Sodium Citrate Alleviates Virulence in Pseudomonas aeruginosa
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals and Bacterial Strains
2.2. Determination of Sodium Citrate Effect on Bacterial Growth
2.3. Evaluation of Antibiofilm Activities of Sodium Citrate
2.4. Assessment of Sodium Citrate Effect on P. aeruginosa Motility
2.5. Determination of Sodium Citrate Effect on Pyocyanin Production
2.6. Evaluation of Inhibitory Effect on Protease Activity
2.7. Assessment of Sodium Citrate Effect on QS-Encoding Genes
2.8. In Silico Assessment of Sodium Citrate Ability to Bind P. aeruginosa QS Receptors
2.9. Statistical Analysis
3. Results
3.1. Sodium Citrate at Concentrations of 4% or 5% Does Not Affect P. aeruginosa Growth
3.2. Sodium Citrate Inhibits P. aeruginosa Biofilm Formation
3.3. Sodium citrate Diminishes P. aeruginosa Motility
3.4. Sodium Citrate Decreases the P. aeruginosa Pigment Pyocyanin
3.5. Sodium Citrate Decreases the Production of Protease
3.6. Sodium Citrate Anti-QS Activities
3.6.1. Sodium Citrate Downregulates the P. aeruginosa QS Genes
3.6.2. Sodium Citrate Interferes with the Binding of Autoinducers to P. aeruginosa QS Receptors
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Antonic, V.; Stojadinovic, A.; Zhang, B.; Izadjoo, M.J.; Alavi, M. Pseudomonas aeruginosa induces pigment production and enhances virulence in a white phenotypic variant of Staphylococcus aureus. Infect. Drug Resist. 2013, 6, 175–186. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gellatly, S.L.; Hancock, R.E. Pseudomonas aeruginosa: New insights into pathogenesis and host defenses. Pathog. Dis. 2013, 67, 159–173. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hentzer, M.; Wu, H.; Andersen, J.B.; Riedel, K.; Rasmussen, T.B.; Bagge, N.; Kumar, N.; Schembri, M.A.; Song, Z.; Kristoffersen, P.; et al. Attenuation of Pseudomonas aeruginosa virulence by quorum sensing inhibitors. EMBO J. 2003, 22, 3803–3815. [Google Scholar] [CrossRef] [PubMed]
- Moradali, M.F.; Ghods, S.; Rehm, B.H. Pseudomonas aeruginosa Lifestyle: A Paradigm for Adaptation, Survival, and Persistence. Front. Cell Infect. Microbiol. 2017, 7, 39. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Francis, V.I.; Stevenson, E.C.; Porter, S.L. Two-component systems required for virulence in Pseudomonas aeruginosa. FEMS Microbiol. Lett. 2017, 364, fnx104. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Contreras, R. Is Quorum Sensing Interference a Viable Alternative to Treat Pseudomonas aeruginosa Infections? Front. Microbiol. 2016, 7, 1454. [Google Scholar] [CrossRef] [Green Version]
- Aldawsari, M.F.; Khafagy, E.S.; Saqr, A.A.; Alalaiwe, A.; Abbas, H.A.; Shaldam, M.A.; Hegazy, W.A.H.; Goda, R.M. Tackling Virulence of Pseudomonas aeruginosa by the Natural Furanone Sotolon. Antibiotics 2021, 10, 871. [Google Scholar] [CrossRef]
- Filloux, A. Protein Secretion Systems in Pseudomonas aeruginosa: An Essay on Diversity, Evolution, and Function. Front. Microbiol. 2011, 2, 155. [Google Scholar] [CrossRef] [Green Version]
- Winzer, K.; Williams, P. Quorum sensing and the regulation of virulence gene expression in pathogenic bacteria. Int. J. Med. Microbiol. 2001, 291, 131–143. [Google Scholar] [CrossRef]
- Almalki, A.J.; Ibrahim, T.S.; Elhady, S.S.; Hegazy, W.A.H.; Darwish, K.M. Computational and Biological Evaluation of β-Adrenoreceptor Blockers as Promising Bacterial Anti-Virulence Agents. Pharmaceuticals 2022, 15, 110. [Google Scholar] [CrossRef]
- Withers, H.; Swift, S.; Williams, P. Quorum sensing as an integral component of gene regulatory networks in Gram-negative bacteria. Curr. Opin. Microbiol. 2001, 4, 186–193. [Google Scholar] [CrossRef]
- Dong, Y.H.; Wang, L.H.; Xu, J.L.; Zhang, H.B.; Zhang, X.F.; Zhang, L.H. Quenching quorum-sensing-dependent bacterial infection by an N-acyl homoserine lactonase. Nature 2001, 411, 813–817. [Google Scholar] [CrossRef] [PubMed]
- Khayyat, A.N.; Abbas, H.A.; Khayat, M.T.; Shaldam, M.A.; Askoura, M.; Asfour, H.Z.; Khafagy, E.-S.; Abu Lila, A.S.; Allam, A.N.; Hegazy, W.A.H. Secnidazole Is a Promising Imidazole Mitigator of Serratia marcescens Virulence. Microorganisms 2021, 9, 2333. [Google Scholar] [CrossRef] [PubMed]
- Morata, L.; Cobos-Trigueros, N.; Martinez, J.A.; Soriano, A.; Almela, M.; Marco, F.; Sterzik, H.; Nunez, R.; Hernandez, C.; Mensa, J. Influence of multidrug resistance and appropriate empirical therapy on the 30-day mortality rate of Pseudomonas aeruginosa bacteremia. Antimicrob. Agents Chemother. 2012, 56, 4833–4837. [Google Scholar] [CrossRef] [Green Version]
- Horcajada, J.P.; Montero, M.; Oliver, A.; Sorli, L.; Luque, S.; Gomez-Zorrilla, S.; Benito, N.; Grau, S. Epidemiology and Treatment of Multidrug-Resistant and Extensively Drug-Resistant Pseudomonas aeruginosa Infections. Clin. Microbiol. Rev. 2019, 32, e00031-19. [Google Scholar] [CrossRef]
- Fernebro, J. Fighting bacterial infections-future treatment options. Drug Resist. Updates Rev. Comment. Antimicrob. Anticancer. Chemother. 2011, 14, 125–139. [Google Scholar] [CrossRef]
- Saqr, A.A.; Aldawsari, M.F.; Khafagy, E.-S.; Shaldam, M.A.; Hegazy, W.A.H.; Abbas, H.A. A Novel Use of Allopurinol as A Quorum-Sensing Inhibitor in Pseudomonas aeruginosa. Antibiotics 2021, 10, 1385. [Google Scholar] [CrossRef]
- Cegelski, L.; Marshall, G.R.; Eldridge, G.R.; Hultgren, S.J. The biology and future prospects of antivirulence therapies. Nat. Rev. Microbiol. 2008, 6, 17–27. [Google Scholar] [CrossRef]
- Rasko, D.A.; Sperandio, V. Anti-virulence strategies to combat bacteria-mediated disease. Nat. Rev. Drug Discov. 2010, 9, 117–128. [Google Scholar] [CrossRef]
- Khayyat, A.N.; Abbas, H.A.; Mohamed, M.F.A.; Asfour, H.Z.; Khayat, M.T.; Ibrahim, T.S.; Youns, M.; Khafagy, E.-S.; Abu Lila, A.S.; Safo, M.K.; et al. Not Only Antimicrobial: Metronidazole Mitigates the Virulence of Proteus mirabilis Isolated from Macerated Diabetic Foot Ulcer. Appl. Sci. 2021, 11, 6847. [Google Scholar] [CrossRef]
- Choo, J.H.; Rukayadi, Y.; Hwang, J.K. Inhibition of bacterial quorum sensing by vanilla extract. Lett. Appl. Microbiol. 2006, 42, 637–641. [Google Scholar] [CrossRef] [PubMed]
- Abbas, H.A.; Hegazy, W.A.H. Targeting the virulence factors of Serratia marcescens by ambroxol. Roum. Arch. Microbiol. Immunol. 2017, 76, 27–32. [Google Scholar]
- Hegazy, W.A.H.; Rajab, A.A.H.; Abu Lila, A.S.; Abbas, H.A. Anti-diabetics and antimicrobials: Harmony of mutual interplay. World J. Diabetes 2021, 12, 1832–1855. [Google Scholar] [CrossRef] [PubMed]
- Hentzer, M.; Riedel, K.; Rasmussen, T.B.; Heydorn, A.; Andersen, J.B.; Parsek, M.R.; Rice, S.A.; Eberl, L.; Molin, S.; Hoiby, N.; et al. Inhibition of quorum sensing in Pseudomonas aeruginosa biofilm bacteria by a halogenated furanone compound. Microbiology 2002, 148, 87–102. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Khayyat, A.N.; Hegazy, W.A.H.; Shaldam, M.A.; Mosbah, R.; Almalki, A.J.; Ibrahim, T.S.; Khayat, M.T.; Khafagy, E.S.; Soliman, W.E.; Abbas, H.A. Xylitol Inhibits Growth and Blocks Virulence in Serratia marcescens. Microorganisms 2021, 9, 1083. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.S.; Lee, S.H.; Byun, Y.; Park, H.D. 6-Gingerol reduces Pseudomonas aeruginosa biofilm formation and virulence via quorum sensing inhibition. Sci. Rep. 2015, 5, 8656. [Google Scholar] [CrossRef]
- Nagaoka, S.; Murata, S.; Kimura, K.; Mori, T.; Hojo, K. Antimicrobial activity of sodium citrate against Streptococcus pneumoniae and several oral bacteria. Lett. Appl. Microbiol. 2010, 51, 546–551. [Google Scholar] [CrossRef]
- Urwin, C.S.; Snow, R.J.; Condo, D.; Snipe, R.; Wadley, G.D.; Carr, A.J. Factors Influencing Blood Alkalosis and Other Physiological Responses, Gastrointestinal Symptoms, and Exercise Performance Following Sodium Citrate Supplementation: A Review. Int. J. Sport Nutr. Exerc. Metab. 2021, 31, 168–186. [Google Scholar] [CrossRef]
- Chu, L.; Zhou, X.; Shen, Y.; Yu, Y. Inhibitory effect of trisodium citrate on biofilms formed by Klebsiella pneumoniae. J. Glob. Antimicrob Resist. 2020, 22, 452–456. [Google Scholar] [CrossRef]
- Takla, T.A.; Zelenitsky, S.A.; Vercaigne, L.M. Effectiveness of a 30% ethanol/4% trisodium citrate locking solution in preventing biofilm formation by organisms causing haemodialysis catheter-related infections. J. Antimicrob. Chemother. 2008, 62, 1024–1026. [Google Scholar] [CrossRef] [Green Version]
- Balestrino, D.; Souweine, B.; Charbonnel, N.; Lautrette, A.; Aumeran, C.; Traore, O.; Forestier, C. Eradication of microorganisms embedded in biofilm by an ethanol-based catheter lock solution. Nephrol. Dial. Transplant. 2009, 24, 3204–3209. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reitzel, R.A.; Rosenblatt, J.; Hirsh-Ginsberg, C.; Murray, K.; Chaftari, A.M.; Hachem, R.; Raad, I. In Vitro Assessment of the Antimicrobial Efficacy of Optimized Nitroglycerin-Citrate-Ethanol as a Nonantibiotic, Antimicrobial Catheter Lock Solution for Prevention of Central Line-Associated Bloodstream Infections. Antimicrob. Agents Chemother. 2016, 60, 5175–5181. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rosenblatt, J.; Reitzel, R.; Dvorak, T.; Jiang, Y.; Hachem, R.Y.; Raad, I.I. Glyceryl trinitrate complements citrate and ethanol in a novel antimicrobial catheter lock solution to eradicate biofilm organisms. Antimicrob. Agents Chemother. 2013, 57, 3555–3560. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nalca, Y.; Jansch, L.; Bredenbruch, F.; Geffers, R.; Buer, J.; Haussler, S. Quorum-sensing antagonistic activities of azithromycin in Pseudomonas aeruginosa PAO1: A global approach. Antimicrob. Agents Chemother. 2006, 50, 1680–1688. [Google Scholar] [CrossRef] [Green Version]
- Stepanovic, S.; Vukovic, D.; Dakic, I.; Savic, B.; Svabic-Vlahovic, M. A modified microtiter-plate test for quantification of staphylococcal biofilm formation. J. Microbiol. Methods 2000, 40, 175–179. [Google Scholar] [CrossRef]
- Rashid, M.H.; Kornberg, A. Inorganic polyphosphate is needed for swimming, swarming, and twitching motilities of Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 2000, 97, 4885–4890. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Das, T.; Manefield, M. Pyocyanin promotes extracellular DNA release in Pseudomonas aeruginosa. PLoS ONE 2012, 7, e46718. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Almalki, A.J.; Ibrahim, T.S.; Taher, E.S.; Mohamed, M.F.A.; Youns, M.; Hegazy, W.A.H.; Al-Mahmoudy, A.M.M. Synthesis, Antimicrobial, Anti-Virulence and Anticancer Evaluation of New 5(4H)-Oxazolone-Based Sulfonamides. Molecules 2022, 27, 671. [Google Scholar] [CrossRef]
- Vijayaraghavan, P.; Vincent, S.G.P. A simple method for the detection of protease activity on agar plate using bromocresolgreen dye. J. Biochem. Technol. 2013, 4, 628–630. [Google Scholar]
- Youns, M.; Askoura, M.; Abbas, H.A.; Attia, G.H.; Khayyat, A.N.; Goda, R.M.; Almalki, A.J.; Khafagy, E.S.; Hegazy, W.A.H. Celastrol Modulates Multiple Signaling Pathways to Inhibit Proliferation of Pancreatic Cancer via DDIT3 and ATF3 Up-Regulation and RRM2 and MCM4 Down-Regulation. Onco Targets Ther. 2021, 14, 3849–3860. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Bottomley, M.J.; Muraglia, E.; Bazzo, R.; Carfì, A. Molecular Insights into Quorum Sensing in the Human Pathogen Pseudomonas aeruginosa from the Structure of the Virulence Regulator LasR Bound to Its Autoinducer. J. Biol. Chem. 2007, 282, 13592–13600. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pubchem. Citrate 3d struture. Available online: https://pubchem.ncbi.nlm.nih.gov/compound/31348 (accessed on 11 April 2022).
- Sanner, M.F. Python: A programming language for software integration and development. J. Mol. Graph. Model. 1999, 17, 57–61. [Google Scholar] [PubMed]
- Trott, O.; Olson, A.J. AutoDock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J. Comput. Chem. 2010, 31, 455–461. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- BIOVIA. Dassault Systèmes, [Discovery Studio client], [21.1.0.20298]; Dassault Systèmes: San Diego, CA, USA, 2021. [Google Scholar]
- Hall, S.; McDermott, C.; Anoopkumar-Dukie, S.; McFarland, A.J.; Forbes, A.; Perkins, A.V.; Davey, A.K.; Chess-Williams, R.; Kiefel, M.J.; Arora, D.; et al. Cellular Effects of Pyocyanin, a Secreted Virulence Factor of Pseudomonas aeruginosa. Toxins 2016, 8, 236. [Google Scholar] [CrossRef]
- Venturi, V. Regulation of quorum sensing in Pseudomonas. FEMS Microbiol. Rev. 2006, 30, 274–291. [Google Scholar] [CrossRef] [Green Version]
- O’Loughlin, C.T.; Miller, L.C.; Siryaporn, A.; Drescher, K.; Semmelhack, M.F.; Bassler, B.L. A quorum-sensing inhibitor blocks Pseudomonas aeruginosa virulence and biofilm formation. Proc. Natl. Acad. Sci. USA 2013, 110, 17981–17986. [Google Scholar] [CrossRef] [Green Version]
- Lister, P.D.; Wolter, D.J.; Hanson, N.D. Antibacterial-resistant Pseudomonas aeruginosa: Clinical impact and complex regulation of chromosomally encoded resistance mechanisms. Clin. Microbiol. Rev. 2009, 22, 582–610. [Google Scholar] [CrossRef] [Green Version]
- Lyczak, J.B.; Cannon, C.L.; Pier, G.B. Establishment of Pseudomonas aeruginosa infection: Lessons from a versatile opportunist. Microbes Infect. 2000, 2, 1051–1060. [Google Scholar] [CrossRef]
- Skindersoe, M.E.; Alhede, M.; Phipps, R.; Yang, L.; Jensen, P.O.; Rasmussen, T.B.; Bjarnsholt, T.; Tolker-Nielsen, T.; Hoiby, N.; Givskov, M. Effects of antibiotics on quorum sensing in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 2008, 52, 3648–3663. [Google Scholar] [CrossRef] [Green Version]
- Brackman, G.; Cos, P.; Maes, L.; Nelis, H.J.; Coenye, T. Quorum sensing inhibitors increase the susceptibility of bacterial biofilms to antibiotics in vitro and in vivo. Antimicrob. Agents Chemother. 2011, 55, 2655–2661. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hoiby, N.; Bjarnsholt, T.; Givskov, M.; Molin, S.; Ciofu, O. Antibiotic resistance of bacterial biofilms. Int. J. Antimicrob. Agents 2010, 35, 322–332. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wolska, K.I.; Grudniak, A.M.; Rudnicka, Z.; Markowska, K. Genetic control of bacterial biofilms. J. Appl. Genet. 2016, 57, 225–238. [Google Scholar] [CrossRef] [Green Version]
- Jakobsen, T.H.; Bjarnsholt, T.; Jensen, P.O.; Givskov, M.; Hoiby, N. Targeting quorum sensing in Pseudomonas aeruginosa biofilms: Current and emerging inhibitors. Future Microbiol. 2013, 8, 901–921. [Google Scholar] [CrossRef] [PubMed]
- Voynow, J.A.; Fischer, B.M.; Zheng, S. Proteases and cystic fibrosis. Int. J. Biochem. Cell Biol. 2008, 40, 1238–1245. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mavrodi, D.V.; Bonsall, R.F.; Delaney, S.M.; Soule, M.J.; Phillips, G.; Thomashow, L.S. Functional analysis of genes for biosynthesis of pyocyanin and phenazine-1-carboxamide from Pseudomonas aeruginosa PAO1. J. Bacteriol. 2001, 183, 6454–6465. [Google Scholar] [CrossRef] [Green Version]
- Hegazy, W.A.H.; Khayat, M.T.; Ibrahim, T.S.; Youns, M.; Mosbah, R.; Soliman, W.E. Repurposing of antidiabetics as Serratia marcescens virulence inhibitors. Braz. J. Microbiol. 2021, 52, 627–638. [Google Scholar] [CrossRef]
- Juhas, M.; Eberl, L.; Tummler, B. Quorum sensing: The power of cooperation in the world of Pseudomonas. Environ. Microbiol. 2005, 7, 459–471. [Google Scholar] [CrossRef]
- Rutherford, S.T.; Bassler, B.L. Bacterial quorum sensing: Its role in virulence and possibilities for its control. Cold Spring Harb. Perspect. Med. 2012, 2, a012427. [Google Scholar] [CrossRef]
- Jiang, T.; Li, M. Quorum sensing inhibitors: A patent review. Expert Opin. Ther. Pat. 2013, 23, 867–894. [Google Scholar] [CrossRef]
- Ramanathan, S.; Ravindran, D.; Arunachalam, K.; Arumugam, V.R. Inhibition of quorum sensing-dependent biofilm and virulence genes expression in environmental pathogen Serratia marcescens by petroselinic acid. Antonie Van Leeuwenhoek 2018, 111, 501–515. [Google Scholar] [CrossRef] [PubMed]
- Rasmussen, T.B.; Givskov, M. Quorum-sensing inhibitors as anti-pathogenic drugs. Int. J. Med. Microbiol. 2006, 296, 149–161. [Google Scholar] [CrossRef] [PubMed]
Target Gene | Sequence (5′–3′) |
---|---|
lasI | For: CTACAGCCTGCAGAACGACA Rev: ATCTGGGTCTTGGCATTGAG |
lasR | For: ACGCTCAAGTGGAAAATTGG Rev: GTAGATGGACGGTTCCCAGA |
rhlI | For: CTCTCTGAATCGCTGGAAGG Rev: GACGTCCTTGAGCAGGTAGG |
rhlR | For: AGGAATGACGGAGGCTTTTT Rev: CCCGTAGTTCTGCATCTGGT |
pqsA | For: TTCTGTTCCGCCTCGATTTC Rev: AGTCGTTCAACGCCAGCAC |
pqsR | For: AACCTGGAAATCGACCTGTG Rev: TGAAATCGTCGAGCAGTACG |
rpoD | For: GGGCGAAGAAGGAAATGGTC Rev: CAGGTGGCGTAGGTGGAGAAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khayat, M.T.; Ibrahim, T.S.; Khayyat, A.N.; Alharbi, M.; Shaldam, M.A.; Mohammad, K.A.; Khafagy, E.-S.; El-damasy, D.A.; Hegazy, W.A.H.; Abbas, H.A. Sodium Citrate Alleviates Virulence in Pseudomonas aeruginosa. Microorganisms 2022, 10, 1046. https://doi.org/10.3390/microorganisms10051046
Khayat MT, Ibrahim TS, Khayyat AN, Alharbi M, Shaldam MA, Mohammad KA, Khafagy E-S, El-damasy DA, Hegazy WAH, Abbas HA. Sodium Citrate Alleviates Virulence in Pseudomonas aeruginosa. Microorganisms. 2022; 10(5):1046. https://doi.org/10.3390/microorganisms10051046
Chicago/Turabian StyleKhayat, Maan T., Tarek S. Ibrahim, Ahdab N. Khayyat, Majed Alharbi, Moataz A. Shaldam, Khadijah A. Mohammad, El-Sayed Khafagy, Dalia A. El-damasy, Wael A. H. Hegazy, and Hisham A. Abbas. 2022. "Sodium Citrate Alleviates Virulence in Pseudomonas aeruginosa" Microorganisms 10, no. 5: 1046. https://doi.org/10.3390/microorganisms10051046