Next Article in Journal
Acknowledgment to the Reviewers of Microorganisms in 2022
Next Article in Special Issue
HexR Transcription Factor Contributes to Pseudomonas cannabina pv. alisalensis Virulence by Coordinating Type Three Secretion System Genes
Previous Article in Journal
Flavonoid Derivatives as New Potent Inhibitors of Cysteine Proteases: An Important Step toward the Design of New Compounds for the Treatment of Leishmaniasis
Previous Article in Special Issue
Beyond Destabilizing Activity of SAP11-like Effector of Candidatus Phytoplasma mali Strain PM19
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Colletotrichum truncatum Causing Anthracnose of Tomato (Solanum lycopersicum L.) in Malaysia

by
Saleh Ahmed Shahriar
1,
Asmaul Husna
1,
Terna Tersoo Paul
2,
Most. Nurjahan Khatun Eaty
3,
Md Quamruzzaman
4,
Abu Bakar Siddique
4,
Md Abdur Rahim
5,
Abu Noman Faruq Ahmmed
6,
Jasim Uddain
7 and
Shafiquzzaman Siddiquee
8,*
1
School of Biological Sciences, Universiti Sains Malaysia, Gelugor 11800, Penang, Malaysia
2
Department of Plant Science and Biotechnology, Federal University of Lafia, PMB 146, Lafia 950101, Nasarawa State, Nigeria
3
College of Agricultural Sciences, IUBAT–International University of Business Agriculture and Technology, Dhaka 1230, Bangladesh
4
Tasmanian Institute of Agriculture, University of Tasmania, Prospect 7250, Australia
5
Department of Genetics and Plant Breeding, Sher-e-Bangla Agricultural University, Dhaka 1207, Bangladesh
6
Department of Plant Pathology, Sher-e-Bangla Agricultural University, Dhaka 1207, Bangladesh
7
Department of Horticulture, Sher-e-Bangla Agricultural University, Dhaka 1207, Bangladesh
8
Biotechnology Research Institute, Universiti Malaysia Sabah, Kota Kinabalu 88400, Sabah, Malaysia
*
Author to whom correspondence should be addressed.
Microorganisms 2023, 11(1), 226; https://doi.org/10.3390/microorganisms11010226
Submission received: 28 December 2022 / Revised: 9 January 2023 / Accepted: 9 January 2023 / Published: 16 January 2023
(This article belongs to the Special Issue Molecular Interactions between Plant Pathogens and Crops)

Abstract

Tomato (Solanum lycopersicum L.) is a popular nutritious vegetable crop grown in Malaysia and other parts of the world. However, fungal diseases such as anthracnose pose significant threats to tomato production by reducing the fruit quality and food value of tomato, resulting in lower market prices of the crop globally. In the present study, the etiology of tomato anthracnose was investigated in commercial tomato farms in Sabah, Malaysia. A total of 22 fungal isolates were obtained from anthracnosed tomato fruits and identified as Colletotrichum species, using morphological characteristics. The phylogenetic relationships of multiple gene sequence alignments such as internal transcribed spacer (ITS), β-tubulin (tub2), glyceraldehyde 3-phosphate dehydrogenase (gapdh), actin (act), and calmodulin (cal), were adopted to accurately identify the Colletotrichum species as C. truncatum. The results of pathogenicity tests revealed that all C. truncatum isolates caused anthracnose disease symptoms on inoculated tomato fruits. To our knowledge, the present study is the first report of tomato anthracnose caused by C. truncatum in Malaysia. The findings of this study will be helpful in disease monitoring, and the development of strategies for effective control of anthracnose on tomato fruits.

1. Introduction

Tomato (Solanum lycopersicum L.) belongs to the Solanaceae family, and is popular for its huge nutritious and economic value. A variety of diseases attack tomato fruits and plants, including major fungal diseases that threaten tomato production globally, such as anthracnose, early blight, late blight, leaf mold, septoria leaf spot, powdery mildew, fusarium wilt, and verticilium wilt [1]. Colletotrichum spp. are important plant pathogens, causing anthracnose diseases in a diverse range of host plants, including vegetables, fruits, legumes, cereals, herbaceous, conifers, woody, and ornamental plants, at both developing and mature stages of plant growth [2,3,4]. Some taxa are restricted to certain host species, or cultivars, while others have extensive host ranges [2,4,5]. Colletotrichum spp. are commonly associated with tomato anthracnose of which C. truncatum has been reported as an emerging pathogen causing huge yield losses of tomato annually.
Differentiation of Colletotrichum spp. on the basis of host associations alone is not a reliable criterion for species identification, because a few taxa such as C. acutatum, C. dematium, and C. gloeosporioides, infect a wide range of plant hosts. Therefore, taxonomic classification of Colletotrichum species has primarily focused on identification and characterization of sub-populations within the species [6,7,8]. The conventional identification and characterisation of Colletotrichum species mainly relied on morphological differences of wide variety of isolates from ample ranges of host crops. However, morphological characteristics alone are also not reliable for identification of Colletotrichum species, due to a variety of variables such as the environment, which influences the stability of the morphological traits and the coexistence of intermediate forms in nature [9].
PCR tests and DNA sequence alignments from multiple genes have been widely utilized to overcome the limitations of morphological characterisation in accurate species delineation [10], and data generated from nucleic acid tests have provided a reliable framework for building the taxonomic classification of Colletotrichum species [11]. A study by Photita et al. [12], showed that sequence analysis based on ITS regions are helpful in determining the phylogenetic relationships within the Colletotrichum species [12]. Apart from the ITS region, partial tub2, gapdh, act and cal genes sequence analyses have also been employed to resolve the phylogenetic relationships within the C. truncatum species [13,14]. The utilisation of morphological studies coupled with sophisticated molecular data has proven to be an efficient method in identifying C. truncatum isolates and has increased the understanding of its taxonomy [2,9]. Thus, in the present study, polyphasic identification involving morphological and molecular characterisation was adopted for the substantive identification of C. truncatum isolates recovered from diseased tomato fruits. Pathogenicity tests were also conducted to assess the pathogenic ability of the C. truncatum isolates on artificially inoculation tomato fruits.

2. Materials and Methods

2.1. Sample Collection and Fungal Isolation

Tomato fruit samples showing typical anthracnose symptoms were collected from three commercial tomato gardens in Sabah, Malaysia. The samples were placed in zip-lock plastic bags, and conveyed to the Biotechnology laboratory of Universiti Malaysia Sabah for fungal isolation. Diseased tissues were cut into smaller pieces of about 1 cm2, and surface-sterilised by soaking in 70% ethanol for 3 min, followed by 1% sodium hypochlorite for 3 min, and rinsed for 1 min each in three changes of sterile distilled water. The sterilised samples were then placed on sterile potato dextrose agar (PDA) medium and incubated under room temperature (25 ± 2 °C) for one week, to obtain fungal mycelial growths. The resulting fungal mycelia were sub-cultured on new PDA plates, and pure cultures of fungal isolates were obtained following the single conidium isolation method previously reported by Zhang et al. [15].

2.2. Morphological Characteristics

Fungal isolates obtained were cultured onto PDA plates and incubated at 25 ± 2 °C for 7 days. The macroscopic characteristics such as colony appearance; pigmentation; and mycelial growth rate were recorded. For microscopic characteristics, the arrangement, shape, and size of acervuli; conidia; conidiogenous cells; appressoria; and setae were examined. Preliminary identification was in accordance with the fungal descriptions of Cabrera et al. [16].

2.3. Extraction of Genomic DNA, PCR Amplification, and DNA Sequencing

All isolates were cultured on potato dextrose broth (PDB) and incubated at 25 ± 2 °C for 5 days. After incubation, the fungal mycelia were harvested from the broth cultures, dried on sterile filter papers, and homogenized into fine powder, using liquid nitrogen. A total of 60 mg of the fine powder was transferred into a 1.5 mL microcentrifuge tube for DNA extraction using Invisorb Spin Plant Mini Kit (Stratec, Birkenfeld, Germany), following the manufacturer’s instructions. DNA samples were preserved at –20 °C for PCR amplifications. The extracted genomic DNA samples were subjected to PCR amplifications in Thermal Cycler (Biorad, Hercules, CA, USA) using five primer pairs, ITS (ITS1/ITS4), tub2 (Bt2a/Bt2b), gapdh (GDF1/GDR1), act (ACT-512F/ACT-783R) and cal (CAL-228F/CAL-737R) (The primer sequences are provided in Table 1). The amplification reactions were carried out in a total volume of 50 μL consisting 8 μL Green GoTaq® Flexi Buffer (Promega, Madison, WI, USA), 8 μL MgCl2 solution (Promega, Wisconsin, USA), 1 μL dNTP mix (Promega, Wisconsin, USA), 8 μL of each primer (Promega, USA), 0.3 μL GoTaq® DNA polymerase (Promega, Wisconsin, USA), 1 μL genomic DNA, and sterile distilled water to make up a total volume of 50 μL.
PCR reactions were carried out in a MyCyclerTM Thermal Cycler (Bio-rad, Hercules, CA, USA), with initial denaturation at 95 °C for 5 min, followed by 32 cycles of denaturation at 95 °C for 30 s, annealing at 56 °C for 30 s, and extension at 72 °C for 1 min. Final extension was performed at 72 °C for 10 min. The PCR products were detected in agarose gel electrophoresis (1%), and sent to a service provider (First BASE Laboratories Sdn Bhd, Seri Kembangan, Malaysia) for DNA purification and sequencing.

2.4. Sequences Alignment, BLAST, and Phylogenetic Analysis

The forward and reverse DNA sequences obtained were aligned using the Molecular Evolutionary Genetics Analysis (MEGA) software, version 11, to create a consensus sequence for each isolate [22]. The identity of the fungal isolates was determined based on the highest percentage of sequence similarity on GenBank, using the Basic Local Alignment Search Tool (BLAST). Multiple sequence alignments of ITS region, tub2, gapdh, act and cal genes were performed to determine the fungal species and their phylogenetic relationships. The phylogenetic tree was constructed using the maximum likelihood (ML) method on the MEGA11 software. For the ML method, a model test was run to select the best nucleotide substitution model. Kimura 2-parameter + gamma distribution (K2 + G) model was adopted to construct a robust phylogenetic tree, and the robustness of the tree was evaluated using a bootstrap analysis with 1000 replicates.

2.5. Pathogenicity Assays

The pathogenicity of all obtained fungal isolates was assessed on healthy fruits of tomato using the wound inoculation method previously described by Cabrera et al. [16].
Fungal isolates were cultured on PDA for 7 days at 25 ± 2 °C, and fungal conidial suspensions were prepared by flooding the culture plates with sterile distilled water. A sterilized glass spreader was used to extricate conidia, and the concentration was adjusted to 1 × 106 conidia/mL using a haemocytometer (Weber, Teddington, UK). Prior to inoculation of wounded fruits, disease-free fruits of tomato were surface-sterilized by swabbing with 70% ethanol, the surface-sterile fruits were wounded by pricking with a sterile toothpick, and inoculated by applying sterile cotton wools immersed in the prepared conidial suspensions (~200 μL) at the wounded sites. Wounded fruits inoculated with sterile distilled water served as control.
All inoculated fruits were placed in a plastic tray and sealed with a transparent plastic wrap. The trays were kept humid by placing petridishes containing water inside the tray to maintain approximately 80% relative humidity. Symptoms that developed on inoculated fruits were observed and recorded. After 7 days of inoculation, the lesion area was measured and recorded. Differences in the lesion area were determined by one-way analysis of variance, and means were compared by the Tukey’s test at 5% level of probability, using the IBM SPSS Statistics software version 26. Fungal isolates were re-isolated from the symptomatic inoculated fruits of tomato and re-identified based on the morphological characteristics of the original cultures to confirm Koch’s postulates.

3. Results

3.1. Disease Survey

Typical symptoms of anthracnose disease were observed on tomato fruits (Figure 1). Fruit symptoms began as small, dark, sunken lesions that had a water-soaked appearance, which increased in diameter and coalesced, leaving a larger sunken soft area. Lesions on ripe fruits became visible within one week of infection.

3.2. Fungal Isolation and Morphological Characterisation

A total of 22 fungal isolates were recovered from tomato fruits showing anthracnose symptoms, and identified as Colletotrichum spp. through examination of macro- and microscopic characteristics. The colony was greenish-white, and pigmentation was greyish-white in color (Figure 2A,B). The average growth rate among the fungal isolates varied from 1.21 ± 0.27 to 1.67 ± 0.34 cm/d. Acervuli were scattered, irregularly shaped, and dark brown to black in color (Figure 2C). Conidia were hyaline, aseptate, and fusiform to rarely cylindrical, with the average size 13.4 to 18.9 × 5.2 to 7.3 µm (Figure 2D). Conidiogenous cells were hyaline, short, aseptate, and cylindrical, with sizes ranging from 11.2 to 16.33 × 4.6 to 5.7 µm (Figure 2E). Appressoria were simple, smooth, clavate to ovate, and dark brown, with sizes ranging from 10.2 to 14.6 × 7.6 to 9.4 µm (Figure 2F). Seta was dark brown, with tip more or less acute and acircular, ranging from 74.6 to 112.4 µm in size (Figure 2G).

3.3. Molecular Identification and Phylogenetic Analysis

Molecular identification based on the concatenated alignments of the ITS region, tub2, gapdh, act, and cal genes confirmed the identification of 22 fungal isolates collected from anthracnose symptomatic fruits of tomato. Based on the BLAST search, all the fungal isolates showed 99–100% sequence similarity to the isolates GQ485593 (ITS), GQ849429 (tub2), GQ856753 (gapdh), GQ856783 (act), and GQ849453 (cal) of C. truncatum (CBS 120709). The accession numbers of all the DNA sequences of the fungal isolates obtained in the present study are listed in Table 2.
The phylogenetic tree derived from the combined ITS, tub2, gapdh, act, and cal sequences of C. truncatum showed that all 22 fungal isolates were clustered along with the reference strains of C. truncatum (CBP002, CBS 120709, CSSX9, and LJTJ12). The clade was supported by a bootstrap value of 100% (Figure 3).

3.4. Pathogenicity Assays

All the tested isolates of Colletotrichum truncatum were pathogenic on the tomato fruits by causing anthracnose lesions varying in size from 1.03 ± 0.13 to 1.46 ± 0.17 cm2 after 7 days of inoculation (Table 3). Symptoms of anthracnose and lesion sizes among the isolates of C. truncatum were significantly different (p ˂ 0.05). Initially, the inoculated tomato fruits showed small, circular to irregular dark chlorotic lesions, but After 7 days, the symptoms appeared as darker, sunken, and circular lesions, with the formation of concentric rings in the middle of the symptomatic areas which were similar to the field conditions (Figure 4A,B). The control experiments were asymptomatic (Figure 4C). The same fungal isolates were re-isolated from the symptomatic inoculated fruits of tomato, thus confirming C. truncatum as the pathogenic agent of anthracnose of tomato in Malaysia.

4. Discussion

A total of 22 fungal isolates associated with anthracnose of tomato fruits in the present study were identified as Colletotrichum truncatum through morphological and molecular characterisation. Although morphological characteristics are sufficient to distinguish between Colletotrichum species and fungi of other genera, inter-specific discrimination within the genus is often difficult as a result of overlaps in configuration of morphological features among identical Colletotrichum species [23,24,25]. This implies that the identification of Colletotrichum species only based on morphological distinctions may result in uncertainties in delineation of the genus [9,14].
A more precise approach will be the combination of morphological characteristics and molecular analysis for the accurate identification of Colletotrichum species [12]. A study of phylogenetic relationships could also reveal useful information on the genomic delineation of C. truncatum, which causes anthracnose of tomato. Thus, in the present study, multiple gene sequence alignments of ITS, tub2, gapdh, act and cal were shown to be effective in identifying C. truncatum from anthracnose of tomato. In related studies, Liu et al. [13] and Weir et al. [14] also used those five conserved genes to accurately identify and resolve the phylogenetic status of Colletotrichum species.
The present study highlighted the occurrence of tomato anthracnose in Malaysia. All the isolates of C. truncatum isolated in the present study caused anthracnose of tomato with varying degrees of severity. Although C. boninense was earlier reported to be associated with tomato anthracnose in Pahang, Malaysia [26], this study is the first report of tomato anthracnose caused by C. truncatum in Malaysia. Other reports of tomato anthracnose caused by C. truncatum have been published in China [27], India [28] and Trinidad [29].
Generally, Colletotrichum is a genus of diverse plant pathogenic fungi which causes diseases in a wide variety of plant species worldwide, and several Colletotrichum species have the capacity to infect a single host-plant, and a single Colletotrichum species is also capable of infecting several hosts [2,3,4,5]. A broad range of host species including avocado, chilli, mango, olive, papaya, strawberry, and watermelon, can be infected by different Colletotrichum species worldwide [30,31,32,33,34,35,36]. Anthracnoses caused by Colletotrichum spp. are important diseases in Malaysia, infecting numerous hosts such as banana, chilli, dragon fruit, eggplant, and watermelon [37,38,39,40,41]. Previous reports also identified Colletotrichum acutatum, C. coccodes, C. dematium, and C. gloeosporioides as the causative agents of tomato anthracnose globally [16,42].

5. Conclusions

In the present study, morphological traits coupled with multigene phylogenetic analysis were effective in identifying C. truncatum as the fungal species associated with diseased tomato fruits showing symptoms of anthracnose in Malaysia. Pathogenicity tests further revealed that C. truncatum was the causative agent of anthracnose of tomato fruits. This confirms that C. truncatum is an emerging pathogen that is capable of causing anthracnose disease which may threaten the yield and profitability of tomato production as well as the other crops in regions where it has already been established. Information on disease symptomatology, etiology, epidemiology and pathogenesis provided by this study could be useful in disease monitoring and formulation of strategies for effective management of anthracnose, thus reducing yield losses of tomatoes.

Author Contributions

Conceptualization, S.A.S., M.A.R., A.N.F.A., J.U. and S.S.; investigation, A.H., T.T.P., M.N.K.E., M.Q. and A.B.S.; formal analysis, A.H., M.N.K.E., M.Q., A.B.S. and A.N.F.A.; writing—original draft, S.A.S.; writing—review and editing, S.A.S., T.T.P., M.A.R., J.U. and S.S.; final submission, S.A.S., M.A.R., J.U. and S.S.; Funding, S.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research project was funded by ‘Strengthening Integrated Research Facilities (SIRF)’ project of Bangladesh Sugarcrop Research Institute (BSRI), Ministry of Agriculture (MoA), Bangladesh and project code number (GLA0026-2019).

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Panthee, D.R.; Chen, F. Genomics of fungal disease resistance in tomato. Curr. Genomics. 2010, 11, 30–39. [Google Scholar] [CrossRef] [Scilit]
  2. Cannon, P.F.; Damm, U.; Johnton, P.R.; Weir, B.S. Colletotrichum-current status and future directions. Stud. Mycol. 2012, 73, 181–213. [Google Scholar] [CrossRef] [Scilit]
  3. Garrido, C.; Carbu, N.; Fernandez-Acero, F.J.; Vallejo, I.; Cantoral, J.M. Phylogenetic relationships and genome organization of Colletotrichum acutatum causing anthracnose in strawberry. Eur. J. Plant Pathol. 2009, 125, 397–411. [Google Scholar] [CrossRef] [Scilit]
  4. Liao, C.Y.; Chen, M.Y.; Chen, Y.K.; Wang, T.C.; Sheu, Z.M.; Kuo, K.C.; Chang, P.F.L.; Chung, K.R.; Lee, M.H. Characterization of three Colletotrichum acutatum isolates from Capsicum spp. Eur. J. Plant Pathol. 2012, 133, 599–608. [Google Scholar] [CrossRef] [Scilit]
  5. Sezer, A.; Dolar, F.S. Colletotrichum acutatum, a new pathogen of hazelnut. J. Phytopathol. 2012, 160, 428–430. [Google Scholar] [CrossRef] [Scilit]
  6. Riccardo, B.; Amby, D.B.; Zapparata, A.; Sarrocco, S.; Vannacci, G.; Le Floch, G.; Harrison, R.J.; Holub, E.; Sukno, S.A.; Sreenivasaprasad, S.; et al. Gene family expansions and contractions are associated with host range in plant pathogens of the genus Colletotrichum. BMC Genomics 2016, 17, 555. [Google Scholar]
  7. Sato, T. Studies on the taxonomy and identification of plant pathogenic fungi, based on morphology and phylogenetic analyses, and fungal pathogenicity focused on host specificity. J. Gen. Plant Pathol. 2016, 82, 332–337. [Google Scholar] [CrossRef] [Scilit]
  8. Wiesner-Hanks, T.; Nelson, R. Multiple disease resistance in plants. Annu. Rev. Phytopathol. 2016, 54, 229–252. [Google Scholar] [CrossRef] [Scilit]
  9. Cai, L.; Hyde, K.D.; Taylor, P.W.J.; Weir, B.S.; Waller, J.M.; Abang, M.M.; Zhang, J.Z.; Yang, Y.L.; Phoulivong, S.; Liu, Z.Y.; et al. A polyphasic approach for studying Colletotrichum. Fungal Divers. 2009, 39, 183–204. [Google Scholar]
  10. Sharma, G.; Pinnaka, A.K.; Shenoy, B.D. Resolving the Colletotrichum siamense species complex using ApMat marker. Fungal Divers. 2015, 71, 247–264. [Google Scholar] [CrossRef] [Scilit]
  11. Cannon, P.F.; Bridge, P.D.; Monte, E. Linking the Past, Present, and Future of Colletotrichum Systematics. In Colletotrichum: Host specificity, Pathology, and Host-Pathogen Interaction; Prusky, D., Freeman, S., Dickman, M., Eds.; APS Press: St. Paul, MN, USA, 2000; pp. 1–20. [Google Scholar]
  12. Photita, W.; Taylor, P.W.J.; Ford, R.; Lumyong, P.; McKenzie, H.C.; Hyde, K.D. Morphological and molecular characterization of Colletotrichum species from herbaceous plants in Thailand. Fungal Divers. 2005, 18, 117–133. [Google Scholar]
  13. Liu, F.; Weir, B.S.; Damm, U.; Crous, P.W.; Wang, Y.; Liu, B.; Wang, M.; Zhang, M.; Cai, L. Unravelling Colletotrichum species associated with Camellia: Employing ApMat and GS loci to resolve species in the C. gloeosporioides complex. Persoonia 2015, 35, 63–86. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Weir, B.S.; Johnston, P.R.; Damm, U. The Colletotrichum gloeosporioides species complex. Stud. Mycol. 2012, 73, 115–180. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Zhang, K.; Su, Y.-Y.; Cai, L. An optimized protocol of single spore isolation for fungi. Cryptogam. Mycol. 2013, 34, 349–356. [Google Scholar] [CrossRef] [Scilit]
  16. Cabrera, L.; Rojas, P.; Rojas, S.; Pardo-De la Hoz, C.J.; Mideros, M.F.; Danies, G.; Lopez-Kleine, L.; Jimenez, P.; Restrepo, S. Most Colletotrichum species associated with tree tomato (Solanum betaceum) and mango (Mangifera indica) crops are not host-specific. Plant Pathol. 2018, 67, 1022–1030. [Google Scholar] [CrossRef] [Scilit]
  17. White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Snisky, J.J., White, T.J., Eds.; Academic Press: San Diego, CA, USA, 1990; pp. 315–322. [Google Scholar]
  18. Glass, N.L.; Donaldson, G. Development of primer sets designed for use with PCR to amplify conserved genes from filamentous Ascomycetes. Appl. Environ. Microbiol. 1995, 61, 1323–1330. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. O’Donnell, K.; Cigelnik, E. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Mol. Phylogenet. Evol. 1997, 7, 103–116. [Google Scholar] [CrossRef] [Scilit]
  20. Templeton, M.D.; Rikkerink, E.H.; Solon, S.L.; Crowhurst, R.N. Cloning and molecular characterization of the glyceraldehyde-3-phosphate dehydrogenase-encoding gene and cDNA from the plant pathogenic fungus Glomerella cingulata. Gene 1992, 122, 225–230. [Google Scholar] [CrossRef] [Scilit]
  21. Carbone, I.; Kohn, L. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef] [Scilit]
  22. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [Scilit]
  23. Baroncelli, R.; Sarrocco, S.; Zapparata, A.; Tavarini, S.; Angelini, L.G.; Vannacci, G. Characterization and epidemiology of Colletotrichum acutatum sensu lato (C. chrysanthemi) causing Carthamus tinctorius anthracnose. Plant Pathol. 2015, 64, 375–384. [Google Scholar] [CrossRef] [Scilit]
  24. Hyde, K.D.; Cai, L.; McKenzie, E.H.C.; Yang, Y.L.; Zhang, J.Z.; Prihastuti, H. Colletotrichum: A catalogue of confusion. Fungal Divers. 2009, 39, 1–17. [Google Scholar]
  25. Schena, L.; Mosca, S.; Cacciola, S.O.; Faedda, R.; Sanzani, S.M.; Agosteo, G.E.; Sergeeva, V.; Magnano di San Lio, G. Species of the Colletotrichum gloeosporioides and C. boninense complexes associated with olive anthracnose. Plant Pathol. 2014, 63, 437–446. [Google Scholar] [CrossRef] [Scilit]
  26. Rashid, T.S.; Sijam, K.; Kadir, J.; Saud, H.M.; Awla, H.K.; Hata, E.M. First report of tomato anthracnose caused by Colletotrichum boninense in Malaysia. J. Plant Pathol. 2015, 97, 209–220. [Google Scholar]
  27. Diao, Y.Z.; Zhang, C.; Lin, D.; Liu, X.L. First report of Colletotrichum truncatum causing anthracnose of tomato in China. Dis. Notes 2014, 98, 687. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Saini, T.J.; Gupta, S.G.; Anandalakshmi, R. Detection of tomato anthracnose caused by Colletotrichum truncatum in India. Australas. Plant Dis. Notes 2017, 12, 48. [Google Scholar] [CrossRef] [Scilit]
  29. Villafana, R.T.; Ramdass, A.C.; Rampersad, S.N. First Report of Colletotrichum truncatum causing anthracnose in tomato fruit in Trinidad. Dis. Notes 2018, 102, 1857. [Google Scholar] [CrossRef] [Scilit]
  30. Bincader, S.; Pongpisutta, R.; Rattanakreetakul, C. Diversity of Colletotrichum species causing anthracnose disease from Mango cv. Nam Dork Mai See Tong based on ISSR-PCR. Indian J. Agric. Res. 2022, 56, 81–90. [Google Scholar] [CrossRef] [Scilit]
  31. de Silva, D.D.; Groenewald, J.Z.; Crous, P.W.; Ades, P.K.; Nasruddin, A.; Mongkolporn, O.; Taylor, P.W. Identification, prevalence and pathogenicity of Colletotrichum species causing anthracnose of Capsicum annuum in Asia. IMA Fungus 2019, 10, 8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Guo, Z.; Luo, C.-X.; Wu, H.-J.; Peng, B.; Kang, B.-S.; Liu, L.-M.; Zhang, M.; Gu, Q.-S. Colletotrichum species associated with anthracnose disease of watermelon (Citrullus lanatus) in China. J. Fungi 2022, 8, 790. [Google Scholar] [CrossRef] [Scilit]
  33. Hu, S.; Zhang, Y.; Yu, H.; Zhou, J.; Hu, M.; Liu, A.; Wu, J.; Wang, H.; Zhang, C. Colletotrichum Spp. Diversity between leaf anthracnose and crown rot from the same strawberry plant. Front. Microbiol. 2022, 13, 860694. [Google Scholar] [CrossRef] [Scilit]
  34. Li, M.; Feng, W.; Yang, J.; Gao, Z.; Zhang, Z.; Zhang, W.; Wang, S.; Wang, W.; Gong, D.; Hu, M. First report of anthracnose caused by Colletotrichum siamense on avocado fruits in China. Crop Prot. 2022, 155, 105922. [Google Scholar] [CrossRef] [Scilit]
  35. Licciardello, G.; Moral, J.; Strano, M.C.; Caruso, P.; Sciara, M.; Bella, P.; Sorrentino, G.; Di Silvestro, S. Characterization of Colletotrichum strains associated with olive anthracnose in Sicily. Phytopathol. Mediterr. 2022, 61, 139–151. [Google Scholar] [CrossRef] [Scilit]
  36. Pacheco-Esteva, M.C.; Soto-Castro, D.; Vásquez-López, A.; Tovar-Pedraza, J.M. First report of Colletotrichum siamense causing papaya anthracnose in Mexico. J. Plant Pathol. 2022, 104, 1175. [Google Scholar] [CrossRef] [Scilit]
  37. Goh, K.S.; Balasubramaniam, J.; Sani, S.F.; Alam, M.W.; Ismail, N.A.; Gleason, M.L.; Rosli, H. First report of Colletotrichum scovillei causing anthracnose on watermelon (Citrullus lanatus) in Malaysia. Dis. Notes 2022, 106, 2521. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Khoo, Y.W.; Tan, H.T.; Khaw, Y.S.; Li, S.-F.; Chong, K.P. First report of anthracnose on ‘Purple Dream’ Solanum melongenain Malaysia caused by Colletotrichum siamense. Plant Dis. 2022, 106. [Google Scholar] [CrossRef] [Scilit]
  39. Mahmodi, F.; Kadir, J.; Puteh, A. Genetic diversity and pathogenic variability of Colletotrichum truncatum causing anthracnose of pepper in Malaysia. J. Phytopathol. 2014, 162, 456–465. [Google Scholar] [CrossRef] [Scilit]
  40. Vijaya, S.I.; Anuar, I.S.M.; Zakaria, L. Characterization and pathogenicity of Colletotrichum truncatum causing stem anthracnose of red-fleshed dragon fruit (Hylocereus polyrhizus) in Malaysia. J. Phytopathol. 2015, 163, 67–71. [Google Scholar] [CrossRef] [Scilit]
  41. Zakaria, L.; Sahak, S.; Zakaria, M.; Salleh, B. Characterisation of Colletotrichum species associated with anthracnose of banana. Trop. Life Sci. Res. 2009, 20, 119–125. [Google Scholar]
  42. Zĭvković, S.; Stojanović, S.; Ivanović, Z.; Trkulja, N.; Dolovac, N.; Aleksić, G.; Jelica Balaž, J. Morphological and molecular identification of Colletotrichum acutatum from tomato fruit. Pestic. Phytomed. 2010, 25, 231–239. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Symptoms of tomato anthracnose observed in the tomato gardens in Sabah, Malaysia.
Figure 1. Symptoms of tomato anthracnose observed in the tomato gardens in Sabah, Malaysia.
Microorganisms 11 00226 g001
Figure 2. Morphological characteristics of Colletotrichum truncatum. (A) Colony appearance. (B) Pigmentation. (C) Acervuli. (D) Conidia. (E) Conidiogenous cell. (F) Appressoria. (G) Seta. Scale, (C,E,G) = 20 µm & (D,F) = 50 µm.
Figure 2. Morphological characteristics of Colletotrichum truncatum. (A) Colony appearance. (B) Pigmentation. (C) Acervuli. (D) Conidia. (E) Conidiogenous cell. (F) Appressoria. (G) Seta. Scale, (C,E,G) = 20 µm & (D,F) = 50 µm.
Microorganisms 11 00226 g002
Figure 3. Maximum likelihood (ML) tree of Colletotrichum truncatum generated from analysis of the concatenated ITS region, tub2, gapdh, act and cal genes, with Colletotrichum xantharrhoeae as outgroup. Asterisks indicate ex-type isolates. The isolates used in the present study are indicated in bold font and highlighted in. Only bootstrap values > 50% are shown.
Figure 3. Maximum likelihood (ML) tree of Colletotrichum truncatum generated from analysis of the concatenated ITS region, tub2, gapdh, act and cal genes, with Colletotrichum xantharrhoeae as outgroup. Asterisks indicate ex-type isolates. The isolates used in the present study are indicated in bold font and highlighted in. Only bootstrap values > 50% are shown.
Microorganisms 11 00226 g003
Figure 4. Pathogenicity of Colletotrichum truncatum on tomato fruits after 7 days of inoculation.
Figure 4. Pathogenicity of Colletotrichum truncatum on tomato fruits after 7 days of inoculation.
Microorganisms 11 00226 g004
Table 1. Primers used for PCR amplifications and DNA sequencing.
Table 1. Primers used for PCR amplifications and DNA sequencing.
GenePrimerSequence (5′–3′)Reference
ITSITS1
ITS4
TCCGTAGGTGAACCTGCGG
TCCTCCGCTTATTGATATGC
[17]
tub2Bt2a
Bt2b
GGTAACCAAATCGGTGCTGCTTTC
ACCCTCAGTGTAGTGACCCTTGGC
[18,19]
gapdhGDF1
GDR1
GCCGTCAACGACCCCTTCATTGA
GGGTGGAGTCGTACTTGAGCATGT
[20]
actACT-512F
ACT-783R
ATGTGCAAGGCCGGTTTCGC
TACGAGTCCTTCTGGCCCAT
[21]
calCAL-228F
CAL-737R
GAGTTCAAGGAGGCCTTCTCCC
CATCTTTCTGGCCATCATGG
[21]
Table 2. Fungal isolates obtained from the present study and reference species used for sequence comparisons and phylogenetic analysis of Colletotrichum truncatum.
Table 2. Fungal isolates obtained from the present study and reference species used for sequence comparisons and phylogenetic analysis of Colletotrichum truncatum.
SpeciesIsolateHostLocationGenBank Accession Number
ITStub2gapdhactcal
Colletotrichum truncatumTM01Solanum lycopersicumMalaysiaOP456600OP495634OP495656OP495678OP495700
TM02Solanum lycopersicumMalaysiaOP456601OP495635OP495657OP495679OP495701
TM03Solanum lycopersicumMalaysiaOP456602OP495636OP495658OP495680OP495702
TM04Solanum lycopersicumMalaysiaOP456603OP495637OP495659OP495681OP495703
TM05Solanum lycopersicumMalaysiaOP456604OP495638OP495660OP495682OP495704
TM06Solanum lycopersicumMalaysiaOP456605OP495639OP495661OP495683OP495705
TM07Solanum lycopersicumMalaysiaOP456606OP495640OP495662OP495684OP495706
TM08Solanum lycopersicumMalaysiaOP456607OP495641OP495663OP495685OP495707
TM09Solanum lycopersicumMalaysiaOP456608OP495642OP495664OP495686OP495708
TM10Solanum lycopersicumMalaysiaOP456609OP495643OP495665OP495687OP495709
TM11Solanum lycopersicumMalaysiaOP456610OP495644OP495666OP495688OP495710
TM12Solanum lycopersicumMalaysiaOP456611OP495645OP495667OP495689OP495711
TM13Solanum lycopersicumMalaysiaOP456612OP495646OP495668OP495690OP495712
TM14Solanum lycopersicumMalaysiaOP456613OP495647OP495669OP495691OP495713
TM15Solanum lycopersicumMalaysiaOP456614OP495648OP495670OP495692OP495714
TM16Solanum lycopersicumMalaysiaOP456615OP495649OP495671OP495693OP495715
TM17Solanum lycopersicumMalaysiaOP456616OP495650OP495672OP495694OP495716
TM18Solanum lycopersicumMalaysiaOP456617OP495651OP495673OP495695OP495717
TM19Solanum lycopersicumMalaysiaOP456618OP495652OP495674OP495696OP495718
TM20Solanum lycopersicumMalaysiaOP456619OP495653OP495675OP495697OP495719
TM21Solanum lycopersicumMalaysiaOP456620OP495654OP495676OP495698OP495720
TM22Solanum lycopersicumMalaysiaOP456621OP495655OP495677OP495699OP495721
CBP002Brassica parachinensisChinaKF030677 KF240819 KF300886 KF158412 KF114851
CBS 120709Capsicum frutescensIndiaGQ485593 GQ849429 GQ856753 GQ856783 GQ849453
CSSX9Hymenocallis americanaChinaGQ485594 GQ849436 GQ856752 GQ856772 GQ849461
LJTJ12Capsicum sp.ChinaKP748203 KP823843 KP823782 KP823765 KP823834
Colletotrichum acutatumBRIP 28519 Carica papayaAustraliaFJ972601 FJ907443 FJ972580 FJ907428 FJ917510
CBS 29467 Carica papayaAustraliaFJ972610 FJ907444 FJ972581 FJ907429 FJ917511
Colletotrichum alataeCBS 304.67Dioscorea alataNigeriaJX010191JX010449JX010011JX009470JX009739
ICMP 17919 *Dioscorea alataIndiaJX010190JX010383JX009990JX009471JX009738
Colletotrichum aotearoaICMP 17324Kunzea ericoidesNew ZealandJX010198JX010418JX009991JX009538JX009619
ICMP 18532Vitex lucensNew ZealandJX010220JX010421JX009906JX009544JX009614
ICMP 18537 *Coprosma sp.New ZealandJX010205JX010420JX010005JX009564JX009611
Colletotrichum boninenseCBS 123755 *Crinum asiaticumJapanJQ005153JQ005588JQ005240JQ005501JQ005674
CBS 128547Camellia sp.New ZealandJQ005159JQ005593JQ005249JQ005507JQ005680
Colletotrichum brasilienseCBS 128501 *Passiflora edulisBrazilJQ005235JQ005669JQ005322JQ005583JQ005756
CBS 128528Passiflora edulisBrazilJQ005234JQ005668JQ005321JQ005582JQ005755
Colletotrichum clidemiaeICMP 18658 *Clidemia hirtaUSAJX010265JX010438JX009989JX009537JX009645
ICMP 18706Vitis sp.USAJX010274JX010439JX009909JX009476JX009639
Colletotrichum cliviaeCBS 125375 *Clivia miniateChinaJX519223JX519249JX546611JX519240KX957765
CSSK4Clivia miniateChinaGQ485607 GQ849440 GQ856756 GQ856777 GQ849464
CSSS1Clivia miniateChinaGU109479 GU085869 GU085868 GU085861 GU085864
Colletotrichum coccodesCBS 164.49Solanum tuberosumNetherlands HM171678KU821197HM171672HM171666HM171669
CBS 369.75 *Solanum tuberosumNetherlands HM171679KU821198HM171673HM171667HM171670
Colletotrichum fioriniaeCBS 128517 *Fiorinia externaUSAJQ948292JQ949943JQ948622JQ949613MN895526
CBS 129948Tulipa sp.UKJQ948344JQ949995JQ948674JQ949665MN895531
Colletotrichum fructicolaCBS 238.49Ficus habrophyllaGermanyJX010181JX010400JX009923JX009495JX009671
CBS 125395Theobroma cacaoPanamaJX010172JX010408JX009992JX009543JX009666
CBS 125397 *Tetragastris panamensisPanamaJX010173 JX010409 JX010032 JX009581 JX009674
LJTJ18Capsicum sp.China KP748209 KP823856 KP823788 KP823744 KP823814
Colletotrichum gloeosporioidesCBS 953.97 *Citrus sinensisItalyGQ485605 GQ849434 GQ856762 GQ856782 GQ849452
ICMP 17821 *Citrus sinensisItalyJX010152JX010445JX010056JX009531JX009731
LF534Camellia sinensisChinaKJ955158KJ955305KJ954859KJ954434KJ954710
LJTJ13Capsicum sp.ChinaKP748204 KP823863 KP823783 KP823751 KP823821
Colletotrichum henanenseLF24Cirsium japonicumChinaKM610182KM610184KM610178KM610172KM610176
LF25Cirsium japonicumChinaKM610183KM610185KM610179KM610173KM610177
LF238 *Camellia sinensisChinaKJ955109KJ955257KJ954810KM023257KJ954662
Colletotrichum jiangxienseC15Citrus sinensisChinaMT318946MT602355MT602358MT602346KJ954701
LF684Camellia sinensisChinaKJ955198KJ955345KJ954899KJ954469KJ954749
LF687 *Camellia sinensisChinaKJ955201KJ955348KJ954902KJ954471KJ954752
Colletotrichum kahawaeCBS 135.30Coffea sp.KenyaJX010235JX010432JX010037JX009554JX009640
CBS 982.69Coffea arabicaAngolaJX010234JX010435JX010040JX009474JX009638
ICMP 17816 *Coffea arabicaKenyaJX010231JX010444JX010012JX009452JX009642
Colletotrichum karstiiCBS 129824Musa sp.ColombiaJQ005215JQ005649JQ005302JQ005563 JQ005736
LF316Camellia sinensisChinaKJ955125KJ955273KJ954826KJ954405KY971492
NTZ8Nandina domesticaChinaMH152578MH152594MH152586MH152582 MH152598
Colletotrichum musaeCBS 116870 *Musa sp.USAJX010146HQ596280JX010050JX009433JX009742
CM02Musa x paradisiacaBrazilMH746945MH746949MH746948MH622522MH746946
ICMP 17817Musa sapientumKenyaJX010142JX010395JX010015JX009432JX009689
Colletotrichum proteaeCBS 132882 *Protea sp.South AfricaKC297079KC297101KC297009KC296940KC296960
CBS 134301Protea sp.South AfricaKC842385KC842387KC842373KC842373KC842375
CBS 134302Protea sp.South AfricaKC842386KC842388KC842380KC842374 KC842376
Colletotrichum siamenseCBS 125378 *Hymenocallis americanaChinaJX010278JX010410JX010019JX009441 JX009709
LC0148Camellia sp.ChinaKJ955078KJ955227KJ954779KJ954360KJ954631
LF149Camellia sp.ChinaKJ955089KJ955238KJ954790KJ954371KJ954642
LJTJ5Capsicum sp.ChinaKP748195 KP823868 KP823756 KP823775 KP823825
Colletotrichum theobromicolaCBS 142.31Fragaria x ananassaUSAJX010286JX010373JX010024JX009516JX009592
CBS 124945 *Theobroma cacaoPanamaJX010294JX010447JX010006JX009444JX009591
Colletotrichum tropicaleCBS 124949Theobroma cacaoPanamaJX010264JX010407JX010007JX009489JX009719
GC3Vitis sp.TaiwanMT555315MT648526MT648519MT648522MT062402
ICMP 18672Litchi chinensisJapanJX010275JX010396JX010020JX009480JX009722
Colletotrichum xanthorrhoeaeBRIP 45094Xanthorrhoea sp.AustraliaJX010261JX010448JX009927JX009478JX009653
* ex-type isolate.
Table 3. Lesion areas produced by C. truncatum isolates on inoculated fruits of tomato.
Table 3. Lesion areas produced by C. truncatum isolates on inoculated fruits of tomato.
Fungal SpeciesIsolate Code* Lesion Area (cm2)
C. truncatumTM011.12 ± 0.17 ab
TM021.09 ± 0.07 ab
TM031.25 ± 0.12 a
TM041.21 ± 0.19 a
TM051.07 ± 0.05 ab
TM061.46 ± 0.17 a
TM071.19 ± 0.11 a
TM081.36 ± 0.21 a
TM091.28 ± 0.07 a
TM101.34 ± 0.11 a
TM111.03 ± 0.13 ab
TM121.15 ± 0.19 a
TM131.27 ± 0.14 a
TM141.04 ± 0.13 ab
TM151.23 ± 0.21 a
TM161.41 ± 0.09 a
TM171.16 ± 0.11 a
TM181.34 ± 0.19 a
TM191.10 ± 0.05 ab
TM201.19 ± 0.13 a
TM211.26 ± 0.05 a
TM221.07 ± 0.10 ab
Control0 ± 0 b
* Means ± standard deviations followed by different letters within the column are significantly different (p ˂ 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Shahriar, S.A.; Husna, A.; Paul, T.T.; Eaty, M.N.K.; Quamruzzaman, M.; Siddique, A.B.; Rahim, M.A.; Ahmmed, A.N.F.; Uddain, J.; Siddiquee, S. Colletotrichum truncatum Causing Anthracnose of Tomato (Solanum lycopersicum L.) in Malaysia. Microorganisms 2023, 11, 226. https://doi.org/10.3390/microorganisms11010226

AMA Style

Shahriar SA, Husna A, Paul TT, Eaty MNK, Quamruzzaman M, Siddique AB, Rahim MA, Ahmmed ANF, Uddain J, Siddiquee S. Colletotrichum truncatum Causing Anthracnose of Tomato (Solanum lycopersicum L.) in Malaysia. Microorganisms. 2023; 11(1):226. https://doi.org/10.3390/microorganisms11010226

Chicago/Turabian Style

Shahriar, Saleh Ahmed, Asmaul Husna, Terna Tersoo Paul, Most. Nurjahan Khatun Eaty, Md Quamruzzaman, Abu Bakar Siddique, Md Abdur Rahim, Abu Noman Faruq Ahmmed, Jasim Uddain, and Shafiquzzaman Siddiquee. 2023. "Colletotrichum truncatum Causing Anthracnose of Tomato (Solanum lycopersicum L.) in Malaysia" Microorganisms 11, no. 1: 226. https://doi.org/10.3390/microorganisms11010226

APA Style

Shahriar, S. A., Husna, A., Paul, T. T., Eaty, M. N. K., Quamruzzaman, M., Siddique, A. B., Rahim, M. A., Ahmmed, A. N. F., Uddain, J., & Siddiquee, S. (2023). Colletotrichum truncatum Causing Anthracnose of Tomato (Solanum lycopersicum L.) in Malaysia. Microorganisms, 11(1), 226. https://doi.org/10.3390/microorganisms11010226

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop