Next Article in Journal
Effect of Iron Limitation, Elevated Temperature, and Florfenicol on the Proteome and Vesiculation of the Fish Pathogen Aeromonas salmonicida
Previous Article in Journal
Do Bacteria Provide an Alternative to Cancer Treatment and What Role Does Lactic Acid Bacteria Play?
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development and Evaluation of Duplex MIRA-qPCR Assay for Simultaneous Detection of Staphylococcus aureus and non-aureus Staphylococci

1
Institution of Health Statistics and Epidemiology, School of Public Health, Lanzhou University, Lanzhou 730000, China
2
National Institute for Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention, State Key Laboratory of Infectious Disease Prevention and Control, Beijing 102206, China
3
Center for Human Pathogenic Culture Collection, Chinese Center for Disease Control and Prevention, Beijing 102206, China
*
Authors to whom correspondence should be addressed.
Microorganisms 2022, 10(9), 1734; https://doi.org/10.3390/microorganisms10091734
Submission received: 21 July 2022 / Revised: 22 August 2022 / Accepted: 24 August 2022 / Published: 27 August 2022
(This article belongs to the Section Microbial Biotechnology)

Abstract

:
Staphylococcus spp., especially Staphylococcus aureus (S. aureus), is an important pathogen in hospital-acquired infection and food poisoning. Here, we developed a multienzyme isothermal rapid amplification combined with duplex quantitative PCR (duplex MIRA-qPCR) method, which can simultaneously detect the S. aureus species-specific conserved gene FMN-bgsfp and the Staphylococcus genus-specific conserved gene tuf. This assay enabled the amplification of DNA within 20 min at a constant temperature of 39 °C. Specificity analysis indicated that all nine common Staphylococcus species were positive and non-Staphylococcus spp. were negative for tuf gene, whereas S. aureus was positive, non-aureus Staphylococci species and non-Staphylococcus spp. were negative for FMN-bgsfp gene, suggesting that duplex MIRA-qPCR exhibited high specificity. Meanwhile, the sensitivity was tested and the limit of detection (LoD) was 3 × 102 CFU/mL. The coefficient variation values ranged from 0.13% to 2.09%, indicating that the assay had good repeatability. Furthermore, all the nine common Staphylococcus species (including S. aureus) could be detected from four kinds of simulated samples and the LoD of S. aureus was 8.56 × 103 CFU/mL. In conclusion, the duplex MIRA-qPCR has advantages of stronger specificity, lower detection threshold, shorter detection time, and simpler operation, which is an effective tool to detect S. aureus and non-aureus Staphylococci spp. infections rapidly.

1. Introduction

Members of the genus Staphylococcus are non-motile, facultative anaerobic, Gram-positive cocci that colonize on the surface of skin and the mucous membranes of humans and animals, including poultry [1]. Staphylococci are usually distributed in animals and the environment (such as soil and water, et al.) and can be differentiated into two groups according to the present or absent production of coagulase, i.e., coagulase-positive Staphylococci (CoPS) and coagulase-negative Staphylococci (CoNS) [2,3]. CoPS are usually assumed to be pathogenic, existing as commensals in humans and food-producing animals, and can cause severe or even lethal diseases [4]. Staphylococcus aureus (S. aureus) is the most common CoPS and regarded as the most virulent and notorious Staphylococcus species due to its large variety of expressed virulence factors [5]. The infection of S. aureus can cause bacteremia, sepsis, impetigo, atherosclerosis, necrotizing pneumonia, infective endocarditis, catheter endocarditis, osteomyelitis, pleuropulmonary infections and inflammation in skin, bone, joint and soft tissue [6,7]. Further, S. aureus is a frequent cause of infections acquired from hospitals and is one of the most common pathogens of prosthetic valve endocarditis [8]. In particular, the highly virulent methicillin-resistant S. aureus (MRSA) infection has a high mortality rate and leads to high treatment costs, which becomes a public-health threat around the world [9,10]. CoNS, however, have fewer virulence factors than the well-studied pathogen S. aureus, which generally colonize on human skin and contamination of blood cultures [11,12]. Although CoNS are widely considered to be less virulent with lower isolation frequency, they may also cause infection and are regarded as important opportunistic pathogens [13,14,15].
Therefore, there is an urgent need to establish a rapid, sensitive and reliable method to detect S. aureus and non-aureus Staphylococci. With the advancement of molecular biology detection technology, molecular methods, such as multilocus sequence typing (MLST), Staphylococcus aureus protein A (spa) typing, polymerase chain reaction (PCR) and quantitative PCR (qPCR), have been used to rapidly identify Staphylococcus spp. [16,17]. Although PCR and qPCR are some of the most valuable techniques currently used in bioscience, diagnostics and forensic science [18,19], there are certain disadvantages, such as cumbersome procedures, including electrophoresis and temperature change [20,21]. Multienzyme isothermal rapid amplification (MIRA), which is a novel nucleic acid rapid amplification technology, uses recombinant enzyme and primers to form a protein/single-stranded DNA complex (Rec/ssDNA). With the help of accessory proteins and single-stranded binding proteins (SSB), Rec/ssDNA invades the double-stranded DNA template and relies on the simultaneous activity of multiple functional proteins to rapidly amplify the target fragment. Due to its simple requirements for primers, high amplification efficiency and short detection time, MIRA has already been used to detect SARS-CoV-2 [22], hepatitis B virus [23] and Mycobacterium tuberculosis [24].
To this end, we developed a duplex MIRA-qPCR assay to detect S. aureus and non-aureus Staphylococci simultaneously. We first screened the S. aureus species-specific and Staphylococcus genus-specific conserved sequences from a public database and then designed primers and probes targeting the conserved sequences to evaluate the specificity, sensitivity and repeatability of this assay. At the same time, the detection of Staphylococcus was evaluated by using four common samples of Staphylococcus. Our results suggest that the duplex MIRA-qPCR can be applied in the detection of clinical treatment and food poisoning investigation.

2. Materials and Methods

2.1. Strain Information and DNA Extraction

In total, 61 strains, including 28 Staphylococcus spp. and 33 non-Staphylococcus spp. strains, were included in this study. All strains were identified at species level and stored at the Center for Human Pathogenic Culture Collection (CHPC), Chinese Center for Disease Control and Prevention. Staphylococcus spp. strains involved S. aureus (n = 8, including S. aureus ATCC 12600T) and non-aureus Staphylococci species (n = 20), namely, S. epidermidis (n = 3, including S. epidermidis ATCC 14990T), S. haemolyticus (n = 3, including S. haemolyticus ATCC 29970T), S. saprophytics (n = 3, including S. saprophytics ATCC 15305T), S. xylosus (n = 2), S. caprae (n = 3), S. pasteuri (n = 2), S. pseudintermedius (n = 2) and S. hominis (n = 2). Non-Staphylococcus spp. strains (n = 33) included 1 strain of Listeria monocytogenes, Listeria ivanovii, Listeria innocua, Enterococcus faecalis, Enterococcus faecium, Enterobacter cloacae, Salmonella enterica serovar Typhimurium, Salmonella enterica serovar Enteritidis, Campylobacter jejuni, Campylobacter coli, Acinetobacter baumannii, Clostridium perfringens and Shigella sonnei, 2 strains of Vibrio parahaemolyticus, 3 strains of Klebsiella pneumonia, 3 strains of Vibrio cholerae, 3 strains of Shewanella sp., 2 strains of Aeromonas veronii, 3 strains of Escherichia coli (including Escherichia coli O157 CHPC 1.1401), 2 strains of Pseudomonas aeruginosa and 2 strains of Plesiomonas shigelloides. Strains of Campylobacter coli, Campylobacter jejuni and Clostridium perfringens were inoculated on Columbia blood agar at 37 ± 0.5 °C for 24–72 h with 5% oxygen, 10% carbon dioxide (Campylobacter coli and Campylobacter jejuni) or no oxygen (Clostridium perfringens). Strains of Listeria monocytogenes, Listeria ivanovii and Listeria innocua were inoculated on Brain heart infusion agar at 37 ± 0.5 °C for 18–24 h. Strains of Shewanella sp. were inoculated on marine agar 2216E at 37 ± 0.5 °C for 18–24 h. Other strains were inoculated into Luria-Bertani (LB) broth at 37 ± 0.5 °C with shaking at 150 rpm for 8–10 h. Wizard Genomic DNA Extraction Kit (Promega, Madison, WI, USA) was used to extract DNA according to the manufacturer’s protocol.

2.2. Design of Primers and Probes

Publicly available genome data of over 18,000 Staphylococcus spp. isolates were retrieved from the National Center for Biotechnology Information (NCBI) assembly database, involving more than 60 Staphylococcus species. Taxonomic classification of Staphylococcus spp. was confirmed by type (strain) genome server (https://tygs.dsmz.de/) accessed on 20 July 2021 [25]. The core genes of S. aureus alone and all Staphylococcus spp. were identified by Roary pipeline (https://github.com/sanger-pathogens/Roary, accessed on 20 July 2021) with an identity cut-off of 50% [26]. Then, primers and probes were designed for the S. aureus species-specific conserved gene FMN-bgsfp (encoding FMN-binding glutamate synthase family protein) and Staphylococcus genus-specific conserved gene tuf (encoding elongation factor Tu) by Primer Premier 5 [27]. The specificity of primers was checked by basic local alignment search tool (BLAST) search (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 20 July 2021). The quencher used was BHQ1 and the fluorophore used was FAM, which can be monitored in the qPCR system. The primers and probes were synthesized and purified by Sangon Bioengineering (Shanghai, China) Co., Ltd. The details of primers and probes sequences are shown in Table 1.

2.3. Conventional PCR and MIRA-qPCR

Conventional PCR amplification was performed by Labcycler PCR instrument (Sensoquest, Göttingen, Germany). The final volume of the amplification reaction mixture was 25 μL containing 12.5 μL of 2 × Es Taq MasterMix (Dye) (CWBIO, Beijing, China), 2 μL (10 μM) forward and reverse primers, 2 μL of genomic DNA and 8.5 μL of nuclease-free water. The amplification conditions comprised an initial 10 min denaturation step at 95 °C followed by 30 cycles of 10 s at 95 °C, 30 s at 56 °C and 30 s at 72 °C, with a final extension at 72 °C for 10 min. PCR products (3 μL for each sample) were electrophoresed through agarose gels (2%, w/v) at 80V for 50 min. Bands representing the corresponding fragment sizes were detected by Gel imager (Bio-Rad, California, USA).
MIRA-qPCR amplification was performed by Applied Biosystems QuantStudio 6 Flex Real-Time PCR (Singapore Life Technologies Holdings Pte Ltd., Singapore). MIRA basic kit (Amp-future, Weifang, China) was used for nucleic acid amplification according to the manufacturer’s instructions. MIRA-qPCR assay was performed in a 50 μL volume. The mixture was prepared in a tube containing 29.4 μL of Buffer A, 2 μL (10 μM) of forward primers, 2 μL (10 μM) of backward primers, 0.6 μL (10 μM) of probes, 9.5 μL of nuclease-free water and 4 μL of genomic DNA. When 2.5 μL of Buffer B was added into the 47.5 μL mixture, the reaction started. The amplification condition was at 39 °C for 20 min. The fluorescence values for FAM channel were collected every 30 s. It was determined negative if the threshold cycle (Ct) value was reported as undetermined with fluorescent signal maintained at background level [28].

2.4. Test for Specificity, Sensitivity and Repeatability

For the specificity test, MIRA-qPCR was performed with the genomic DNA templates from the 61 strains described above and conventional PCR was performed as control. The singular MIRA-qPCR was performed to verify the specificity of primers and probes for S. aureus (FMN-bgsfp) and Staphylococcus spp. (tuf), respectively. Then the duplex MIRA-qPCR was performed with specific primers and probes of S. aureus and non- aureus Staphylococci.
For the sensitivity test of MIRA-qPCR, the suspension of S. aureus ATCC 12600T strain was 10-fold diluted. The concentrations of bacterial suspensions were calculated by plate counting. Wizard Genomic DNA Extraction Kit (Promega, Madison, WI, USA) was used to extract the genomic DNA from the diluted bacterial suspensions. Then the DNA templates were used for MIRA-qPCR assay. The limit of detection (LoD) of MIRA-qPCR was calculated based on the minimum concentration tested. Moreover, a comparative analysis of MIRA-qPCR and conventional PCR techniques was conducted.
For the repeatability test of MIRA-qPCR, three independent replicates were performed with the genomic DNA from the 10-fold serially diluted bacterial suspensions (the concentrations were 2.64 × 107 CFU/mL, 3 × 107 CFU/mL and 5.26 × 107 CFU/mL, respectively) of S. aureus ATCC 12600T. The repeatability was evaluated by the coefficient of variation (CV,CV = SD/M × 100%) [29] of Ct values.

2.5. S. aureus and non-aureus Staphylococci Detection in Simulated Samples

The detection ability of MIRA-qPCR assay was further explored by four kinds of simulated samples (dried tofu, pork, milk and feces). Dried tofu and raw pork samples (each 40 g) were washed twice with 10 mL of sterile distilled water and then were dried inside the hood under ultraviolet light for 3 min for sterilization. Then, 40 g of dried tofu and raw pork was cut into about 2 g each piece and then homogenized in a stomacher (Stomacher Lab-Blender 400, Seward, London, UK) for 3 min, respectively [30,31]. Milk (5 mL) was centrifuged for 15 min (8000 rpm, 10 °C) to remove the upper cream layer. The remainder was filtered with 0.45 μm filter membrane to remove impurities. The filtered milk was then diluted with distilled water at a ratio of 1:20 [32]. Feces (2 g) were thoroughly suspended in 10 mL Tris-HCl buffer (20 mM, pH 7.8) [33]. The dried tofu, pork, milk and fecal samples were confirmed to be Staphylococcus-negative by conventional PCR [34].
Secondly, S. aureus ATCC 12600T, S. epidermidis ATCC 14990T, S. haemolyticus ATCC 29970T, S. saprophyticus ATCC 15305T, S. xylosus CHPC 1.3379, S. caprae CHPC 1.7854, S. pasteuri CHPC 1.7875, S. pseudintermedius CHPC 1.7919 and S. hominis CHPC 1.7929 strains were, respectively, inoculated into LB broth at 37 ± 0.5 °C with shaking at 150 rpm for 8 h. Then the bacterial suspensions of the above strains were added into saline solution containing dried tofu, pork, milk or feces to make simulated samples.
Thirdly, to test the LoD of MIRA-qPCR, the bacterial suspensions (approximately 8.56 × 107 CFU/mL) of S. aureus ATCC 12600T were 10-fold serially diluted. Then, normal saline solution containing dried tofu, pork, milk or feces was added into the bacterial suspension with a volume ratio of 1:1 to make simulated samples. The nucleic acids of the above strains were extracted from each stimulated sample by Wizard Genomic DNA Extraction Kit (Promega, Madison, WI, USA), then MIRA-qPCR assay was performed. Blank samples were used as negative controls. The LoD was evaluated as mentioned.

3. Results

3.1. The Principle and Workflow of Duplex MIRA-qPCR Assay

This study aims to develop a novel strategy for the rapid and duplexed quantification of S. aureus and non-aureus Staphylococci by combining MIRA with qPCR. The target bacteria and samples were pretreated and DNA was extracted as the substrate for the next step (Figure 1A). The MIRA-qPCR enabled the amplification of DNA within 20 min at a constant temperature of 39 °C (Figure 1B). The detection principle of MIRA-qPCR is illustrated in Figure 1C. Recombinant enzyme and primers form a Rec/ssDNA. The SSB assists Rec/ssDNA to invade the double-stranded DNA template. When the complex Rec/ssDNA decomposes, the DNA polymerase binds to the 3’ end of the primer to start the chain extension. Finally, the probe is hydrolyzed and the target DNA is amplified. The appearance of fluorescence amplification curves of both tuf and FMN-bgsfp genes indicated the presence of S. aureus (Figure 1D). The appearance of a fluorescence amplification curve for only tuf gene but not FMN-bgsfp gene indicated the presence of non-aureus Staphylococci species. The absence of fluorescence amplification curves of tuf and FMN-bgsfp genes indicated the absence of any Staphylococcus species.

3.2. Specificity Analysis of the MIRA-qPCR

Nine Staphylococcus species (including S. aureus) and twenty-one non-Staphylococcus species were selected for the specificity analysis of MIRA-qPCR. Conventional PCR was performed as a control. In singular MIRA-qPCR, for the detection of S. aureus species-specific gene FMN-bgsfp, only S. aureus showed positive results in both MIRA-qPCR and conventional PCR, whereas the eight strains of non-aureus Staphylococci species and the twenty-one non-Staphylococcus strains showed negative results (Figure 2A). Similarly, for the detection of Staphylococcus genus-specific gene tuf, all nine strains of Staphylococcus species showed positive results in both MIRA-qPCR and conventional PCR, while all twenty-one non-Staphylococcus species strains showed negative results (Figure 2B). The same results were achieved using the other 31 strains of Staphylococcus species and non-Staphylococcus spp. strains (data not shown). These results showed that the primers and probes had strong specificity for both S. aureus and Staphylococcus spp.
In duplex MIRA-qPCR, the fluorescence amplification curves of both the FMN-bgsfp gene and tuf gene were detected in the reaction of S. aureus (Figure 3A). The fluorescence amplification curves of tuf gene but not FMN-bgsfp gene were detected in the reactions of non-aureus Staphylococci species (Figure 3B–I). No fluorescence amplification curves were detected in the reactions of non-Staphylococcus spp. strains (Figure 3J). In conventional PCR, the same results were observed (Figure 3K). Our results showed that the duplex MIRA-qPCR exhibited high specificity for simultaneous detection of S. aureus and non-aureus Staphylococci strains.

3.3. Sensitivity Analysis of the MIRA-qPCR

The sensitivity of MIRA-qPCR assay was tested by the bacterial suspensions of S. aureus ATCC12600T with serially diluted concentrations (3 × 108~3 × 101 CFU/mL) and all tests were repeated three times. The LoD of the MIRA-qPCR and conventional PCR assay with pure culture was 3 × 102 CFU/mL and 3 × 104 CFU/mL, respectively (Figure 4A). The LoD of the MIRA-qPCR was 100-fold more sensitive than that of conventional PCR. The linear regression analysis between Ct values and the concentrations of bacterial suspensions yielded R2 value above 0.99 and the slope was −2.532 (Figure 4B), indicating high linear relationship.

3.4. Repeatability Analysis of the MIRA-qPCR

In order to analyze the repeatability of MIRA-qPCR, three independent replicates were performed and the corresponding Ct values of fluorescence amplification curves were statistically analyzed. The CV values ranged from 0.13% to 2.09%, indicating good repeatability (Table 2).

3.5. Evaluation of MIRA-qPCR Assay Using Simulated Samples

To ascertain the applicability of the MIRA-qPCR assay as a surveillance tool for Staphylococcus spp., MIRA-qPCR assay was tested by artificially inoculating S. aureus, S. epidermidis, S. haemolyticus, S. saprophytics, S. xylosus, S. caprae, S. pasteuri, S. pseudintermedius and S. hominis stains into dried tofu, pork, milk and feces, respectively. The results showed that nine Staphylococcus species (including S. aureus) were successfully detected in the four simulated samples (Figure 5A–D). Additionally, for S. aureus, positive amplification can be observed when the concentrations of bacteria were more than 8.56 × 103 CFU/mL (Figure 5E–H). No amplification curve was observed in simulated samples without Staphylococcus.

4. Discussion

Among Staphylococci, S. aureus is the most frequently isolated and the most important pathogen, but the incidences of non-aureus Staphylococci infection have increased throughout the world [8,35]. Therefore, it is most important to distinguish S. aureus from non-aureus Staphylococci in clinical practice and food safety investigation. It is also important to confirm the presence of non-aureus Staphylococci, given its increasing significance [14]. However, the detection of Staphylococcus mainly focused on certain species, especially S. aureus [36,37,38], and few studies detected S. aureus and non-aureus Staphylococci at the same time. Okolie et al. and McClure et al. [39,40] established multiplex conventional PCR assays detecting S. aureus and other Staphylococci spp. simultaneously. However, the complex thermal cycles, long detection time and low sensitivity limit its application. Therefore, our study aimed at proffering a new solution, MIRA-qPCR, to overcome the above limitations and make the detection simpler and more efficient.
The selection of targeted genes is critical for pathogenic bacteria detection. The tuf gene has been reported as a good target to allow the detection of Staphylococci at the genus level [41]. Sakai et al. developed a PCR-based assay that targets tuf gene for the identification of S. aureus and a variety of CoNS [42]. As for the identification of S. aureus species, the 16S rRNA, nuc gene and femA gene were used as target genes [36,40,43]. However, some of these genes cannot discriminate between phylogenetically closely related species, such as the S. epidermidis and S. aureus cluster groups [38]. Further, some researchers reported that some of these genes were unsuitable to detect poly-microbial samples harboring S. aureus and CoNS [39]. Rapid development of high-throughput sequencing technology has increased the number of whole-genome sequences available in public databases, making it easy to obtain novel target genes specific to Staphylococcus spp. using bioinformatics approaches [44]. Thus, we designed specific primers and probes of two conserved genes (FMN-bgsfp and tuf) for S. aureus species and Staphylococcus genus, respectively. MIRA-qPCR assay confirmed the specificity of these primers and probes and positive results were generated for S. aureus and non-aureus Staphylococci strains but not non-Staphylococcus strains.
MIRA-qPCR also exhibited high sensitivity. Our results showed that in conventional PCR, the LoD was 3 × 104 CFU/mL, while in MIRA-qPCR system, the LoD was 3 × 102 CFU/mL, which was 100-fold more sensitive than that of the conventional PCR assay. Wu et al. detected S. aureus based on loop-mediated isothermal amplification (LAMP), which showed high sensitivity with a detection limit of 4 × 102 CFU/mL, similar to our results [45]. Furthermore, our statistical analysis of the Ct values showed that MIRA-qPCR had good repeatability. To evaluate the practical application of MIRA-qPCR to detect S. aureus and non-aureus Staphylococci strains, artificially contaminated dried tofu, pork, milk and fecal samples were analyzed. Positive amplifications of nine Staphylococcus species were observed in these four stimulated samples. The LoD of MIRA-qPCR was 8.56 × 103 CFU/mL in simulated samples, which was approximately 10-fold less sensitive than that in pure bacterial suspension. Previously, some researchers reported that lower detection sensitivity for artificially contaminated samples was attributed to certain factors, such as food particles, nutrient content, pH value and inhibitors [46]. Thus, we assumed that simulated samples were negative at a bacterial concentration of 8.56 × 102 CFU/mL in this study, which might be related to food and fecal particles or other potential factors.
In recent years, emerging isothermal amplification techniques have provided new opportunities for pathogen detection. Helicase-dependent amplification (HDA) was performed at 60~65 °C for 60~120 min [47,48]. LAMP has the advantages of accuracy and sensitivity [49], but it has some drawbacks, such as false-positive results [50]. Crossing priming amplification (CPA) with amplification temperatures at 37~42 °C for 20~40 min is efficient but is not ideal for discriminating between mutations or identifying mutations based on the performance of a nested recombinase polymerase amplification (RPA)-based assay [51]. Compared to the assays mentioned above, MIRA-qPCR has its own advantages in pathogen detection. Its detection time can be shortened to 20 min because of the high amplification efficiency of multienzyme cooperation. The amplification process is completed in a single run, which was unnecessary to open the lid in the process. Completely closed tube operation can greatly reduce the risk of contamination and improve the specificity of detection [52]. Moreover, the results of MIRA-qPCR assay can be interpreted by the fluorescence curves, which is simple and user friendly. Compared with conventional PCR and LAMP, agarose gel electrophoresis or turbidimetry is not required in MIRA-qPCR, which shortens the workflow and decreases the risk of contamination [53,54,55]. The duplex MIRA-qPCR assay in this study required only two pairs of primers for the detection of S. aureus and non-aureus Staphylococci. In LAMP, multiple primers were required, including two outer primers, two inner primers and two loop primers [56]. Simper primer requirements for MIRA-qPCR can avoid nonspecific amplification of DNA templates. In addition, the reagents used in MIRA-qPCR can be easily transported as freeze-dried powder. Primers and probes can be freeze-dried together with the reagents into commercial kits, which are easy and flexible for storage and, thus, are suitable for on-site real-time detection. In addition, MIAR-qPCR is cost effective with simple laboratory settings for analysis and only requires heating the samples to reaction temperature to accomplish rapid, sensitive and reliable detection. It is believed that as the costs further decrease in the future, MIRA-qPCR can gain wider application.
However, the MIRA-qPCR assay had some limitations to overcome. Firstly, among Staphylococci, MRSA infections are common in hospital settings [57]. In addition to the genus of Staphylococcus, the common clinical and food-borne infection sources include many other bacteria, such as Enterococcus faecalis, Enterobacter cloacae, Clostridium perfringens, Listeria monocytogenes and Campylobacter jejuni [58,59,60,61].Therefore, the multiplex MIRA-qPCR for detecting MRSA, Staphylococcus spp. and bacterial pathogens of other genera can be established in the future. Secondly, the reaction temperature in MIRA-qPCR is close to room temperature, which means that the reaction is likely to start before the mixture is placed on the qPCR instrument. In that case, complete amplification curves cannot be seen and results cannot be interpreted. Further studies are needed to avoid this circumstance and to optimize the amplification temperature of MIRA-qPCR. Thirdly, a DNA extraction process is still required in MIRA-qPCR. The combination of DNA extraction and amplification can greatly increase the efficiency and convenience of MIRA-qPCR.
The MIRA-qPCR method is rapid, quantitative and feasible. The whole process can be accomplished within 20 min, which is far more efficient than the traditional process. Results showed that the duplex MIRA-qPCR exhibited strong specificity and high sensitivity and the coefficient variation revealed the assay had good repeatability. Moreover, the detection of simulated samples demonstrated good applicability of the as-developed assay. In summary, the MIRA-qPCR method provides a novel strategy for the simultaneous duplex detection of clinical and food-borne pathogens and has potential as a primary screening tool.

Author Contributions

Conceptualization, J.L., X.L. and D.W.; methodology, J.L., Z.H., Y.X. and K.Y.; software, J.L., Z.H. and Y.X.; validation, J.L.; formal analysis, J.L. and Z.H.; investigation, J.L., K.Y., X.B., H.G. and H.D.; resources, X.L. and D.W.; data curation, J.L., Z.H., Y.X. and K.Y.; writing—original draft preparation, J.L.; writing—review and editing, Z.H., Y.X., K.Y., X.L. and D.W.; visualization, J.L., Z.H., Y.X., K.Y., X.B., H.G. and H.D.; supervision, X.L. and D.W.; project administration, X.L. and D.W.; funding acquisition, D.W. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Science and Technology Infrastructure of China (National Pathogen Resource Center-NPRC-32) and the National Science and Technology Fundamental Resources Investigation Program of China (2021FY100904).

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki and approved by National Institute for Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention (approved in 2021) for studies involving humans.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The original contributions presented in the study are included in the article. Further inquiries can be directed to the corresponding authors.

Acknowledgments

We thank the researchers who facilitated the completion of this study.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Syed, M.A.; Ullah, H.; Tabassum, S.; Fatima, B.; Woodley, T.A.; Ramadan, H.; Jackson, C.R. Staphylococci in poultry intestines: A comparison between farmed and household chickens. Poult. Sci. 2020, 99, 4549–4557. [Google Scholar] [CrossRef]
  2. Mourenza, Á.; Gil, J.A.; Mateos, L.M.; Letek, M. Novel treatments and preventative strategies against food-poisoning caused by staphylococcal species. Pathogens 2021, 10, 91. [Google Scholar] [CrossRef] [PubMed]
  3. Ebani, V.V. Biology and pathogenesis of Staphylococcus infection. Microorganisms 2020, 8, 383. [Google Scholar] [CrossRef] [PubMed]
  4. Riegel, P.; Jesel-Morel, L.; Laventie, B.; Boisset, S.; Vandenesch, F.; Prévost, G. Coagulase-positive Staphylococcus pseudintermedius from animals causing human endocarditis. Int. J. Med. Microbiol. 2011, 301, 237–239. [Google Scholar] [CrossRef] [PubMed]
  5. Götz, F. Staphylococcus and biofilms. Mol. Microbiol. 2002, 43, 1367–1378. [Google Scholar] [CrossRef] [PubMed]
  6. Gordon, R.J.; Lowy, F.D. Pathogenesis of methicillin-resistant Staphylococcus aureus infection. Clin. Infect. Dis. 2008, 46 (Suppl. 5), S350–S359. [Google Scholar] [CrossRef]
  7. Penesyan, A.; Gillings, M.; Paulsen, I.T. Antibiotic discovery: Combatting bacterial resistance in cells and in biofilm communities. Molecules 2015, 20, 5286–5298. [Google Scholar] [CrossRef]
  8. Cheung, G.Y.C.; Bae, J.S.; Otto, M. Pathogenicity and virulence of Staphylococcus aureus. Virulence 2021, 12, 547–569. [Google Scholar] [CrossRef]
  9. Boucher, H.W.; Talbot, G.H.; Benjamin, D.K., Jr.; Bradley, J.; Guidos, R.J.; Jones, R.N.; Murray, B.E.; Bonomo, R.A.; Gilbert, D. 10 × ′20 Progress—Development of new drugs active against gram-negative bacilli: An update from the Infectious Diseases Society of America. Clin. Infect. Dis. 2013, 56, 1685–1694. [Google Scholar] [CrossRef]
  10. Khoshnood, S.; Heidary, M.; Asadi, A.; Soleimani, S.; Motahar, M.; Savari, M.; Saki, M.; Abdi, M. A review on mechanism of action, resistance, synergism, and clinical implications of mupirocin against Staphylococcus aureus. Biomed. Pharmacother. 2019, 109, 1809–1818. [Google Scholar] [CrossRef]
  11. França, A.; Gaio, V.; Lopes, N.; Melo, L.D.R. Virulence factors in coagulase-negative staphylococci. Pathogens 2021, 10, 170. [Google Scholar] [CrossRef] [PubMed]
  12. Michels, R.; Last, K.; Becker, S.L.; Papan, C. Update on coagulase-negative staphylococci—What the clinician should know. Microorganisms 2021, 9, 830. [Google Scholar] [CrossRef] [PubMed]
  13. Otto, M. Staphylococcus epidermidis—The ‘accidental’ pathogen. Nat. Rev. Microbiol. 2009, 7, 555–567. [Google Scholar] [CrossRef]
  14. Argemi, X.; Hansmann, Y.; Prola, K.; Prévost, G. Coagulase-negative staphylococci pathogenomics. Int. J. Mol. Sci. 2019, 20, 1215. [Google Scholar] [CrossRef]
  15. Lina, G. New insights into coagulase-negative staphylococci. Clin. Microbiol. Infect. 2019, 25, 1063. [Google Scholar] [CrossRef] [PubMed]
  16. Babenko, D.; Omarkulov, B.; Ilyaazizov; Sandle, T.; Moraru, D.C.; Chesca, A.E. Evaluation of sequence based typing methods (SPA and MSLT) for clonal characterization of Staphylococcus aureus. Acta Med. Mediterr. 2016, 32, 1851–1856. [Google Scholar]
  17. Sudhaharan, S.; Vanjari, L.; Mamidi, N.; Ede, N.; Vemu, L. Evaluation of LAMP assay using phenotypic tests and conventional PCR for detection of nuc and mecA genes among clinical isolates of Staphylococcus spp. J. Clin. Diagn. Res. 2015, 9, DC06–DC09. [Google Scholar] [CrossRef]
  18. Zhu, H.; Zhang, H.; Xu, Y.; Laššáková, S.; Korabečná, M.; Neužil, P. PCR past, present and future. Biotechniques 2020, 69, 317–325. [Google Scholar] [CrossRef]
  19. Xu, S.; Xie, X.; Shi, Y.; Chai, A.; Li, B.; Li, L. Development of a real-time quantitative PCR assay for the specific detection of Bacillus velezensis and its application in the study of colonization ability. Microorganisms 2022, 10, 1216. [Google Scholar] [CrossRef]
  20. Lorenz, T.C. Polymerase chain reaction: Basic protocol plus troubleshooting and optimization strategies. J. Vis. Exp. 2012, 63, e3998. [Google Scholar] [CrossRef]
  21. Yang, J.; Zhang, N.; Lv, J.; Zhu, P.; Pan, X.; Hu, J.; Wu, W.; Li, S.; Li, H. Comparing the performance of conventional PCR, RTQ-PCR, and droplet digital PCR assays in detection of Shigella. Mol. Cell. Probes 2020, 51, 101531. [Google Scholar] [CrossRef] [PubMed]
  22. Chen, H.; Sun, C.; Wang, Y.; Gao, X.; You, J.; Yu, W.; Sun, N.; Yang, Y.; Li, X. Rapid detection of SARS-CoV-2 using duplex reverse transcription-multienzyme isothermal rapid amplification in a point-of-care testing. Front. Cell. Infect. Microbiol. 2021, 11, 678703. [Google Scholar] [CrossRef] [PubMed]
  23. Sun, M.L.; Lai, H.Y.; Chong, N.Y.; Liu, D.F.; Zhang, Z.Y.; Pang, B.; Yao, J. Simple and feasible detection of hepatitis B virus via combination of multienzyme isothermal rapid amplification and lateral flow dipstick strip. Front. Mol. Biosci. 2021, 8, 763079. [Google Scholar] [CrossRef] [PubMed]
  24. Lu, Y.; Li, M.C.; Liu, H.C.; Lin, S.Q.; Zhao, X.Q.; Liu, Z.G.; Zhao, L.L.; Wan, K.L. Detecting Mycobacterium tuberculosis complex and rifampicin resistance via a new rapid multienzyme isothermal point mutation assay. Anal. Biochem. 2021, 630, 114341. [Google Scholar] [CrossRef]
  25. Meier-Kolthoff, J.P.; Göker, M. TYGS is an automated high-throughput platform for state-of-the-art genome-based taxonomy. Nat. Commun. 2019, 10, 2182. [Google Scholar] [CrossRef]
  26. Page, A.J.; Cummins, C.A.; Hunt, M.; Wong, V.K.; Reuter, S.; Holden, M.T.; Fookes, M.; Falush, D.; Keane, J.A.; Parkhill, J. Roary: Rapid large-scale prokaryote pan genome analysis. Bioinformatics 2015, 31, 3691–3693. [Google Scholar] [CrossRef]
  27. He, P.; Wang, H.; Yan, Y.; Zhu, G.; Chen, Z. Development and application of a multiplex fluorescent PCR for Shigella detection and species identification. J. Fluoresc. 2022, 32, 707–713. [Google Scholar] [CrossRef]
  28. Zhang, Y.; Li, Q.; Guo, J.; Li, D.; Wang, L.; Wang, X.; Xing, G.; Deng, R.; Zhang, G. An isothermal molecular point of care testing for African swine fever virus using recombinase-aided amplification and lateral flow assay without the need to extract nucleic acids in blood. Front. Cell. Infect. Microbiol. 2021, 11, 633763. [Google Scholar] [CrossRef]
  29. Ren, Y.; Allenmark, F.; Müller, H.J.; Shi, Z. Variation in the "coefficient of variation": Rethinking the violation of the scalar property in time-duration judgments. Acta Psychol. 2021, 214, 103263. [Google Scholar] [CrossRef]
  30. Alarcón, B.; Vicedo, B.; Aznar, R. PCR-based procedures for detection and quantification of Staphylococcus aureus and their application in food. J. Appl. Microbiol. 2006, 100, 352–364. [Google Scholar] [CrossRef]
  31. Vichaibun, V.; Kanchanaphum, P. Quantitative LAMP and PCR detection of Salmonella in chicken samples collected from local markets around Pathum Thani province, Thailand. Int. J. Food. Sci. 2020, 2020, 8833173. [Google Scholar] [CrossRef] [PubMed]
  32. Ma, X.; Lin, X.; Xu, X.; Wang, Z. Fabrication of gold/silver nanodimer SERS probes for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus. Mikrochim. Acta 2021, 188, 202. [Google Scholar] [CrossRef] [PubMed]
  33. Feng, Z.S.; Li, J.Y.; Zhang, J.Y.; Li, F.Y.; Guan, H.X.; Zhang, R.Q.; Liu, H.; Guo, Q.; Shen, X.X.; Kan, B.; et al. Development and evaluation of a sensitive recombinase aided amplification assay for rapid detection of Vibrio parahaemolyticus. J. Microbiol. Methods 2022, 193, 106404. [Google Scholar] [CrossRef]
  34. Wang, Y.; Li, D.; Wang, Y.; Li, K.; Ye, C. Rapid and sensitive detection of Vibrio parahaemolyticus and Vibrio vulnificus by multiple endonuclease restriction real-time loop-mediated isothermal amplification technique. Molecules 2016, 21, 111. [Google Scholar] [CrossRef] [PubMed]
  35. Heilmann, C.; Ziebuhr, W.; Becker, K. Are coagulase-negative staphylococci virulent? Clin. Microbiol. Infect. 2019, 25, 1071–1080. [Google Scholar] [CrossRef] [PubMed]
  36. Meng, X.; Zhang, G.; Sun, B.; Liu, S.; Wang, Y.; Gao, M.; Fan, Y.; Zhang, G.; Shi, G.; Kang, X. Rapid detection of mecA and femA genes by loop-mediated isothermal amplification in a microfluidic system for discrimination of different Staphylococcal species and prediction of methicillin resistance. Front. Microbiol. 2020, 11, 1487. [Google Scholar] [CrossRef]
  37. Zhou, J.; Yin, L.; Dong, Y.; Peng, L.; Liu, G.; Man, S.; Ma, L. CRISPR-Cas13a based bacterial detection platform: Sensing pathogen Staphylococcus aureus in food samples. Anal. Chim. Acta 2020, 1127, 225–233. [Google Scholar] [CrossRef]
  38. Kim, E.; Yang, S.M.; Won, J.E.; Kim, D.Y.; Kim, D.S.; Kim, H.Y. Real-time PCR method for the rapid detection and quantification of pathogenic Staphylococcus species based on novel molecular target genes. Foods 2021, 10, 2839. [Google Scholar] [CrossRef]
  39. Okolie, C.E.; Wooldridge, K.G.; Turner, D.P.; Cockayne, A.; James, R. Development of a new pentaplex real-time PCR assay for the identification of poly-microbial specimens containing Staphylococcus aureus and other staphylococci, with simultaneous detection of staphylococcal virulence and methicillin resistance markers. Mol. Cell. Probes 2015, 29, 144–150. [Google Scholar] [CrossRef]
  40. McClure, J.A.; Zaal DeLongchamp, J.; Conly, J.M.; Zhang, K. Novel multiplex PCR assay for detection of chlorhexidine-quaternary ammonium, mupirocin, and methicillin resistance genes, with simultaneous discrimination of Staphylococcus aureus from coagulase-negative staphylococci. J. Clin. Microbiol. 2017, 55, 1857–1864. [Google Scholar] [CrossRef]
  41. Tang, Y.W.; Kilic, A.; Yang, Q.; McAllister, S.K.; Li, H.; Miller, R.S.; McCormac, M.; Tracy, K.D.; Stratton, C.W.; Han, J.; et al. StaphPlex system for rapid and simultaneous identification of antibiotic resistance determinants and Panton-Valentine leukocidin detection of staphylococci from positive blood cultures. J. Clin. Microbiol. 2007, 45, 1867–1873. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Sakai, H.; Procop, G.W.; Kobayashi, N.; Togawa, D.; Wilson, D.A.; Borden, L.; Krebs, V.; Bauer, T.W. Simultaneous detection of Staphylococcus aureus and coagulase-negative staphylococci in positive blood cultures by real-time PCR with two fluorescence resonance energy transfer probe sets. J. Clin. Microbiol. 2004, 42, 5739–5744. [Google Scholar] [CrossRef] [PubMed]
  43. Kim, J.; Hong, J.; Lim, J.A.; Heu, S.; Roh, E. Improved multiplex PCR primers for rapid identification of coagulase-negative staphylococci. Arch. Microbiol. 2018, 200, 73–83. [Google Scholar] [CrossRef] [PubMed]
  44. Shang, Y.; Ye, Q.; Cai, S.; Wu, Q.; Pang, R.; Yang, S.; Xiang, X.; Wang, C.; Zha, F.; Ding, Y.; et al. Loop-mediated isothermal amplification (LAMP) for rapid detection of Salmonella in foods based on new molecular targets. LWT 2021, 142, 110999. [Google Scholar] [CrossRef]
  45. Wu, C.; Zeng, Y.; He, Y. Rapid visualization and detection of Staphylococcus aureus based on loop-mediated isothermal amplification. World J. Microbiol. Biotechnol. 2021, 37, 209. [Google Scholar] [CrossRef] [PubMed]
  46. Hu, J.; Wang, Y.; Ding, H.; Jiang, C.; Geng, Y.; Sun, X.; Jing, J.; Gao, H.; Wang, Z.; Dong, C. Recombinase polymerase amplification with polymer flocculation sedimentation for rapid detection of Staphylococcus aureus in food samples. Int. J. Food Microbiol. 2020, 331, 108691. [Google Scholar] [CrossRef]
  47. Deng, H.; Gao, Z. Bioanalytical applications of isothermal nucleic acid amplification techniques. Anal. Chim. Acta 2015, 853, 30–45. [Google Scholar] [CrossRef]
  48. Shanmugakani, R.K.; Bonam, W.; Erickson, D.; Mehta, S. An isothermal amplification-based point-of-care diagnostic platform for the detection of Mycobacterium tuberculosis: A proof-of-concept study. Curr. Res. Biotechnol. 2021, 3, 154–159. [Google Scholar] [CrossRef]
  49. Pilchová, V.; Seinige, D.; Hennig-Pauka, I.; Büttner, K.; Abdulmawjood, A.; Kehrenberg, C. Development and validation of a loop-mediated isothermal amplification (LAMP) assay for rapid detection of Glaesserella (Haemophilus) parasuis. Microorganisms 2020, 9, 41. [Google Scholar] [CrossRef]
  50. Shahbazi, E.; Mollasalehi, H.; Minai-Tehrani, D. Development and evaluation of an improved quantitative loop-mediated isothermal amplification method for rapid detection of Morganella morganii. Talanta 2019, 191, 54–58. [Google Scholar] [CrossRef]
  51. Ng, B.Y.C.; Wee, E.J.H.; Woods, K.; Anderson, W.; Antaw, F.; Tsang, H.Z.H.; West, N.P.; Trau, M. Isothermal point mutation detection: Toward a first-pass screening strategy for multidrug-resistant tuberculosis. Anal. Chem. 2017, 89, 9017–9022. [Google Scholar] [CrossRef] [PubMed]
  52. Weng, J.; Sheng, N.; Wang, R.; Liang, S.; Wang, C.; Bai, X.; Zhou, G.; Zou, B.; Song, Q. Multiplex visualized closed-tube PCR with hamming distance 2 code for 15 HPV subtype typing. Anal. Chem. 2021, 93, 5529–5536. [Google Scholar] [CrossRef] [PubMed]
  53. Waters, D.L.; Shapter, F.M. The polymerase chain reaction (PCR): General methods. Methods Mol. Biol. 2014, 1099, 65–75. [Google Scholar] [CrossRef] [PubMed]
  54. Wong, Y.P.; Othman, S.; Lau, Y.L.; Radu, S.; Chee, H.Y. Loop-mediated isothermal amplification (LAMP): A versatile technique for detection of micro-organisms. J. Appl. Microbiol. 2018, 124, 626–643. [Google Scholar] [CrossRef]
  55. Bu, Y.; Qiao, W.; Zhai, Z.; Liu, T.; Gong, P.; Zhang, L.; Hao, Y.; Yi, H. Establishment and evaluation of a loop-mediated isothermal amplification (LAMP) assay for rapid detection of Pseudomonas fluorescens in raw milk. Front. Microbiol. 2021, 12, 810511. [Google Scholar] [CrossRef]
  56. Stehlíková, D.; Beran, P.; Cohen, S.P.; Čurn, V. Development of real-time and colorimetric loop mediated isothermal amplification assay for detection of Xanthomonas gardneri. Microorganisms 2020, 8, 1301. [Google Scholar] [CrossRef]
  57. Lakhundi, S.; Zhang, K. Methicillin-resistant Staphylococcus aureus: Molecular characterization, evolution, and epidemiology. Clin. Microbiol. Rev. 2018, 31, e00020-18. [Google Scholar] [CrossRef]
  58. Huang, Q.Q.; Liu, B.B.; Zhu, H.F.; Ma, J.J.; Tsoi, M.; Yao, B.Q.; Yao, L.C.; Wu, Q.; Mu, X.Q.; Liu, S.L. Rapid and sensitive detection of the vanA resistance gene from clinical Enterococcus faecium and Enterococcus faecalis isolates by loop-mediated isothermal amplification. J. Glob. Antimicrob. Resist. 2019, 16, 262–265. [Google Scholar] [CrossRef]
  59. Ji, Y.; Wang, P.; Xu, T.; Zhou, Y.; Chen, R.; Zhu, H.; Zhou, K. Development of a one-step multiplex PCR assay for differential detection of four species (Enterobacter cloacae, Enterobacter hormaechei, Enterobacter roggenkampii, and Enterobacter kobei) belonging to Enterobacter cloacae complex with clinical significance. Front. Cell. Infect. Microbiol. 2021, 11, 677089. [Google Scholar] [CrossRef]
  60. Razei, A.; Sorouri, R.; Mousavi, S.L.; Nazarian, S.; Amani, J.; Aghamollaei, H. Presenting a rapid method for detection of Bacillus cereus, Listeria monocytogenes and Campylobacter jejuni in food samples. Iran J. Basic Med. Sci. 2017, 20, 1050–1055. [Google Scholar] [CrossRef]
  61. Maikanov, B.; Mustafina, R.; Auteleyeva, L.; Wiśniewski, J.; Anusz, K.; Grenda, T.; Kwiatek, K.; Goldsztejn, M.; Grabczak, M. Clostridium botulinum and Clostridium perfringens occurrence in Kazakh honey samples. Toxins 2019, 11, 472. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Figure 1. Schematic illustration of the workflow of duplex MIRA-qPCR assay. The detection process can be roughly divided into three steps. (A) Step I, the extraction of DNA. (B,C) Step II, the amplification and detection of DNA by MIRA-qPCR. (D) Step III, the interpretation of fluorescent signals.
Figure 1. Schematic illustration of the workflow of duplex MIRA-qPCR assay. The detection process can be roughly divided into three steps. (A) Step I, the extraction of DNA. (B,C) Step II, the amplification and detection of DNA by MIRA-qPCR. (D) Step III, the interpretation of fluorescent signals.
Microorganisms 10 01734 g001
Figure 2. The amplification curves and the results of agarose gel electrophoresis of singular MIRA-qPCR and singular conventional PCR. (A) Detection of S. aureus species-specific gene FMN-bgsfp. (B) Detection of Staphylococcus genus-specific gene tuf. Insets show the results of conventional PCR. M: DL2000 Marker; Lane 1: S. aureus ATCC 12600T; Lane 2-9: S. epidermidis ATCC 14990T, S. haemolyticus ATCC 29970T, S. saprophyticus ATCC 15305T, S. xylosus CHPC 1.3379, S. caprae CHPC 1.7854, S. pasteuri CHPC 1.7875, S. pseudintermedius CHPC 1.7919 and S. hominis CHPC 1.7929; Lane 10-30: Vibrio parahaemolyticus CHPC 1.1001, Klebsiella pneumonia CHPC 1.1005, Vibrio cholerae CHPC 1.1088, Shewanella sp. CHPC 1.1202, Aeromonas veronii CHPC 1.3269, Escherichia coli O157 CHPC 1.1401, Pseudomonas aeruginosa CHPC 1.7890, Plesiomonas shigelloides CHPC 1.6301, Listeria monocytogenes CHPC 1.4719, Listeria ivanovii CHPC 1.7962, Listeria innocua CHPC 1.7935, Enterococcus faecalis CHPC 1.1367, Enterococcus faecium CHPC 1.3256, Enterobacter cloacae CHPC 1.1004, Salmonella enterica serovar Typhimurium CHPC 1.8647, Salmonella enterica serovar Enteritidis CHPC 1.8651, Campylobacter jejuni CHPC 1.7505, Campylobacter coli CHPC 1.7506, Acinetobacter baumannii CHPC 1.3380, Clostridium perfringens CHPC 1.3140 and Shigella sonnei CHPC 1.1397.
Figure 2. The amplification curves and the results of agarose gel electrophoresis of singular MIRA-qPCR and singular conventional PCR. (A) Detection of S. aureus species-specific gene FMN-bgsfp. (B) Detection of Staphylococcus genus-specific gene tuf. Insets show the results of conventional PCR. M: DL2000 Marker; Lane 1: S. aureus ATCC 12600T; Lane 2-9: S. epidermidis ATCC 14990T, S. haemolyticus ATCC 29970T, S. saprophyticus ATCC 15305T, S. xylosus CHPC 1.3379, S. caprae CHPC 1.7854, S. pasteuri CHPC 1.7875, S. pseudintermedius CHPC 1.7919 and S. hominis CHPC 1.7929; Lane 10-30: Vibrio parahaemolyticus CHPC 1.1001, Klebsiella pneumonia CHPC 1.1005, Vibrio cholerae CHPC 1.1088, Shewanella sp. CHPC 1.1202, Aeromonas veronii CHPC 1.3269, Escherichia coli O157 CHPC 1.1401, Pseudomonas aeruginosa CHPC 1.7890, Plesiomonas shigelloides CHPC 1.6301, Listeria monocytogenes CHPC 1.4719, Listeria ivanovii CHPC 1.7962, Listeria innocua CHPC 1.7935, Enterococcus faecalis CHPC 1.1367, Enterococcus faecium CHPC 1.3256, Enterobacter cloacae CHPC 1.1004, Salmonella enterica serovar Typhimurium CHPC 1.8647, Salmonella enterica serovar Enteritidis CHPC 1.8651, Campylobacter jejuni CHPC 1.7505, Campylobacter coli CHPC 1.7506, Acinetobacter baumannii CHPC 1.3380, Clostridium perfringens CHPC 1.3140 and Shigella sonnei CHPC 1.1397.
Microorganisms 10 01734 g002
Figure 3. The amplification curves and the results of agarose gel electrophoresis of duplex MIRA-qPCR and duplex conventional PCR. (A) S. aureus ATCC 12600T; (B) S. epidermidis ATCC 14990T; (C) S. haemolyticus ATCC 29970T; (D) S. saprophyticus ATCC 15305T; (E) S. xylosus CHPC 1.3379; (F) S. caprae CHPC 1.7854; (G) S. pasteuri CHPC 1.7875; (H) S. pseudintermedius CHPC 1.7919; (I) S. hominis CHPC 1.7929 and (J) Vibrio parahaemolyticus CHPC 1.1001, Klebsiella pneumonia CHPC 1.1005, Vibrio cholera CHPC 1.1088, Shewanella sp. CHPC 1.1202, Aeromonas veronii CHPC 1.3269, Escherichia coli O157 CHPC 1.1401, Pseudomonas aeruginosa CHPC 1.7890, Plesiomonas shigelloides CHPC 1.6301, Listeria monocytogenes CHPC 1.4719, Listeria ivanovii CHPC 1.7962, Listeria innocua CHPC 1.7935, Enterococcus faecalis CHPC 1.1367, Enterococcus faecium CHPC 1.3256, Enterobacter cloacae CHPC 1.1004, Salmonella enterica serovar Typhimurium CHPC 1.8647, Salmonella enterica serovar Enteritidis CHPC 1.8651, Campylobacter jejuni CHPC 1.7505, Campylobacter coli CHPC 1.7506, Acinetobacter baumannii CHPC 1.3380, Clostridium perfringens CHPC 1.3140 and Shigella sonnei CHPC 1.1397. (K) The gel electrophoresis results of conventional PCR. M: DL2000 Marker; Lane 1: S. aureus ATCC 12600T; Lane 2-9: S. epidermidis ATCC 14990T, S. haemolyticus ATCC 29970T, S. saprophyticus ATCC 15305T, S. xylosus CHPC 1.3379, S. caprae CHPC 1.7854, S. pasteuri CHPC 1.7875, S. pseudintermedius CHPC 1.7919 and S. hominis CHPC 1.7929; Lane 10-30: Vibrio parahaemolyticus CHPC 1.1001, Klebsiella pneumonia CHPC 1.1005, Vibrio cholera CHPC 1.1088, Shewanella sp. CHPC 1.1202, Aeromonas veronii CHPC 1.3269, Escherichia coli O157 CHPC 1.1401, Pseudomonas aeruginosa CHPC 1.7890, Plesiomonas shigelloides CHPC 1.6301, Listeria monocytogenes CHPC 1.4719, Listeria ivanovii CHPC 1.7962, Listeria innocua CHPC 1.7935, Enterococcus faecalis CHPC 1.1367, Enterococcus faecium CHPC 1.3256, Enterobacter cloacae CHPC 1.1004, Salmonella enterica serovar Typhimurium CHPC 1.8647, Salmonella enterica serovar Enteritidis CHPC 1.8651, Campylobacter jejuni CHPC 1.7505, Campylobacter coli CHPC 1.7506, Acinetobacter baumannii CHPC 1.3380, Clostridium perfringens CHPC 1.3140 and Shigella sonnei CHPC 1.1397.
Figure 3. The amplification curves and the results of agarose gel electrophoresis of duplex MIRA-qPCR and duplex conventional PCR. (A) S. aureus ATCC 12600T; (B) S. epidermidis ATCC 14990T; (C) S. haemolyticus ATCC 29970T; (D) S. saprophyticus ATCC 15305T; (E) S. xylosus CHPC 1.3379; (F) S. caprae CHPC 1.7854; (G) S. pasteuri CHPC 1.7875; (H) S. pseudintermedius CHPC 1.7919; (I) S. hominis CHPC 1.7929 and (J) Vibrio parahaemolyticus CHPC 1.1001, Klebsiella pneumonia CHPC 1.1005, Vibrio cholera CHPC 1.1088, Shewanella sp. CHPC 1.1202, Aeromonas veronii CHPC 1.3269, Escherichia coli O157 CHPC 1.1401, Pseudomonas aeruginosa CHPC 1.7890, Plesiomonas shigelloides CHPC 1.6301, Listeria monocytogenes CHPC 1.4719, Listeria ivanovii CHPC 1.7962, Listeria innocua CHPC 1.7935, Enterococcus faecalis CHPC 1.1367, Enterococcus faecium CHPC 1.3256, Enterobacter cloacae CHPC 1.1004, Salmonella enterica serovar Typhimurium CHPC 1.8647, Salmonella enterica serovar Enteritidis CHPC 1.8651, Campylobacter jejuni CHPC 1.7505, Campylobacter coli CHPC 1.7506, Acinetobacter baumannii CHPC 1.3380, Clostridium perfringens CHPC 1.3140 and Shigella sonnei CHPC 1.1397. (K) The gel electrophoresis results of conventional PCR. M: DL2000 Marker; Lane 1: S. aureus ATCC 12600T; Lane 2-9: S. epidermidis ATCC 14990T, S. haemolyticus ATCC 29970T, S. saprophyticus ATCC 15305T, S. xylosus CHPC 1.3379, S. caprae CHPC 1.7854, S. pasteuri CHPC 1.7875, S. pseudintermedius CHPC 1.7919 and S. hominis CHPC 1.7929; Lane 10-30: Vibrio parahaemolyticus CHPC 1.1001, Klebsiella pneumonia CHPC 1.1005, Vibrio cholera CHPC 1.1088, Shewanella sp. CHPC 1.1202, Aeromonas veronii CHPC 1.3269, Escherichia coli O157 CHPC 1.1401, Pseudomonas aeruginosa CHPC 1.7890, Plesiomonas shigelloides CHPC 1.6301, Listeria monocytogenes CHPC 1.4719, Listeria ivanovii CHPC 1.7962, Listeria innocua CHPC 1.7935, Enterococcus faecalis CHPC 1.1367, Enterococcus faecium CHPC 1.3256, Enterobacter cloacae CHPC 1.1004, Salmonella enterica serovar Typhimurium CHPC 1.8647, Salmonella enterica serovar Enteritidis CHPC 1.8651, Campylobacter jejuni CHPC 1.7505, Campylobacter coli CHPC 1.7506, Acinetobacter baumannii CHPC 1.3380, Clostridium perfringens CHPC 1.3140 and Shigella sonnei CHPC 1.1397.
Microorganisms 10 01734 g003
Figure 4. The LoD-relevant results of S. aureus ATCC 12600T by MIRA-qPCR and conventional PCR. (A) The amplification curves showed the LoD of MIRA-qPCR and the inset showed the LoD of conventional PCR. M: DL2000 Marker; Lane 1-7: the corresponding concentration of bacterial suspensions is 3 × 108~102 CFU/mL; Lane 8: Negative control. (B) The standard curve between the Ct values and the concentrations of bacterial suspension.
Figure 4. The LoD-relevant results of S. aureus ATCC 12600T by MIRA-qPCR and conventional PCR. (A) The amplification curves showed the LoD of MIRA-qPCR and the inset showed the LoD of conventional PCR. M: DL2000 Marker; Lane 1-7: the corresponding concentration of bacterial suspensions is 3 × 108~102 CFU/mL; Lane 8: Negative control. (B) The standard curve between the Ct values and the concentrations of bacterial suspension.
Microorganisms 10 01734 g004
Figure 5. Detection of the Staphylococci strains in simulated samples by MIRA-qPCR. (AD) Detection of nine Staphylococci species strains. (EH) The LoD of S. aureus ATCC 12600T strain.
Figure 5. Detection of the Staphylococci strains in simulated samples by MIRA-qPCR. (AD) Detection of nine Staphylococci species strains. (EH) The LoD of S. aureus ATCC 12600T strain.
Microorganisms 10 01734 g005
Table 1. Primers and probes information.
Table 1. Primers and probes information.
GeneTargetSequence (5′–3′)Product Sizes (bp)
FMN-bgsfpStaphylococcus aureusF: ATGACCAGCTTCGGTACTACTAAAGATTATC285
R: TCCATAACTCATACCAGATTGTCCTACGATAC
Probe:TCGCGAATGAGCGTTTATTTAGTCGTGAAGAATA[dT-FAM][THF]G[dT-BHQ1]GTACCGACAAAGATT[c3spacer]
tufStaphylococcus spp.F: CTTCCCAGGTGAYGAYGTACCTGTAATCGC220
R: ACCACGTTCAACACGGCCWGTAGCAACAGT
Probe: AACCATTCATGATGCCWGTTGAGGACGTAT[FAM-dT][THF][ BHQ1-dT]CAATCACTGGTCGTG [c3spacer]
Table 2. CV values and Ct values of different replicates.
Table 2. CV values and Ct values of different replicates.
Bacterial Concentration (CFU/mL)
N × 107N × 106N × 105N × 104N × 103N × 102
Ct values for Replicate 1 (N = 2.64)3.845.627.4810.2413.4615.86
Ct values for Replicate 2 (N = 3)3.755.687.4310.1713.4215.82
Ct values for Replicate 3 (N = 5.26)3.915.717.5110.2013.4815.85
Mean of Ct values3.835.677.4710.2013.4515.84
SD of Ct values0.080.050.040.040.030.02
CV (%)2.090.880.540.390.220.13
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Lai, J.; Huang, Z.; Xiao, Y.; Yu, K.; Bai, X.; Gao, H.; Dai, H.; Liu, X.; Wang, D. Development and Evaluation of Duplex MIRA-qPCR Assay for Simultaneous Detection of Staphylococcus aureus and non-aureus Staphylococci. Microorganisms 2022, 10, 1734. https://doi.org/10.3390/microorganisms10091734

AMA Style

Lai J, Huang Z, Xiao Y, Yu K, Bai X, Gao H, Dai H, Liu X, Wang D. Development and Evaluation of Duplex MIRA-qPCR Assay for Simultaneous Detection of Staphylococcus aureus and non-aureus Staphylococci. Microorganisms. 2022; 10(9):1734. https://doi.org/10.3390/microorganisms10091734

Chicago/Turabian Style

Lai, Jiulian, Zhenzhou Huang, Yue Xiao, Keyi Yu, Xuemei Bai, He Gao, Hang Dai, Xiaoning Liu, and Duochun Wang. 2022. "Development and Evaluation of Duplex MIRA-qPCR Assay for Simultaneous Detection of Staphylococcus aureus and non-aureus Staphylococci" Microorganisms 10, no. 9: 1734. https://doi.org/10.3390/microorganisms10091734

APA Style

Lai, J., Huang, Z., Xiao, Y., Yu, K., Bai, X., Gao, H., Dai, H., Liu, X., & Wang, D. (2022). Development and Evaluation of Duplex MIRA-qPCR Assay for Simultaneous Detection of Staphylococcus aureus and non-aureus Staphylococci. Microorganisms, 10(9), 1734. https://doi.org/10.3390/microorganisms10091734

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop