Haemoplasma Prevalence and Diversity in Three Invasive Rattus Species from Gauteng Province, South Africa
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Rattus Age Classes
2.3. Rattus and Ectoparasite Species Identification
2.4. Haemoplasma Screening
2.4.1. 16S rRNA PCR Assays
2.4.2. Additional Gene Regions
2.4.3. Polymerase Chain Reaction (PCR) Amplification and Nucleotide Sequencing
2.5. Phylogenetic Analyses
2.6. Statistical Analyses
3. Results
3.1. Haemoplasma Prevalence in Ectoparasites
3.2. Haemoplasma Prevalence in Buccal Swabs
3.3. Haemoplasma Prevalence in Rattus Kidneys
3.4. 16S rRNA Nucleotide Searches and Phylogenetic Analyses
3.5. Alternative Gene Regions
3.6. Statistical Analyses
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Willi, B.; Novacco, M.; Meli, M.L.; Wolf-Jäckel, G.A.; Boretti, F.S.; Wengi, N.; Lutz, H.; Hofmann-Lehmann, R. Haemotropic mycoplasmas of cats and dogs: Transmission, diagnosis, prevalence and importance in Europe. Schweiz. Arch. Fur Tierheilkd. 2010, 152, 237–244. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Cui, Y.; Zhang, Y.; Shi, K.; Yan, Y.; Jian, F.; Zhang, L.; Wang, R.; Ning, C. Molecular characterization of hemotropic mycoplasmas (Mycoplasma ovis and ’Candidatus Mycoplasma haemovis’) in sheep and goats in China. BMC Vet. Res. 2017, 13, 142. [Google Scholar] [CrossRef] [PubMed]
- Neimark, H.; Johansson, K.; Rikihisa, Y.; Tully, J.G. Proposal to transfer some members of the genera Haemobartonella and Eperythozoon to the genums Mycoplasma with descriptions of ‘Candidatus Mycoplasma haemofelis’, ‘Candidatus Mycoplasma haemomuris’, ‘Candidatus Mycoplasma haemosuis’ and ’Candidatus Mycoplasma wenyonii’. Int. J. Syst. Evol. Microbiol. 2001, 51, 891–899. [Google Scholar] [CrossRef] [PubMed]
- Neimark, H.; Peters, W.; Robinson, B.L.; Stewart, L.B. Phylogenetic analysis and description of Eperythrozoon coccoides, proposal to transfer to the genus Mycoplasma as Mycoplasma coccoides comb. nov. and request for an opinion. Int. J. Syst. Evol. Microbiol. 2005, 55, 1385–1391. [Google Scholar] [CrossRef] [PubMed]
- Uilenberg, G.; Thiaucourt, F.; Jongejan, F. On molecular taxonomy: What is in a name? Exp. Appl. Acarol. 2004, 32, 301–312. [Google Scholar] [CrossRef] [PubMed]
- Hicks, C.A.E.; Barker, E.N.; Brady, C.; Stokes, C.R.; Helps, C.R.; Tasker, S. Non-ribosomal phylogenetic exploration of Mollicute species: New insights into haemoplasma taxonomy. Infect. Genet. Evol. 2014, 23, 99–105. [Google Scholar] [CrossRef]
- Millán, J.; Di Cataldo, S.; Volokhov, D.V.; Becker, D.J. Worldwide occurrence of haemoplasmas in wildlife: Insights into the patterns of infection, transmission, pathology and zoonotic potential. Transbound. Emerg. Dis. 2021, 68, 3236–3256. [Google Scholar] [CrossRef] [PubMed]
- Conrado, F.D.O.; Do Nascimento, N.C.; Dos Santos, A.P.; Zimpel, C.K.; Messick, J.B.; Biondo, A.W. Occurrence and identification of hemotropic mycoplasmas (Hemoplasmas) in free ranging and laboratory rats (Rattus norvegicus) from two Brazilian zoos. BMC Vet. Res. 2015, 11, 286. [Google Scholar] [CrossRef] [PubMed]
- Volokhov, D.V.; Hwang, J.; Chizhikov, V.E.; Danaceau, H.; Gottdenker, N.L. Prevalence, genotype richness, and coinfection patterns of hemotropic mycoplasmas in raccoons (Procyon lotor) on environmentally protected and urbanized barrier islands. Appl. Environ. Microbiol. 2017, 83, e00211-17. [Google Scholar] [CrossRef] [PubMed]
- Novacco, M.; Wolf-Jäckel, G.; Riond, B.; Hofmann-Lehmann, R. Humoral immune response to a recombinant hemoplasma antigen in experimental ‘Candidatus Mycoplasma turicensis’ infection. Vet. Microbiol. 2012, 157, 464–470. [Google Scholar] [CrossRef]
- Cohen, C.; Shemesh, M.; Garrido, M.; Messika, I.; Einav, M.; Khokhlova, I.; Tasker, S.; Hawlena, H. Haemoplasmas in wild rodents: Routes of transmission and infection dynamics. Mol. Ecol. 2018, 27, 3714–3726. [Google Scholar] [CrossRef]
- Tasker, S.; Helps, C.R.; Day, M.J.; Harbour, D.A.; Shaw, S.E.; Harrus, S.; Baneth, G.; Lobetti, R.G.; Malik, R.; Beaufils, J.P.; et al. Phylogenetic analysis of hemoplasma species: An international study. J. Clin. Microbiol. 2004, 41, 3877–3880. [Google Scholar] [CrossRef] [PubMed]
- Vieira, R.F.D.C.; Vidotto, O.; Vieira, T.S.W.J.; Guimaraes, A.M.S.; Dos Santos, A.P.; Nascimento, N.C.; Dos Santos, N.J.R.; Martins, T.F.; Labruna, M.B.; Marcondes, M.; et al. Molecular investigation of hemotropic mycoplasmas in human beings, dogs and horses in a rural settlement in southern Brazil. Rev. Inst. Med. Trop. Sao Paulo 2015, 57, 353–357. [Google Scholar] [CrossRef] [PubMed]
- Vergara, R.W.; Morera Galleguillos, F.; Jaramillo, M.G.; Regina, N.; Almosny, P.; Arauna Martínez, P.; Grob Behne, P.; Acosta-Jamett, G.; Müller, A. Prevalence, risk factor analysis, and hematological findings of hemoplasma infection in domestic cats from Valdivia, Southern Chile. Comp. Immunol. Microbiol. Infect. Dis. 2016, 46, 20–26. [Google Scholar] [CrossRef]
- Di Cataldo, S.; Kamani, J.; Cevidanes, A.; Msheliza, E.G.; Millán, J. Hemotropic mycoplasmas in bats captured near human settlements in Nigeria. Comp. Immunol. Microbiol. Infect. Dis. 2020, 70, 101448. [Google Scholar] [CrossRef] [PubMed]
- Gonçalves, L.R.; Herrera, H.M.; Nantes, W.A.G.; Santos, F.M.; Porfírio, G.E.D.O.; Barreto, W.T.G.; de Macedo, G.C.; Assis, W.D.O.; Campos, J.B.V.; da Silva, T.M.V.; et al. Genetic diversity and lack of molecular evidence for hemoplasma cross-species transmission between wild and synanthropic mammals from Central-Western Brazil. Acta Trop. 2020, 203, 105303. [Google Scholar] [CrossRef] [PubMed]
- Willi, B.; Tasker, S.; Boretti, F.S.; Doherr, M.G.; Cattori, V.; Meli, M.L.; Lobetti, R.G.; Malik, R.; Reusch, C.E.; Lutz, H.; et al. Phylogenetic analysis of ‘Candidatus Mycoplasma turicensis’ isolates from pet cats in the United Kingdom, Australia, and South Africa, with analysis of risk factors for infection. J. Clin. Microbiol. 2006, 44, 4430–4435. [Google Scholar] [CrossRef]
- Sykes, J.E.; Ball, L.M.; Bailiff, N.L.; Fry, M.M. ‘Candidatus Mycoplasma haematoparvum’, a novel small haemotropic Mycoplasma from a dog. Int. J. Syst. Evol. Microbiol. 2005, 55, 27–30. [Google Scholar] [CrossRef]
- Yuan, C.L.; Liang, A.B.; Yao, C.B.; Yang, Z.B.; Zhu, J.G.; Cui, L.; Yu, F.; Zhu, N.Y.; Yang, X.W.; Hua, X.G. Prevalence of Mycoplasma suis (Eperythrozoon suis) infection in and swine-farm workers in Shanghai, China. Am. J. Vet. Res. 2009, 70, 890–894. [Google Scholar] [CrossRef] [PubMed]
- Ybañez, A.P.; Ybañez, R.H.D.; Armonia, R.K.M.; Chico, J.K.E.; Ferraren, K.J.V.; Tapdasan, E.P.; Salces, C.B.; Maurillo, B.C.A.; Galon, E.M.S.; Macalanda, A.M.C.; et al. First molecular detection of Mycoplasma wenyonii and the ectoparasite biodiversity in dairy water buffalo and cattle in Bohol, Philippines. Parasitol. Int. 2019, 70, 77–81. [Google Scholar] [CrossRef] [PubMed]
- Sashida, H.; Sasaoka, F.; Suzuki, J.; Watanabe, Y.; Fujihara, M.; Nagai, K.; Kobayashi, S.; Furuhama, K.; Harasawa, R. Detection of hemotropic mycoplasmas in free-living brown sewer rats (Rattus norvegicus). J. Vet. Med. Sci. 2013, 75, 979–983. [Google Scholar] [CrossRef] [PubMed]
- Gonçalves, L.R.; Roque, A.L.R.; Matos, C.A.; Fernandes, S.D.J.; Olmos, I.D.F.; Machado, R.Z.; André, M.R. Diversity and molecular characterization of novel hemoplasmas infecting wild rodents from different Brazilian biomes. Comp. Immunol. Microbiol. Infect. Dis. 2015, 43, 50–56. [Google Scholar] [CrossRef] [PubMed]
- Hornok, S.; Földvári, G.; Rigó, K.; Meli, M.L.; Gönczi, E.; Répási, A.; Farkas, R.; Papp, I.; Kontschán, J.; Hofmann-Lehmann, R. Synanthropic rodents and their ectoparasites as carriers of a novel haemoplasma and vector-borne, zoonotic pathogens indoors. Parasites Vectors 2015, 8, 27. [Google Scholar] [CrossRef]
- de Sousa, K.C.M.; Herrera, H.M.; Secato, C.T.; Oliveira, A.D.V.; Santos, F.M.; Rocha, F.L.; Barreto, W.T.G.; Macedo, G.C.; Pinto, P.C.E.D.A.; Machado, R.Z.; et al. Occurrence and molecular characterization of hemoplasmas in domestic dogs and wild mammals in a Brazilian wetland. Acta Trop. 2017, 171, 172–181. [Google Scholar] [CrossRef] [PubMed]
- Alabí, A.S.; Monti, G.; Otth, C.; Sepulveda-García, P.; Sánchez-Hidalgo, M.; De Mello, V.V.C.; Machado, R.Z.; André, M.R.; Bittencourt, P.; Müller, A. Molecular survey and genetic diversity of hemoplasmas in rodents from Chile. Microorganisms 2020, 8, 1493. [Google Scholar] [CrossRef] [PubMed]
- Sacristán, I.; Acuña, F.; Aguilar, E.; García, S.; López, M.J.; Cevidanes, A.; Cabello, J. Assessing cross-species transmission of hemoplasmas at the wild-domestic felid interface in Chile using genetic and landscape variables analysis. Sci. Rep. 2019, 9, 16816. [Google Scholar] [CrossRef] [PubMed]
- Cabello, J.; Altet, L.; Napolitano, C.; Sastre, N.; Hidalgo, E.; Dávila, J.A.; Millán, J. Survey of infectious agents in the endangered Darwin’s fox (Lycalopex fulvipes): High prevalence and diversity of hemotrophic mycoplasmas. Vet. Microbiol. 2013, 167, 448–454. [Google Scholar] [CrossRef] [PubMed]
- Volokhov, D.V.; Becker, D.J.; Bergner, L.M.; Camus, M.S.; Orton, R.J.; Chizhikov, V.E.; Altizer, S.M.; Streicker, D.G. Novel hemotropic mycoplasmas are widespread and genetically diverse in vampire bats. Epidemiol. Infect. 2017, 145, 3154–3167. [Google Scholar] [CrossRef] [PubMed]
- Steer, J.A.; Tasker, S.; Barker, E.N.; Jensen, J.; Mitchell, J.; Stocki, T.; Chalker, V.J.; Hamon, M. A novel hemotropic Mycoplasma (hemoplasma) in a patient with hemolytic anemia and pyrexia. Clin. Infect. Dis. 2011, 53, e147–e151. [Google Scholar] [CrossRef] [PubMed]
- Maggi, R.G.; Mascarelli, P.E.; Havenga, L.N.; Naidoo, V.; Breitschwerdt, E.B. Co-infection with Anaplasma platys, Bartonella henselae and “Candidatus Mycoplasma haematoparvum” in a veterinarian. Parasites Vectors 2013, 6, 103. [Google Scholar] [CrossRef]
- Sykes, J.E. Feline hemotropic mycoplasmas. J. Vet. Emerg. Crit. Care 2010, 20, 62–69. [Google Scholar] [CrossRef]
- Maggi, R.G.; Compton, S.M.; Trull, C.L.; Mascarelli, P.E.; Robert Mozayeni, B.; Breitschwerdt, E.B. Infection with hemotropic Mycoplasma species in patients with or without extensive arthropod or animal contact. J. Clin. Microbiol. 2013, 51, 3237–3241. [Google Scholar] [CrossRef]
- Alcorn, K.; Gerrard, J.; Cochrane, T.; Graham, R.; Jennison, A.; Irwin, P.J.; Barbosa, A.D. First report of “Candidatus Mycoplasma haemohominis” infection in Australia causing persistent fever in an animal carer. Clin. Infect. Dis. 2021, 72, 634–640. [Google Scholar] [CrossRef]
- Yang, D.; Xiuzheng, T.A.I.; Ying, Q.I.U.; Sheng, Y.U.N. Prevalence of Eperythrozoon spp. infection and congenital eperythrozoonosis in humans in Inner Mongolia, China. Epidemiol. Infect. 2000, 125, 421–426. [Google Scholar] [CrossRef]
- Hattori, N.; Kuroda, M.; Katano, H.; Takuma, T.; Ito, T.; Arai, N.; Yanai, R.; Sekizuka, T.; Ishii, S.; Miura, Y.; et al. “Candidatus Mycoplasma haemohominis” in human, Japan. Emerg. Infect. Dis. 2020, 26, 11–19. [Google Scholar] [CrossRef]
- Alkan, M.L. Hemoplasma haemohominis, a new human pathogen. Clin. Infect. Dis. 2020, 72, 641–646. [Google Scholar] [CrossRef]
- Sykes, J.E.; Lindsay, L.L.; Maggi, R.G.; Breitschwerdt, E.B. Human coinfection with Bartonella henselae and two hemotropic mycoplasma variants resembling Mycoplasma ovis. J. Clin. Microbiol. 2010, 48, 3782–3785. [Google Scholar] [CrossRef]
- Willi, B.; Meli, M.L.; Luthy, R.; Honegger, H.; Wengi, N.; Hoelzle, L.E.; Reusch, C.E.; Lutz, H.; Hofmann-Lehmann, R. Development and application of a universal haemoplasma screening assay based on the SYBR green PCR principle. J. Clin. Microbiol. 2009, 47, 4049–4054. [Google Scholar] [CrossRef]
- Julius, R.S.; Brettschneider, H.; Chimimba, C.T.; Bastos, A.D.S. Zoonotic Disease: Prevalence and Diversity of the Streptobacillus Rat-bite Fever Agent, in Three Invasive, Commensal Rattus Species from South Africa. Yale J. Biol. Med. 2021, 94, 217. [Google Scholar]
- Retief, L.; Bennett, N.C.; Bastos, A.D.S. Molecular detection and characterization of novel haemotropic Mycoplasma in free-living mole rats from South Africa. Infect. Genet. Evol. 2021, 89, 104739. [Google Scholar] [CrossRef]
- Berry, K.M.; Rodriguez, C.A.; Berhanu, R.H.; Ismail, N.; Mvusi, L.; Long, L.; Evans, D. Treatment outcomes among children, adolescents, and adults on treatment for tuberculosis in two metropolitan municipalities in Gauteng Province, South Africa. BMC Public Health 2019, 19, 973. [Google Scholar] [CrossRef]
- Motlhale, M.; Ncayiyana, J.R. Migration status and prevalence of diabetes and hypertension in Gauteng province, South Africa: Effect modification by demographic and socioeconomic characteristics—A cross-sectional population-based study. BMJ Open 2019, 9, e027427. [Google Scholar] [CrossRef]
- Ringani, G.V.; Julius, R.S.; Chimimba, C.T.; Pirk CW, W.; Zengeya, T.A. Predicting the potential distribution of a previously undetected cryptic invasive synanthropic Asian house rat (Rattus tanezumi) in South Africa. J. Urban Ecol. 2022, 8, juac005. [Google Scholar] [CrossRef]
- Brettschneider, H.; Anguelov, R.; Chimimba, C.T.; Bastos, A.D.S. A mathematical epidemiological model of gram-negative Bartonella bacteria: Does differential ectoparasite load fully explain the differences in infection prevalence of Rattus rattus and Rattus norvegicus? J. Biol. Dyn. 2012, 6, 763–781. [Google Scholar] [CrossRef]
- Lithole, A. Transmission Dynamics of Bartonella in Invasive Rattus from South Africa. Master’s Thesis, University of Pretoria, Pretoria, South Africa, 2015. [Google Scholar]
- Novacco, M.; Boretti, F.S.; Wolf-Jackel, G.A.; Riond, B.; Meli, M.L.; Willi, B.; Lutz, H.; Hofmann-Lehmann, R. Chronic ‘‘Candidatus Mycoplasma turicensis’’ infection. Vet. Res. 2011, 42, 59. [Google Scholar] [CrossRef]
- Novacco, M.; Riond, B.; Meli, M.L.; Grest, P.; Hofman-lehmann, R. Tissue sequestration of ‘Candidatus Mycoplasma turicensis’. Vet. Microbiol. 2013, 167, 403–409. [Google Scholar] [CrossRef]
- Chimimba, C.T.; Dippenaar, N.J. Non-geographic variation in Aethomys chrysopilus (De Winton, 1987) and A. namaquensis (A Smith 1834) (Rodentia: Muridae) from southern Africa. S. Afr. J. Zool. 1994, 29, 107–117. [Google Scholar] [CrossRef]
- Ringani, G.V.; Zengeya, T.A.; Pirk CW, W.; Chimimba, C.T. Assessment of craniometric sexual dimorphism and ontogenetic variation in invasive Rattus norvegicus and R. rattus from urban and peri-urban areas of Gauteng Province, South Africa. Mammalia 2022. [Google Scholar] [CrossRef]
- Ewing, H.E. The Fleas of North America: Classification, Identification and Geographic Distribution of These Injurious and Disease Spreading Insects; Bureau of Entomology and Plant Quarantine, United States Department of Agriculture Miscellaneous Publication: Washington, DC, USA, 1943; pp. 101–104. [Google Scholar] [CrossRef]
- Traub, R. Siphonaptera from Central America and Mexico: A Morphological Study of the Aedeagus with Descriptions of new Genera and Species; Chicago Natural History Museum, Zoology Memoirs: Chicago, IL, USA, 1950; Volume 1, p. 109. [Google Scholar]
- De Meillon, B.; Davis, D.H.S.; Hardy, F. Plague in Southern Africa: The Siphonaptera (excluding Ischnopsyllidae); Government Printer: Pretoria, South Africa, 1968; Volume 1, pp. 82–103. [Google Scholar]
- Segerman, J. Siphonaptera of Southern Africa: Handbook for the Identification of Fleas; Issue 57 of Publications of the South African Institute for Medical Research; South African Institute for Medical Research: Johannesburg, South Africa, 1995. [Google Scholar]
- Hoogstraal, H. Notes on African Haemaphysalis ticks. IV. Description of Egyptian populations of the yellow dog-tick, H. leachii leachii (Audouin, 1827) (Ixodoidea, Ixodidae). J. Parasitol. 1958, 44, 548–558. [Google Scholar] [CrossRef]
- Hoogstraal, H. Notes on African Haemaphysalis ticks. VI. H. spinulosa Neumann, and its relation to biological and nomenclatorial problems in the H. leachii group of Africa and Asia (Ixodoidea, Ixodidae). J. Parasitol. 1964, 50, 786–791. [Google Scholar] [CrossRef]
- Hoogstraal, H.; Kanmah, K.M. Notes on African Haemaphysalis tick X.H. (Kaiseriana) Aciculifer Warburton and H. (K) Rugosa santos dias, the African Representatives of the Spinigera subgroup (Ixodoidea, Ixodidae). J. Parasitol. 1972, 58, 960–978. [Google Scholar] [CrossRef]
- Pegram, R.G.; Hoogstraal, H.; Wassef, H. Ticks (Acari: Ixodoidea) of Ethiopia. I. Distribution, ecology and host relationships of species infesting livestock. Bull. Entomol. Res. 1981, 71, 339–359. [Google Scholar] [CrossRef]
- Camicas, J.-L.; Hervey, J.-P.; Adam, F.; Morel, P.-C. The Ticks of the World; Editions de l’Orstom: Paris, France, 1998. [Google Scholar]
- Apanaskevich, D.A.; Horak, I.G.; Camicas, J.L. Redescription of Haemaphysalis (Rhipistoma) elliptica (Koch, 1844), an old taxon of the Haemaphysalis [Rhipistoma leachi group from East and southern Africa, and of Haemaphysalis (Rhipistoma) leachi (Audouin, 1826) (Ixodida, Ixodidae). Onderstepoort J. Vet. Res. 2007, 74, 181–208. [Google Scholar] [CrossRef]
- Pratt, H.D. Mites of Public Health Importance and Their Control; Training Guide-Insect Control Series; U.S Department of Health, Education, and Welfare, Public Health Services; Communicable Disease Centre: Atlanta, GA, USA, 1963. [Google Scholar]
- Strandtmann, R.W.; Mitchel, C.J. The Laelaptine mites of the Echino Laelaps complex from the Southwest Pacific area (Acarina: Mesostigmata). Pac. Insects 1963, 5, 541–576. [Google Scholar]
- Bakker, A.S. Mites and Ticks of Domestic Animals: Identification Guide and Information Source; Stationery Office: London, UK, 1999. [Google Scholar]
- Edwards, U.; Rogall, T.; Blöcker, H.; Emde, M.; Böttger, E.C. Isolation and direct complete nucleotide determination of entire genes. Characterization of a gene coding for 16S ribosomal RNA. Nucleic Acids Res. 1989, 17, 7843–7853. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Nei, M.; Kumar, S. Molecular Evolution and Phylogenetics; Oxford University Press: New York, NY, USA, 2000. [Google Scholar]
- Guindon, S.; Gascuel, O. Simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 2003, 52, 696–704. [Google Scholar] [CrossRef]
- Huelsenbeck, J.P.; Ronquist, F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 2001, 17, 754–755. [Google Scholar] [CrossRef]
- Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef]
- Rambaut, A.; Suchard, M.A.; Xie, W.; Drummond, A.J. Tracer v1.6.0 MCMC Trace Analysis Tool. 2014. Available online: http://beast.bio.ed.ac.uk/Tracer (accessed on 10 October 2021).
- RStudio Team. RStudio: Integrated Development for R; RStudio, PBC: Boston, MA, USA, 2020; Available online: URLwww.rstudio.com (accessed on 9 August 2022).
- Willi, B.; Boretti, F.S.; Meli, M.L.; Bernasconi, M.V.; Casati, S.; Hegglin, D.; Puorger, M.; Neimark, H.; Cattori, V.; Wengi, N.; et al. Real-time PCR investigation of potential vectors, reservoirs, and shedding patterns of feline hemotropic mycoplasmas. Appl. Environ. Microbiol. 2007, 73, 3798–3802. [Google Scholar] [CrossRef]
- Harasawa, R.; Fujita, H.; Kadosaka, T.; Ando, S.; Rikihisa, Y. Proposal for ‘Candidatus Mycoplasma haemomuris subsp. musculi’ in mice, and ‘Candidatus Mycoplasma haemomuris subsp. ratti’ in rats. Int. J. Syst. Evol. Microbiol. 2015, 65, 734–737. [Google Scholar] [CrossRef]
- Penzhorn, B.L.; Harrison-White, R.F.; Stoltsz, W.H. Completing the cycle: Haemaphysalis elliptica, the vector of Babesia rossi, is the most prevalent tick infesting black-backed jackals (Canis mesomelas), an indigenous reservoir host of B. rossi in South Africa. Ticks Tick-Borne Dis. 2020, 11, 101325. [Google Scholar] [CrossRef]
- Millán, J.; Travaini, A.; Cevidanes, A.; Sacristán, I.; Rodríguez, A. Assessing the natural circulation of canine vector-borne pathogens in foxes, ticks and fleas in protected areas of Argentine Patagonia with negligible dog participation. Parasites Wildl. 2019, 8, 63–70. [Google Scholar] [CrossRef]
- Sepúlveda-García, P.; Raffo, E.; Medina-Vogel, G.; Muñoz, F.; Muñoz, P.; Alabí, A.; Navarrete-Talloni, M.J.; Gonçalves, L.R.; Califre De Mello, V.V.; Machado, R.Z.; et al. Molecular survey of Bartonella spp. and haemoplasmas in American minks (Neovison vison). Transbound. Emerg. Dis. 2021, 68, 2094–2110. [Google Scholar] [CrossRef] [PubMed]
- Tennant, K.V.; Barker, E.N.; Polizopoulou, Z.; Helps, C.R.; Tasker, S. Real-time quantitative polymerase chain reaction detection of haemoplasmas in healthy and unhealthy dogs from Central Macedonia, Greece. J. Small Anim. Pract. 2011, 52, 645–649. [Google Scholar] [CrossRef] [PubMed]
- Avery, D.M. Hitching a ride: How Black rats (Rattus rattus) could have reached southern Africa. Iziko Mus. South Afr. Cape Town South Afr. 2021, preprint. [Google Scholar] [CrossRef]
- Bastos, A.D.; Nair, D.; Taylor, P.J.; Brettschneider, H.; Kirsten, F.; Mostert, E.; Von Maltitz, E.; Lamb, J.M.; Van Hooft, P.; Belmain, S.R.; et al. Genetic monitoring detects an overlooked cryptic species and reveals the diversity and distribution of three invasive Rattus congeners in south Africa. BMC Genetics 2011, 12, 26. [Google Scholar] [CrossRef]
- Guo, H.L.; Teng, H.J.; Zhang, J.H.; Zhang, J.X.; Zhang, Y.H. Asian house rats may facilitate their invasive success through suppressing brown rats in chronic interaction. Front. Zool. 2017, 14, 20. [Google Scholar] [CrossRef] [PubMed]
- Wu, D.L.; Shih, H.C.; Wang, J.K.; Teng, H.J.; Kuo, C.C. Commensal Rodent Habitat Expansion Enhances Arthropod Disease Vectors on a Tropical Volcanic Island. Front. Vet. Sci. 2021, 8, 736216. [Google Scholar] [CrossRef]
- Moseley, M.; Naidoo, K.; Bastos, A.; Retief, L.; Frean, J.; Telfer, S.; Rossouw, J. Multi-locus sequence analyses reveal a clonal L. borgpetersenii genotype in a heterogeneous invasive Rattus spp. community across the City of Johannesburg, South Africa. Parasites Vectors 2020, 13, 570. [Google Scholar] [CrossRef]
- Julius, R.S.; Bastos, A.D.; Brettschneider, H.; Chimimba, C.T. Dynamics of Rodent-Borne Zoonotic Diseases and Their Reservoir Hosts: Invasive Rattus in South Africa. In Proceedings of the 25th Vertebrate Pest Conference, Monteray, CA, USA, 5–8 March 2012. [Google Scholar] [CrossRef]
Sampling Locality | Rattus rattus | Rattus norvegicus | Rattus tanezumi | Total Animals |
---|---|---|---|---|
Hammanskraal | 0 | 0 | 12 | 12 |
Hatfield | 33 | 0 | 1 | 34 |
Tembisa | 0 | 32 | 0 | 32 |
Villeria | 0 | 0 | 1 | 1 |
Centurion | 0 | 0 | 1 | 1 |
Mountain View | 0 | 0 | 6 | 6 |
Diepsloot | 0 | 3 | 0 | 3 |
Garsfontein | 1 | 0 | 1 | 2 |
Menlyn | 2 | 0 | 0 | 2 |
Boschkop | 0 | 0 | 5 | 5 |
Rietfontein | 0 | 0 | 1 | 1 |
Total | 36 | 35 | 28 | 99 |
Primer Set Used (from 5′ to 3′) and Orientation (F:Forwards/R:Reverse) | Reference | Gene Region Targeted | Expected Ampilcon Size (bp) | Ta Used in This Study |
---|---|---|---|---|
Myco16S-322s: GCC CAT ATT CCT ACG GGA AGC AGC AGT (F) | [32] | 16S rRNA | ~1000 | 68 °C |
HemMycop16S-1420as: GTT TGA CGG GCG GTG TGT ACA AGA CC (R) | [32] | |||
MyChlo-1F: TGC CAG CAG CTG CGG TAA TAC (F) | [40] | 16S rRNA | ~300 | 69 °C |
Mycop-1R: CGT TTA CGG TGT GGA CTA CTG (R) | [40] | |||
27F: AGA GTT TGA TCC TGG CTC AG (F) | [63] | 16S rRNA | ~700 | 61 °C |
Mycop-1R: CGT TTA CGG TGT GGA CTA CTG (R) | [40] | |||
RNasePFor1: CTGC GATGGTCGTAATGTTG (F) | [12] | RnaseP | ~180 | 46 °C |
RNasePRev1: GAG GAG TTT ACC GCG TTT CA (R) | [12] | |||
RNasePFor2: TAT TTA AAG TAG AGG AAA GTC (F) | [12] | RnaseP | ~210 | 49 °C |
RNasePRev1: GAG GAG TTT ACC GCG TTT CA (R) | [12] | |||
F34: GACCTAGGTACAACTAACTCYTGTG (F) | [6] | dnaK | ~1055 | 56 °C; 50 °C |
R1139: CCACCTAGTGTTTCAATACTTAGAGTT (R) | [6] | |||
F34: GACCTAGGTACAACTAACTCYTGTG (F) | [6] | dnaK | ~1288 | 56 °C; 50 °C |
R1367: CCGTTAGCGTCAATAGAGAAGG (R) | [6] | |||
F34: GACCTAGGTACAACTAACTCYTGTG (F) | [6] | dnaK | ~1720 | 55 °C; 50 °C |
R1802: TTAGTTTTATCTACCTCAGTCTTATCCT (R) | [6] | |||
F350: GTTATTACTGTTCCAGCATACTTTAA (F) | [6] | dnaK | ~739 | 53 °C; 50 °C |
R1139: CCACCTAGTGTTTCAATACTTAGAGTT (R) | [6] | |||
F350: GTTATTACTGTTCCAGCATACTTTAA (F) | [6] | dnaK | ~972 | 53 °C; 50 °C |
R1367: CCGTTAGCGTCAATAGAGAAGG (R) | [6] | |||
F350: GTTATTACTGTTCCAGCATACTTTAA (F) | [6] | dnaK | ~1404 | 53 °C; 50 °C |
R1802: TTAGTTTTATCTACCTCAGTCTTATCCT (R) | [6] | |||
GAPA-F22: GGATTCGGAAGAATCGGAAG (F) | [6] | gapA | ~953 | 52 °C; 50 °C |
GAPA-R975: AACAAGCTGATTCACATAAGAAGA (R) | [6] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Retief, L.; Chimimba, C.T.; Oosthuizen, M.C.; Matshotshi, A.; Bastos, A.D.S. Haemoplasma Prevalence and Diversity in Three Invasive Rattus Species from Gauteng Province, South Africa. Microorganisms 2022, 10, 1632. https://doi.org/10.3390/microorganisms10081632
Retief L, Chimimba CT, Oosthuizen MC, Matshotshi A, Bastos ADS. Haemoplasma Prevalence and Diversity in Three Invasive Rattus Species from Gauteng Province, South Africa. Microorganisms. 2022; 10(8):1632. https://doi.org/10.3390/microorganisms10081632
Chicago/Turabian StyleRetief, Liezl, Christian T. Chimimba, Marinda C. Oosthuizen, Asiashu Matshotshi, and Armanda D. S. Bastos. 2022. "Haemoplasma Prevalence and Diversity in Three Invasive Rattus Species from Gauteng Province, South Africa" Microorganisms 10, no. 8: 1632. https://doi.org/10.3390/microorganisms10081632
APA StyleRetief, L., Chimimba, C. T., Oosthuizen, M. C., Matshotshi, A., & Bastos, A. D. S. (2022). Haemoplasma Prevalence and Diversity in Three Invasive Rattus Species from Gauteng Province, South Africa. Microorganisms, 10(8), 1632. https://doi.org/10.3390/microorganisms10081632