Development of a Molecular Marker Based on the Mitochondrial Genome for Detection of Cyclospora cayetanensis in Food and Water Samples
Abstract
:1. Introduction
2. Materials and Methods
2.1. C. cayetanensis Oocysts Isolation and Sample Preparation
2.2. Conventional PCR Assay Developed Based on the Mitochondrial Genome
2.3. Specificity Evaluation of Conventional mit3PCR Assay
2.4. Evaluation of Sensitivity and Comparison of the New Conventional PCR Assay with Validated qPCR for Food and Water Samples
2.4.1. Seeded Food Samples
2.4.2. Seeded Agricultural Water Samples
2.4.3. Detection in Surface Water Samples
2.5. Statistical Analysis of qPCR and Conventional PCR Detection Rates in Seeded Produce Samples and Agricultural Water
3. Results
3.1. Evaluation of Molecular Markers and Specificity Analysis
3.2. Evaluation of the New Optimized PCR Assay in Food and Agricultural Water Samples Seeded with Different Numbers of Oocysts
3.2.1. Detection of C. cayetanensis in Seeded Food Samples
3.2.2. Detection of C. cayetanensis in Seeded Agricultural Water Samples
3.2.3. Detection of C. cayetanensis in Environmental Water Samples
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Kahler, A.M.; Mattioli, M.C.; da Silva, A.J.; Hill, V. Detection of Cyclospora cayetanensis in Produce Irrigation and Wash Water Using Large-Volume Sampling Techniques. Food Waterborne Parasitol. 2021, 22, e00110. [Google Scholar] [CrossRef] [PubMed]
- Almeria, S.; Cinar, H.N.; Dubey, J.P. Cyclospora cayetanensis and Cyclosporiasis: An Update. Microorganisms 2019, 7, 317. [Google Scholar] [CrossRef] [PubMed]
- Dubey, J.P.; Almeria, S.; Mowery, J.; Fortes, J. Endogenous Developmental Cycle of the Human Coccidian Cyclospora cayetanensis. J. Parasitol. 2020, 106, 295–307. [Google Scholar] [CrossRef] [PubMed]
- Chacín-Bonilla, L. Epidemiology of Cyclospora cayetanensis: A Review Focusing in Endemic Areas. Acta Trop. 2010, 115, 181–193. [Google Scholar] [CrossRef]
- Mathur, M.; Verma, A.; Makwana, G.; Sinha, M. Study of Opportunistic Intestinal Parasitic Infections in Human Immunodeficiency Virus/Acquired Immunodeficiency Syndrome Patients. J. Glob. Infect. Dis. 2013, 5, 164–167. [Google Scholar] [CrossRef] [PubMed]
- Lalonde, L.; Oakley, J.; Fries, P. Verification and Use of the US-FDA BAM 19b Method for Detection of Cyclospora cayetanensis in a Survey of Fresh Produce by CFIA Laboratory. Microorganisms 2022, 10, 559. [Google Scholar] [CrossRef] [PubMed]
- Dixon, B.; Parrington, L.; Cook, A.; Pollari, F.; Farber, J. Detection of Cyclospora, Cryptosporidium, and Giardia in Ready-to-Eat Packaged Leafy Greens in Ontario, Canada. J. Food Prot. 2013, 76, 307–313. [Google Scholar] [CrossRef]
- Giangaspero, A.; Marangi, M.; Koehler, A.V.; Papini, R.; Normanno, G.; Lacasella, V.; Lonigro, A.; Gasser, R.B. Molecular Detection of Cyclospora in Water, Soil, Vegetables and Humans in Southern Italy Signals a Need for Improved Monitoring by Health Authorities. Int. J. Food Microbiol. 2015, 211, 95–100. [Google Scholar] [CrossRef] [PubMed]
- Lalonde, L.F.; Gajadhar, A.A. Detection of Cyclospora cayetanensis, Cryptosporidium Spp., and Toxoplasma Gondii on Imported Leafy Green Vegetables in Canadian Survey. Food Waterborne Parasitol. 2016, 2, 8–14. [Google Scholar] [CrossRef]
- Caradonna, T.; Marangi, M.; Del Chierico, F.; Ferrari, N.; Reddel, S.; Bracaglia, G.; Normanno, G.; Putignani, L.; Giangaspero, A. Detection and Prevalence of Protozoan Parasites in Ready-to-Eat Packaged Salads on Sale in Italy. Food Microbiol. 2017, 67, 67–75. [Google Scholar] [CrossRef]
- Bern, C.; Hernandez, B.; Lopez, M.B.; Arrowood, M.J.; Alvarez de Mejia, M.; Maria de Merida, A.; Hightower, A.W.; Venczel, L.; Herwaldt, B.L.; Klein, R.E. Epidemiologic Studies of Cyclospora cayetanensis in Guatemala. Emerg. Infect. Dis. 1999, 5, 766–774. [Google Scholar] [CrossRef] [PubMed]
- Nichols, G.L.; Freedman, J.; Pollock, K.G.; Rumble, C.; Chalmers, R.M.; Chiodini, P.; Hawkins, G.; Alexander, C.L.; Godbole, G.; Williams, C.; et al. Cyclospora Infection Linked to Travel to Mexico, June to September 2015. Eurosurveillance 2015, 20, 30048. [Google Scholar] [CrossRef] [PubMed]
- Bednarska, M.; Bajer, A.; Welc-Falęciak, R.; Pawełas, A. Cyclospora cayetanensis Infection in Transplant Traveller: A Case Report of Outbreak. Parasites Vectors 2015, 8, 411. [Google Scholar] [CrossRef] [PubMed]
- Whitfield, Y.; Johnson, K.; Hanson, H.; Huneault, D. 2015 Outbreak of Cyclosporiasis Linked to the Consumption of Imported Sugar Snap Peas in Ontario, Canada. J. Food Prot. 2017, 80, 1666–1669. [Google Scholar] [CrossRef]
- Abanyie, F.; Harvey, R.R.; Harris, J.R.; Wiegand, R.E.; Gaul, L.; Desvignes-Kendrick, M.; Irvin, K.; Williams, I.; Hall, R.L.; Herwaldt, B.; et al. 2013 Multistate Outbreaks of Cyclospora cayetanensis Infections Associated with Fresh Produce: Focus on the Texas Investigations. Epidemiol. Infect. 2015, 143, 3451–3458. [Google Scholar] [CrossRef]
- Efstratiou, A.; Ongerth, J.E.; Karanis, P. Waterborne Transmission of Protozoan Parasites: Review of Worldwide Outbreaks—An Update 2011–2016. Water Res. 2017, 114, 14–22. [Google Scholar] [CrossRef]
- Plutzer, J.; Karanis, P. Neglected Waterborne Parasitic Protozoa and Their Detection in Water. Water Res. 2016, 101, 318–332. [Google Scholar] [CrossRef]
- Lanata, C. Studies of Food Hygiene and Diarrhoeal Disease. Int. J. Environ. Health Res. 2003, 13, S175–S183. [Google Scholar] [CrossRef]
- Kourenti, C.; Karanis, P.; Smith, H. Waterborne Transmission of Protozoan Parasites: A Worldwide Review of Outbreaks and Lessons Learnt. J. Water Health 2007, 5, 1–38. [Google Scholar] [CrossRef]
- Baldursson, S.; Karanis, P. Waterborne Transmission of Protozoan Parasites: Review of Worldwide Outbreaks—An Update 2004–2010. Water Res. 2011, 45, 6603–6614. [Google Scholar] [CrossRef]
- Chacin-Bonilla, L. Cyclospora cayetanensis. In Water and Sanitation for the 21st Century: Health and Microbiological Aspects of Excreta and Wastewater Management (Global Water Pathogen Project); Fayer, R., Jakubowski, W., Eds.; Michigan State University: East Lansing, MI, USA, 2017; pp. 3–10. [Google Scholar]
- Ortega, Y.R.; Sanchez, R. Update on Cyclospora cayetanensis, a Food-Borne and Waterborne Parasite. Clin. Microbiol. Rev. 2010, 23, 218–234. [Google Scholar] [CrossRef] [PubMed]
- Galván, A.L.; Magnet, A.; Izquierdo, F.; Fenoy, S.; Rueda, C.; Vadillo, F.; Henriques-gil, N. Molecular Characterization of Human-Pathogenic Microsporidia and Cyclospora cayetanensis Isolated from Various Water Sources in Spain: A Year-Long Longitudinal Study. Appl. Environ. Microbiol. 2013, 79, 449–459. [Google Scholar] [CrossRef]
- Kitajima, M.; Haramoto, E.; Iker, B.C.; Gerba, C.P. Occurrence of Cryptosporidium, Giardia, and Cyclospora in Influent and Effluent Water at Wastewater Treatment Plants in Arizona. Sci. Total Environ. 2014, 484, 129–136. [Google Scholar] [CrossRef] [PubMed]
- Durigan, M.; Murphy, H.R.; da Silva, A.J. Dead-End Ultrafiltration and DNA-Based Methods for Detection of Cyclospora cayetanensis in Agricultural Water. Appl. Environ. Microbiol. 2020, 86, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Dowd, S.E.; John, D.; Eliopolus, J.; Gerba, C.P.; Naranjo, J.; Klein, R.; Lo, B.; De Mejı, M.; Mendoza, C.E.; Pepper, I.L. Confirmed Detection of Cyclospora cayetanensis, Encephalitozoon intestinalis and Cryptosporidium parvum in Water Used for Drinking. J. Water Health 2003, 1, 117–123. [Google Scholar] [CrossRef]
- Murphy, H.R.; Almeria, S.; da Silva, A.J. Molecular detection of Cyclospora cayetanensis in fresh produce using real-time PCR. In U.S. Food and Drug Administration Bacteriological Analytical Manual (BAM) Chapter 19B. Available online: https://www.fda.gov/Food/FoodScienceResearch/LaboratoryMethods/ucm553445.htm (accessed on 30 November 2021).
- Murphy, H.R.; Lee, S.; Da Silva, A.J. Evaluation of an Improved U.S. Food and Drug Administration Method for the Detection of Cyclospora cayetanensis in Produce Using Real-Time PCR. J. Food Prot. 2017, 80, 1133–1144. [Google Scholar] [CrossRef] [PubMed]
- Durigan, M.; Murphy, H.; Deng, K.; Kmet, M.; Lindemann, S.; Newkirk, R.; Patel, V.Y.; Ulaszek, J.; Warren, J.; Ewing, L.; et al. Dead-End Ultrafiltration (DEUF) for the Detection of Cyclospora cayetanensis from Agricultural Water. In U.S. Food and Drug Administration Bacteriological Analytical Manual (BAM) Chapter 19c. Available online: https://www.fda.gov/media/140309/download (accessed on 30 November 2021).
- Temesgen, T.T.; Tysnes, K.R.; Robertson, L.J. A New Protocol for Molecular Detection of Cyclospora cayetanensis as Contaminants of Berry Fruits. Front. Microbiol. 2019, 10, 1939. [Google Scholar] [CrossRef]
- Cinar, H.N.; Gopinath, G.; Jarvis, K.; Murphy, H.R. The Complete Mitochondrial Genome of the Foodborne Parasitic Pathogen Cyclospora cayetanensis. PLoS ONE 2015, 10, e0128645. [Google Scholar] [CrossRef]
- Qvarnstrom, Y.; Wei-Pridgeon, Y.; Li, W.; Nascimento, F.S.; Bishop, H.S.; Herwaldt, B.L.; Moss, D.M.; Nayak, V.; Srinivasamoorthy, G.; Sheth, M.; et al. Draft Genome Sequences from Cyclospora cayetanensis Oocysts Purified from a Human Stool Sample. Genome Announc. 2015, 3, 10–11. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Wang, L.; Zheng, H.; Xu, Z.; Roellig, D.M.; Li, N.; Frace, M.A.; Tang, K.; Arrowood, M.J.; Moss, D.M.; et al. Comparative Genomics Reveals Cyclospora cayetanensis Possesses Coccidia-like Metabolism and Invasion Components but Unique Surface Antigens. BMC Genom. 2016, 17, 1–17. [Google Scholar] [CrossRef] [Green Version]
- Gopinath, G.R.; Cinar, H.N.; Murphy, H.R.; Durigan, M.; Almeria, M.; Tall, B.D.; Dasilva, A.J. A Hybrid Reference-Guided de Novo Assembly Approach for Generating Cyclospora Mitochondrion Genomes. Gut Pathog. 2018, 10, 4–11. [Google Scholar] [CrossRef] [PubMed]
- Morgan, J.A.T.; Godwin, R.M. Mitochondrial Genomes of Australian Chicken Eimeria Support the Presence of Ten Species with Low Genetic Diversity among Strains. Vet. Parasitol. 2017, 243, 58–66. [Google Scholar] [CrossRef]
- Cinar, H.N.; Gopinath, G.; Murphy, H.R.; Almeria, S.; Durigan, M.; Choi, D.; Jang, A.; Kim, E.; Kim, R.; Choi, S.; et al. Molecular Typing of Cyclospora cayetanensis in Produce and Clinical Samples Using Targeted Enrichment of Complete Mitochondrial Genomes and Next-Generation Sequencing. Parasites Vectors 2020, 13, 1–12. [Google Scholar] [CrossRef]
- Barratt, J.L.N.; Park, S.; Nascimento, F.S.; Hofstetter, J.; Plucinski, M.; Casillas, S.; Bradbury, R.S.; Arrowood, M.J.; Qvarnstrom, Y.; Talundzic, E. Genotyping Genetically Heterogeneous Cyclospora cayetanensis Infections to Complement Epidemiological Case Linkage. Parasitology 2019, 146, 1275–1283. [Google Scholar] [CrossRef] [PubMed]
- Bikandi, J.; Millán, R.S.; Rementeria, A.; Garaizar, J. In Silico Analysis of Complete Bacterial Genomes: PCR, AFLP-PCR and Endonuclease Restriction. Bioinformatics 2004, 20, 798–799. [Google Scholar] [CrossRef]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3-New Capabilities and Interfaces. Nucleic Acids Res. 2012, 40, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Nascimento, F.S.; Barta, J.R.; Whale, J.; Hofstetter, J.N.; Casillas, S.; Barratt, J.; Talundzic, E.; Arrowood, M.J.; Qvarnstrom, Y. Mitochondrial Junction Region as Genotyping Marker for Cyclospora cayetanensis. Emerg. Infect. Dis. 2019, 25, 1314–1319. [Google Scholar] [CrossRef] [PubMed]
- Murphy, H.R.; Cinar, H.N.; Gopinath, G.; Noe, K.E.; Chatman, L.D.; Miranda, N.E.; Wetherington, J.H.; Neal-McKinney, J.; Pires, G.S.; Sachs, E.; et al. Interlaboratory Validation of an Improved Method for Detection of Cyclospora cayetanensis in Produce Using a Real-Time PCR Assay. Food Microbiol. 2018, 69, 170–178. [Google Scholar] [CrossRef] [PubMed]
- Durigan, M.; Abreu, A.G.G.; Zucchi, M.I.; Franco, R.M.B.; Souza, A.P.; De Souza, A.P. Genetic Diversity of Giardia Duodenalis: Multilocus Genotyping Reveals Zoonotic Potential between Clinical and Environmental Sources in a Metropolitan Region of Brazil. PLoS ONE 2014, 9, e115489. [Google Scholar] [CrossRef]
- Durigan, M.; Ciampi-Guillardi, M.; Rodrigues, R.C.A.; Greinert-Goulart, J.A.; Siqueira-Castro, I.C.V.; Leal, D.A.G.; Yamashiro, S.; Bonatti, T.R.; Zucchi, M.I.; Franco, R.M.B.; et al. Population Genetic Analysis of Giardia Duodenalis: Genetic Diversity and Haplotype Sharing between Clinical and Environmental Sources. Microbiol. Open 2017, 6, e00424. [Google Scholar] [CrossRef] [PubMed]
- Tang, K.; Guo, Y.; Zhang, L.; Rowe, L.A.; Roellig, D.M.; Frace, M.A.; Li, N.; Liu, S.; Feng, Y.; Xiao, L. Genetic Similarities between Cyclospora cayetanensis and Cecum-Infecting Avian Eimeria Spp. in Apicoplast and Mitochondrial Genomes. Parasit. Vectors 2015, 8, 358. [Google Scholar] [CrossRef] [PubMed]
- Nascimento, F.S.; Barratt, J.; Houghton, K.; Plucinski, M.; Kelley, J.; Casillas, S.; Bennett, C.; Snider, C.; Tuladhar, R.; Zhang, J.; et al. Evaluation of an Ensemble-Based Distance Statistic for Clustering MLST Datasets Using Epidemiologically Defined Clusters of Cyclosporiasis. Epidemiol. Infect. 2020, 148, e172. [Google Scholar] [CrossRef] [PubMed]
- Barratt, J.; Houghton, K.; Richins, T.; Straily, A.; Threlkel, R.; Bera, B.; Kenneally, J.; Clemons, B.; Madison-Antenucci, S.; Cebelinski, E.; et al. Investigation of US Cyclospora cayetanensis outbreaks in 2019 and evaluation of an improved Cyclospora genotyping system against 2019 cyclosporiasis outbreak clusters. Epidemiol. Infect. 2021, 149, e214. [Google Scholar] [CrossRef] [PubMed]
- Houghton, K.A.; Lomsadze, A.; Park, S.; Nascimento, F.S.; Barratt, J.; Arrowood, M.J.; Vanroey, E.; Talundzic, E.; Borodovsky, M.; Qvarnstrom, Y. Development of a Workflow for Identification of Nuclear Genotyping Markers for Cyclospora cayetanensis. Parasite 2020, 27, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Almeria, S.; da Silva, A.J.; Blessington, T.; Cloyd, T.C.; Cinar, H.N.; Durigan, M.; Murphy, H.R. Evaluation of the U.S. Food and Drug Administration Validated Method for Detection of Cyclospora cayetanensis in High-Risk Fresh Produce Matrices and a Method Modification for a Prepared Dish. Food Microbiol. 2018, 76, 497–503. [Google Scholar] [CrossRef] [PubMed]
- Sturbaum, G.D.; Ortega, Y.R.; Gilman, R.H.; Sterling, C.R.; Cabrera, L.; Klein, D.A. Detection of Cyclospora cayetanensis in Wastewater. Appl. Environ. Microbiol. 1998, 64, 2284–2286. [Google Scholar] [CrossRef] [PubMed]
- Cam, P.D.; Sorel, N.; Dan, L.C.; Larher, E.; Tassin, S.; Barbier, J.P.; Miégeville, M. A New Contribution to the Epidemiological Survey of Cyclospora cayetanensis in Hanoï Water Supplies (Viet-Nam); a 12-Month Longitudinal Study. Médecine Mal. Infect. 2001, 31, 597–600. [Google Scholar] [CrossRef]
Designation | Target | Sequence (5′–3′) | Amplicon Size (bp) |
---|---|---|---|
3F1 | C. cayetanensis | TGCCAAACTATTCAAACAATCTTCTCA | 182 |
3R1 | CCTTTCCGGTTGTTTCCATCTC | ||
C. cayetanensis synthetic target | TGCCAAACTATTCAAACAATCTTCATCCAGTGCTCCTATTTTTACCAAAAGGGACTCCATAAGTTAAACTGTAGAGTCGAGATGGAAACAACCGGAAAGG | 100 |
Matrix | Number of Oocysts Seeded | Number of Seeded Samples Tested | No. of Samples Positive with mit3PCR | No. of Samples Positive by BAM qPCR: | p b |
---|---|---|---|---|---|
(%) | (%) | ||||
Cilantro (25 g) a | 0 | 3 | 0 (0%) | 0 (0%) | 1 |
5 | 4 | 2 (50%) | 3 (75%) | 1 | |
10 | 4 | 4 (100%) | 4 (100%) | 1 | |
20 | 4 | 4 (100%) | 4 (100%) | 1 | |
200 | 3 | 3 (100%) | 3 (100%) | 1 | |
Raspberries (50 g) a | 0 | 3 | 0 (0) | 0 (0) | 1 |
5 | 4 | 2 (50%) | 3 (75%) | 1 | |
10 | 4 | 2 (50 %) | 3 (75%) | 1 | |
20 | 4 | 4 (100%) | 4 (100%) | 1 | |
200 | 3 | 3 (100%) | 3 (100%) | 1 |
Matrix | Seeding Level a | No. of Samples Analyzed | No. of Oocysts (L) | qPCR | mit3PCR | p b | ||
---|---|---|---|---|---|---|---|---|
No. of Positive Samples | Positive (%) | No. of Positive Samples | Positive (%) | |||||
Irrigation Water (10 L) | 0 | 12 | 0 | 0 | 0% | 0 | 0% | 1 |
6 | 12 | 0.6 | 8 | 66.60% | 7 | 58.30% | 1 | |
12 | 3 | 1.2 | 3 | 100% | 2 | 75% | 1 | |
25 | 6 | 2.5 | 6 | 100% | 6 | 100% | 1 | |
100 | 3 | 10 | 3 | 100% | 3 | 100% | 1 | |
200 | 6 | 20 | 6 | 100% | 6 | 100% | 1 |
Sample | Origin | Turbidity (NTU) | qPCR Result | qPCR Ct C | mit3PCR | Sequencing Result |
---|---|---|---|---|---|---|
W33 | C&O Canal | 10.2 | Positive | 35.7 | Positive | C. cayetanensis |
W37 | C&O Canal | 17.3 | Negative | Und | Negative | NA |
W40 | C&O Canal | 14.7 | Negative | Und | Negative | NA |
W41 | C&O Canal | 14.9 | Negative | Und | Negative | NA |
W42 | C&O Canal | 14.6 | Positive | 36.6 | Positive | C. cayetanensis ** |
W43 | C&O Canal | 16.5 | Positive | 33.9 ± 0.4 | Positive | C. cayetanensis |
Stool 28 Control b,d | US | N/A | Positive | 29 ± 0.2 | Positive | C. cayetanensis |
Stool 19 Control b,d | US | N/A | Positive | 27.1 ± 0.3 | Positive | C. cayetanensis |
Oocysts Control b,e | Purified oocysts | N/A | Positive | 31 ± 0.3 | Positive | C. cayetanensis |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Durigan, M.; Patregnani, E.; Gopinath, G.R.; Ewing-Peeples, L.; Lee, C.; Murphy, H.R.; Almeria, S.; Cinar, H.N.; Negrete, F.; da Silva, A.J. Development of a Molecular Marker Based on the Mitochondrial Genome for Detection of Cyclospora cayetanensis in Food and Water Samples. Microorganisms 2022, 10, 1762. https://doi.org/10.3390/microorganisms10091762
Durigan M, Patregnani E, Gopinath GR, Ewing-Peeples L, Lee C, Murphy HR, Almeria S, Cinar HN, Negrete F, da Silva AJ. Development of a Molecular Marker Based on the Mitochondrial Genome for Detection of Cyclospora cayetanensis in Food and Water Samples. Microorganisms. 2022; 10(9):1762. https://doi.org/10.3390/microorganisms10091762
Chicago/Turabian StyleDurigan, Mauricio, Emma Patregnani, Gopal R. Gopinath, Laura Ewing-Peeples, Chaeyoon Lee, Helen R. Murphy, Sonia Almeria, Hediye Nese Cinar, Flavia Negrete, and Alexandre J. da Silva. 2022. "Development of a Molecular Marker Based on the Mitochondrial Genome for Detection of Cyclospora cayetanensis in Food and Water Samples" Microorganisms 10, no. 9: 1762. https://doi.org/10.3390/microorganisms10091762
APA StyleDurigan, M., Patregnani, E., Gopinath, G. R., Ewing-Peeples, L., Lee, C., Murphy, H. R., Almeria, S., Cinar, H. N., Negrete, F., & da Silva, A. J. (2022). Development of a Molecular Marker Based on the Mitochondrial Genome for Detection of Cyclospora cayetanensis in Food and Water Samples. Microorganisms, 10(9), 1762. https://doi.org/10.3390/microorganisms10091762