibiotic resistance of Campylobacter coli and Campylobacter jejuni in Greek swine farms. Am. J. Microbiol. Immunol. 2020, 5, 6. [Google Scholar] [CrossRef]
  53. Allos, B.M.; Iovine, N.M.; Blaser, M.J. Campylobacter jejuni and Related Species. Bennett’s Princ. Pract. Infect. Dis. 2015, 2, 2485–2493. [Google Scholar] [CrossRef]
  54. Gorkiewicz, G.; Feierl, G.; Zechner, R.; Zechner, E.L. Transmission of Campylobacter hyointestinalis from a pig to a human. J. Clin. Microbiol. 2002, 40, 2601–2605. [Google Scholar] [CrossRef]
  55. Gebreyes, W.A.; Thakur, S.; Morrow, W.E.M. Campylobacter coli: Prevalence and antimicrobial resistance in antimicrobial-free (ABF) swine production systems. J. Antimicrob. Chemother. 2005, 56, 765–768. [Google Scholar] [CrossRef]
  56. Taylor, D.E.; Courvalin, P. Mechanisms of Antibiotic Resistance in Campylobacter Species. Antimicrob. Agents Chemother. 1988, 32, 1107–1112. [Google Scholar] [CrossRef] [PubMed]
  57. Juntunen, P.; Laurila, T.; Heinonen, M.; Hänninen, M.L. Absence of tetracycline resistance in Campylobacter coli isolates from Finnish finishing pigs treated with chlortetracycline. J. Appl. Microbiol. 2013, 114, 974–981. [Google Scholar] [CrossRef] [PubMed]
  58. Zhang, L.; Huang, Y.; Zhou, Y.; Buckley, T.; Wang, H.H. Antibiotic administration routes significantly influence the levels of antibiotic resistance in gut microbiota. Antimicrob. Agents Chemother. 2013, 57, 3659–3666. [Google Scholar] [CrossRef] [PubMed]
  59. Langdon, A.; Crook, N.; Dantas, G. The effects of antibiotics on the microbiome throughout development and alternative approaches for therapeutic modulation. Genome Med. 2016, 8, 39. [Google Scholar] [CrossRef] [PubMed]
  60. Zheng, D.; Liwinski, T.; Elinav, E. Interaction between microbiota and immunity in health and disease. Cell Res. 2020, 30, 492–506. [Google Scholar] [CrossRef] [PubMed]
  61. Gough, E.K. The impact of mass drug administration of antibiotics on the gut microbiota of target populations. Infect. Dis. Poverty 2022, 11, 76. [Google Scholar] [CrossRef] [PubMed]
  62. Ce, H.; Shengyu, F.; Fengjiao, H.; Hailiang, L. Effects of Four Antibiotics on the Diversity of the Intestinal Microbiota. Microbiol. Spectr. 2022, 10, e01904-21. [Google Scholar] [CrossRef]
  63. FDA. Food and Drug Administration. CFR—Code of Federal Regulations Title 21. Www.Fda.Gov. 2020. Available online: https://www.accessdata.fda.gov/scripts/cdrh/cfdocs/cfCFR/CFRSearch.cfm?fr=170.3&SearchTerm=170.3 (accessed on 15 November 2023).
  64. Peeters, L.E.J.; Daeseleire, E.; Devreese, M.; Rasschaert, G.; Smet, A.; Dewulf, J.; Heyndrickx, M.; Imberechts, H.; Haesebrouck, F.; Butaye, P.; et al. Residues of chlortetracycline, doxycycline and sulfadiazine-trimethoprim in intestinal content and feces of pigs due to cross-contamination of feed. BMC Vet. Res. 2016, 12, 209. [Google Scholar] [CrossRef]
  65. Price, G.; Patel, D.A. Drug Bioavailability. In StatPearls [Internet]; StatPearls Publishing: Treasure Island, FL, USA, 2023. [Google Scholar]
  66. Cybulski, P.; Gajda, A.; Bilecka, M.; Jabłoński, A. Determination of Tiamulin Concentration in Sow Milk and in Sera of Suckling Piglets. Molecules 2023, 28, 6940. [Google Scholar] [CrossRef]
  67. Burch, D.G.S. Pharmacokinetics Pharmacodynamics of Denagard® and Econor®; and Their Use for Enteric and Respiratory Disease Control in Pigs. 2012. Available online: http://www.octagon-services.co.uk/articles/therapeutics.pdf (accessed on 15 November 2023).
Table 1. Gene targets, primer sequences, and amplicon sizes were used for the speciation of Campylobacter isolated from piglets administered with in-feed or in-water chlortetracycline (CTC) and/or tiamulin.
Table 1. Gene targets, primer sequences, and amplicon sizes were used for the speciation of Campylobacter isolated from piglets administered with in-feed or in-water chlortetracycline (CTC) and/or tiamulin.
SpeciesPrimerTarget GeneSequence (5′ to 3′)Amplicon SizeReference
Genus
Campylobacter
C412F
C1228R
16S rRNA5′-GGATGACACTTTTCGGAGC-3′
5′-CATTGTAGCACGTGTGTC-3′
816[29]
C. hyointestinalis
subsp. hyointestinalis
HYO1F HYOFET23SR23S rRNA5′-ATAATCTAGGTGAGAATCCTAG-3′
5′-GCTTCGCATAGCTAACAT-3′
611[30]
C. coliCC18F CC519RaskD5′-GGTATGATTTCTACAAAGCGAG-3′
5′-ATAAAAGACTATCGTCGCGTG-3′
502[31]
C. fetusMG3F CF359RcstA5′-GGTAGCCGCAGCTGCTAAGAT-3′
5′-AGCCAGTAACGCATATTATAGTAG-3′
359[32]
C. lariCLF CLRglyA5′-TAGAGAGATAGCAAAAGAGA-3′
5′-TACACATAATAATCCCACCC-3′
251[33]
C. jejuniC-1 C-3cj04145′-CAAATAAAGTTAGAGGTAGAATGT-3′
5′-CCATAAGCACTAGCTAGCTGAT-3′
161[34]
C. upsaliensisCU61F CU146RlpxA5′-CGATGATGTGCAAATTGAAGC-3′
5′-TTCTAGCCCCTTGCTTGATG-3′
86[28]
Table 2. Target genes, primer sequences, and amplicon sizes used for detection of tet (A, B, O, and S) resistance genes in Campylobacter isolated from piglets administered with in-feed or in-water chlortetracycline (CTC) and/or tiamulin.
Table 2. Target genes, primer sequences, and amplicon sizes used for detection of tet (A, B, O, and S) resistance genes in Campylobacter isolated from piglets administered with in-feed or in-water chlortetracycline (CTC) and/or tiamulin.
PrimerTarget GeneSequence (5′ to 3′)Amplicon (bp)Reference
tetA-Ftet(A)GTGAAACCCAACATACCCC888[35,36]
tetA-R GAAGGCAAGCAGGATGTAG
tetB-Ftet(B)CCTTATCATGCCAGTCTTGC774[35,36]
tetB-R ACTGCCGTTTTTTCGCC
tetS-Ftet(S)CATAGACAAGCCGTTGACC667[35,36]
tetS-R ATG TTT TTG GAA CGC CAG AG
tetO-F
tetO-R
tet(O)AACTTAGGCATTCTGGCTCAC
TCCCACTGTTCCATATCGTCA
515[35,36]
Table 3. Animal-level fecal prevalence of Campylobacter in piglets administered with in-feed or in-water chlortetracycline (CTC) and/or tiamulin (n = 1440).
Table 3. Animal-level fecal prevalence of Campylobacter in piglets administered with in-feed or in-water chlortetracycline (CTC) and/or tiamulin (n = 1440).
Treatment GroupsTreatment Phases
Pre-TreatmentTreatmentPost-TreatmentTreatment Total (%)
Week 1Week 2Week 3Week 4Week 5Week 6
Control1289151349 (20.4)
In-feed CTC05612111852 (21.7)
In-water CTC2343121437 (15.4)
In-feed Tiamulin01511191753 (22.1)
In-water Tiamulin0232141334 (14.2)
In-Feed CTC + Tiamulin035713937 (15.4)
Weekly Total (%)3 (1.3)16 (6.7)31 (12.9)44 (18.3)84 (35.0)84 (35.0)
Total (%)19 (4.0)75 (15.6)168 (35)262 (18.2)
Table 4. Treatment effects on the fecal prevalence (main effects) of Campylobacter in piglets administered with in-feed or in-water chlortetracycline (CTC) and/or tiamulin (n = 1440).
Table 4. Treatment effects on the fecal prevalence (main effects) of Campylobacter in piglets administered with in-feed or in-water chlortetracycline (CTC) and/or tiamulin (n = 1440).
Comparison to Control
EndpointTreatmentPrevalence +/− S.E.Odds Ratio
(p-Value for Testing Odds Ratio = 1)
CampylobacterControl0.274 +/− 0.048-
(n = 262)In-feed CTC0.273 +/− 0.0490.99 (0.987)
In-water CTC0.172 +/− 0.040.55 (0.105)
In-feed Tiamulin0.306 +/− 0.0521.16 (0.655)
In-water Tiamulin0.153 +/− 0.040.48 (0.057)
In-feed CTC + Tiamulin0.199 +/− 0.0410.66 (0.235)
C. hyointestinalisControl0.275 +/− 0.047-
(n = 258)In-feed CTC0.268 +/− 0.0490.97 (0.923)
In-water CTC0.174 +/− 0.040.56 (0.109)
In-feed Tiamulin0.308 +/− 0.0521.17 (0.639)
In-water Tiamulin0.153 +/− 0.040.48 (0.056)
In-feed CTC + Tiamulin0.198 +/− 0.0410.65 (0.221)
Table 5. Interaction effect of treatment vs. sampling day on the prevalence of Campylobacter in piglets administered with in-feed or in-water chlortetracycline (CTC) and/or tiamulin (n = 1440).
Table 5. Interaction effect of treatment vs. sampling day on the prevalence of Campylobacter in piglets administered with in-feed or in-water chlortetracycline (CTC) and/or tiamulin (n = 1440).
EndpointTreatmentSampling DayPrevalence +/− S.E.Odds Ratio
(p-Value for Testing Odds Ratio = 1)
Comparison to
Day 14Day 21Day 28
CampylobacterControlDay 140.198 +/− 0.0680.86 (0.784)0.41 (0.086)0.52 (0.205)
(n = 262) Day 210.223 +/− 0.071--0.48 (0.144)0.60 (0.316)
Day 280.375 +/− 0.085----1.25 (0.637)
Day 350.324 +/− 0.082------
In-feed CTCDay 140.143 +/− 0.0580.41 (0.111)0.46 (0.173)0.21 (0.004)
Day 210.292 +/− 0.08--1.13 (0.803)0.52 (0.164)
Day 280.267 +/− 0.077----0.46 (0.103)
Day 350.444 +/− 0.089------
In-water CTCDay 140.097 +/− 0.0481.37 (0.692)0.26 (0.031)0.20 (0.011)
Day 210.073 +/− 0.042--0.19 (0.016)0.15 (0.005)
Day 280.296 +/− 0.079----0.79 (0.630)
Day 350.347 +/− 0.083------
In-feed TiamulinDay 140.125 +/− 0.0550.37 (0.100)0.16 (0.001)0.19 (0.004)
Day 210.276 +/− 0.078--0.42 (0.066)0.51 (0.160)
Day 280.479 +/− 0.089----1.23 (0.651)
Day 350.428 +/− 0.088------
In-water TiamulinDay 140.074 +/− 0.0431.54 (0.646)0.15 (0.006)0.17 (0.009)
Day 210.049 +/− 0.035--0.10 (0.003)0.11 (0.005)
Day 280.35 +/− 0.084----1.12 (0.812)
Day 350.324 +/− 0.082------
In-feed CTC + TiamulinDay 140.122 +/− 0.0540.67 (0.531)0.29 (0.037)0.49 (0.242)
Day 210.171 +/− 0.063--0.44 (0.123)0.73 (0.575)
Day 280.322 +/− 0.082----1.67 (0.315)
Day 350.221 +/− 0.071------
C. hyointestinalisControlDay 140.199 +/− 0.0680.86 (0.784)0.41 (0.086)0.52 (0.205)
(n = 258) Day 210.224 +/− 0.071--0.48 (0.144)0.60 (0.316)
Day 280.375 +/− 0.085----1.25 (0.638)
Day 350.325 +/− 0.082------
In-feed CTCDay 140.14 +/− 0.0570.40 (0.110)0.46 (0.173)0.21 (0.004)
Day 210.287 +/− 0.079--1.13 (0.803)0.52 (0.163)
Day 280.262 +/− 0.076----0.46 (0.102)
Day 350.438 +/− 0.089------
In-water CTCDay 140.098 +/− 0.0491.37 (0.692)0.26 (0.031)0.20 (0.011)
Day 210.073 +/− 0.042--0.19 (0.016)0.15 (0.005)
Day 280.299 +/− 0.08----0.79 (0.631)
Day 350.349 +/− 0.084------
In-feed TiamulinDay 140.126 +/− 0.0560.37 (0.100)0.16 (0.001)0.19 (0.004)
Day 210.278 +/− 0.078--0.42 (0.066)0.51 (0.160)
Day 280.481 +/− 0.088----1.23 (0.651)
Day 350.431 +/− 0.088------
In-water TiamulinDay 140.074 +/− 0.0431.54 (0.646)0.15 (0.006)0.17 (0.009)
Day 210.049 +/− 0.035--0.10 (0.003)0.11 (0.005)
Day 280.35 +/− 0.083----1.12 (0.812)
Day 350.325 +/− 0.082------
In-feed CTC + TiamulinDay 140.121 +/− 0.0540.67 (0.531)0.29 (0.037)0.49 (0.242)
Day 210.17 +/− 0.063--0.44 (0.123)0.73 (0.574)
Day 280.32 +/− 0.081----1.67 (0.315)
Day 350.199 +/− 0.0680.86 (0.784)0.41 (0.086)0.52 (0.205)
Table 6. Prevalence and MIC* distributions of Campylobacter isolates in piglets administered with in-feed or in-water chlortetracycline (CTC) and/or tiamulin (n = 262).
Table 6. Prevalence and MIC* distributions of Campylobacter isolates in piglets administered with in-feed or in-water chlortetracycline (CTC) and/or tiamulin (n = 262).
AntimicrobialsResistant Breakpoints% Resistant0.0150.030.060.120.250.51248163264128256
Azithromycin≥15111319723330123213
Ciprofloxacin≥189.3 101110624820416
Clindamycin≥23.1 281044163451133
Erythromycin≥163.4 221093915316411114
Florfenicol≥81.2 1182132241111
Gentamicin≥48 28925109704211
Nalidixic Acid≥3260.3 5998672
Telithromycin≥81.926471815252714
Tetracycline≥498.5 1111414758679
MIC* = Minimal inhibitory concentration; Note: The top dilution tested for each drug should be interpreted as ≥ and the lowest dilution tested for each drug as ≤.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ishengoma, V.L.; Amachawadi, R.G.; Tokach, M.D.; Shi, X.; Kang, Q.; Goodband, R.D.; DeRouchey, J.; Woodworth, J.; Nagaraja, T.G. Impact of In-Feed versus In-Water Chlortetracycline and Tiamulin Administrations on Fecal Prevalence and Antimicrobial Susceptibilities of Campylobacter in a Population of Nursery Pigs. Microorganisms 2023, 11, 2876. https://doi.org/10.3390/microorganisms11122876

AMA Style

Ishengoma VL, Amachawadi RG, Tokach MD, Shi X, Kang Q, Goodband RD, DeRouchey J, Woodworth J, Nagaraja TG. Impact of In-Feed versus In-Water Chlortetracycline and Tiamulin Administrations on Fecal Prevalence and Antimicrobial Susceptibilities of Campylobacter in a Population of Nursery Pigs. Microorganisms. 2023; 11(12):2876. https://doi.org/10.3390/microorganisms11122876

Chicago/Turabian Style

Ishengoma, Victor L., Raghavendra G. Amachawadi, Mike D. Tokach, Xiaorong Shi, Qing Kang, Robert D. Goodband, Joel DeRouchey, Jason Woodworth, and Tiruvoor G. Nagaraja. 2023. "Impact of In-Feed versus In-Water Chlortetracycline and Tiamulin Administrations on Fecal Prevalence and Antimicrobial Susceptibilities of Campylobacter in a Population of Nursery Pigs" Microorganisms 11, no. 12: 2876. https://doi.org/10.3390/microorganisms11122876

APA Style

Ishengoma, V. L., Amachawadi, R. G., Tokach, M. D., Shi, X., Kang, Q., Goodband, R. D., DeRouchey, J., Woodworth, J., & Nagaraja, T. G. (2023). Impact of In-Feed versus In-Water Chlortetracycline and Tiamulin Administrations on Fecal Prevalence and Antimicrobial Susceptibilities of Campylobacter in a Population of Nursery Pigs. Microorganisms, 11(12), 2876. https://doi.org/10.3390/microorganisms11122876

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop