Genome-Wide Association Study Reveals Host Factors Affecting Conjugation in Escherichia coli
Abstract
1. Introduction
2. Materials and Methods
2.1. Strains, Plasmids and Growth Conditions
2.2. Quantifying Conjugation Efficiency
2.2.1. Flow Cytometry
2.2.2. Serial Dilutions and Plating
2.3. Associating Conjugation Efficiency with Genetic Variants
2.4. Validating the Identified Genes by Single-Gene Knockout Strains
2.5. Competition Experiment
3. Results
3.1. Quantifying the Donor Abilities of Diverse E. coli Strains by Flow Cytometry
3.2. Associating Conjugation Efficiency with Genetic Variants
3.3. Validating Genes with Knockout Mutants
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Antimicrobial Resistance Collaborators. Global burden of bacterial antimicrobial resistance in 2019: A systematic analysis. Lancet 2022, 399, 629–655. [Google Scholar] [CrossRef] [Scilit]
- European Centre for Disease Prevention and Control. Antimicrobial Resistance in the EU/EEA (EARS-Net)—Annual Epidemiological Report 2019; ECDC: Stockholm, Sweden, 2020; pp. 1–28. [Google Scholar]
- Kaper, J.B.; Nataro, J.P.; Mobley, H.L.T. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2004, 2, 123–140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- World Health Organization. 2020 Antibacterial Agents in Clinical and Preclinical Development: An Overview and Analysis; WHO: Geneva, Switzerland, 2021; pp. 1–59. [Google Scholar]
- Bennett, P.M. Plasmid encoded antibiotic resistance: Acquisition and transfer of antibiotic resistance genes in bacteria. Br. J. Pharmacol. 2008, 153, S347–S357. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, Y.; Wang, Y.; Hua, X.; Qu, Y.; Peleg, A.Y.; Yu, Y. Pooled plasmid sequencing reveals the relationship between mobile genetic elements and antimicrobial resistance genes in clinically isolated Klebsiella pneumoniae. Genom. Proteom. Bioinform. 2020, 18, 539–548. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ingram, L.C.; Richmond, M.H.; Sykes, R.B. Molecular characterization of the R factors implicated in the carbenicillin resistance of a sequence of Pseudomonas aeruginosa strains isolated from burns. Antimicrob. Agents Chemother. 1973, 3, 279–288. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Su, L.H.; Chiu, C.H.; Chu, C.; Wang, M.H.; Chia, J.H.; Wu, T.L. In vivo acquisition of ceftriaxone resistance in Salmonella enterica serotype Anatum. Antimicrob. Agents Chemother. 2003, 47, 563–567. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jia, C.C.; Hong, W.Z.; Zhang, R.; Chen, G.X. Emergence of Serratia marcescens, Klebsiella pneumoniae, and Escherichia coli isolates possessing the plasmid-mediated carbapenem-hydrolyzing β-lactamase KPC-2 in intensive care units of a chinese hospital. Antimicrob. Agents Chemother. 2008, 52, 2014–2018. [Google Scholar] [CrossRef] [Scilit]
- Sidjabat, H.E.; Silveira, F.P.; Potoski, B.A.; Abu-Elmagd, K.M.; Adams-Haduch, J.M.; Paterson, D.L.; Doi, Y. Interspecies spread of Klebsiella pneumoniae carbapenemase gene in a single patient. Clin. Infect. Dis. 2009, 49, 1736–1738. [Google Scholar] [CrossRef] [Scilit]
- Tofteland, S.; Naseer, U.; Lislevand, J.H.; Sundsfjord, A.; Samuelsen, Ø. A long-term low-frequency hospital outbreak of KPC-producing Klebsiella pneumoniae involving intergenus plasmid diffusion and a persisting environmental reservoir. PLoS ONE 2013, 8, e59015. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prussing, C.; Snavely, E.A.; Singh, N.; Lapierre, P.; Lasek-Nesselquist, E.; Mitchell, K.; Haas, W.; Owsiak, R.; Nazarian, E.; Musser, K.A. Nanopore MinION sequencing reveals possible transfer of blaKPC–2 plasmid across bacterial species in two healthcare facilities. Front. Microbiol. 2020, 11, 2007. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Graf, F.E.; Palm, M.; Warringer, J.; Farewell, A. Inhibiting conjugation as a tool in the fight against antibiotic resistance. Drug Dev. Res. 2019, 80, 19–23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Waksman, G. From conjugation to T4S systems in Gram-negative bacteria: A mechanistic biology perspective. EMBO Rep. 2019, 20, e47012. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ilangovan, A.; Connery, S.; Waksman, G. Structural biology of the Gram-negative bacterial conjugation systems. Trends Microbiol. 2015, 23, 301–310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cabezón, E.; Ripoll-Rozada, J.; Peña, A.; de la Cruz, F.; Arechaga, I. Towards an integrated model of bacterial conjugation. FEMS Microbiol. Rev. 2014, 39, 81–95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cabezón, E.; de la Cruz, F.; Arechaga, I. Conjugation inhibitors and their potential use to prevent dissemination of antibiotic resistance genes in bacteria. Front. Microbiol. 2017, 8, 2329. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- García-Cazorla, Y.; Getino, M.; Sanabria-Ríos, D.J.; Carballeira, N.M.; De La Cruz, F.; Arechaga, I.; Cabezón, E. Conjugation inhibitors compete with palmitic acid for binding to the conjugative traffic ATPase TrwD, providing a mechanism to inhibit bacterial conjugation. J. Biol. Chem. 2019, 293, 16923–16930. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, A.; Jimenez, J.; Derr, J.; Vera, P.; Manapat, M.L.; Esvelt, K.M.; Villanueva, L.; Liu, D.R.; Chen, I.A. Inhibition of bacterial conjugation by phage M13 and its protein g3p: Quantitative analysis and model. PLoS ONE 2011, 6, e19991. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garcillán-Barcia, M.P.; Jurado, P.; González-Pérez, B.; Moncalián, G.; Fernández, L.A.; de la Cruz, F. Conjugative transfer can be inhibited by blocking relaxase activity within recipient cells with intrabodies. Mol. Microbiol. 2007, 63, 404–416. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pérez-Mendoza, D.; de la Cruz, F. Escherichia coli genes affecting recipient ability in plasmid conjugation: Are there any? BMC Genom. 2009, 10, 71. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Johnson, C.M.; Grossman, A.D. Identification of host genes that affect acquisition of an integrative and conjugative element in Bacillus subtilis. Mol. Microbiol. 2014, 93, 1284–1301. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Johnson, C.M.; Grossman, A.D. The composition of the cell envelope affects conjugation in Bacillus subtilis. J. Bacteriol. 2016, 198, 1241–1249. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alalam, H.; Graf, F.E.; Palm, M.; Abadikhah, M.; Zackrisson, M.; Boström, J.; Fransson, A.; Hadjineophytou, C.; Persson, L.; Stenberg, S.; et al. A high-throughput method for screening for genes controlling bacterial conjugation of antibiotic resistance. mSystems 2020, 5, e01226-20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Frost, L.S.; Koraimann, G. Regulation of bacterial conjugation: Balancing opportunity with adversity. Future Microbiol. 2010, 5, 1057–1071. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gubbins, M.J.; Lau, I.; Will, W.R.; Manchak, J.M.; Raivio, T.L.; Frost, L.S. The positive regulator, TraJ, of the Escherichia coli F plasmid is unstable in a cpxA* background. J. Bacteriol. 2002, 184, 5781–5788. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Silverman, P.M.; Wickersham, E.; Harris, R. Regulation of the F plasmid tra Y promoter in Escherichia coli by host and plasmid factors. J. Mol. Biol. 1991, 218, 119–128. [Google Scholar] [CrossRef] [Scilit]
- Baba, T.; Ara, T.; Hasegawa, M.; Takai, Y.; Okumura, Y.; Baba, M.; Datsenko, K.A.; Tomita, M.; Wanner, B.L.; Mori, H. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: The Keio collection. Mol. Syst. Biol. 2006, 2, 2006.0008. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Souza, V.; Rocha, M.; Valera, A.; Eguiarte, L.E. Genetic structure of natural populations of Escherichia coli in wild hosts on different continents. Appl. Environ. Microbiol. 1999, 65, 3373–3385. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ochman, H.; Selander, R.K. Standard reference strains of Escherichia coli from natural populations. J. Bacteriol. 1984, 157, 690–693. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Skjøt-Rasmussen, L.; Hammerum, A.M.; Jakobsen, L.; Lester, C.H.; Larsen, P.; Frimodt-Møller, N. Persisting clones of Escherichia coli isolates from recurrent urinary tract infection in men and women. J. Med. Microbiol. 2011, 60, 550–554. [Google Scholar] [CrossRef] [Scilit]
- Datsenko, K.A.; Wanner, B.L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 2000, 97, 6640–6645. [Google Scholar] [CrossRef] [Scilit]
- Thoma, S.; Schobert, M. An improved Escherichia coli donor strain for diparental mating. FEMS Microbiol. Lett. 2009, 294, 127–132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de la Cruz-Perera, C.I.; Ren, D.; Blanchet, M.; Dendooven, L.; Marsch, R.; Sørensen, S.J.; Burmølle, M. The ability of soil bacteria to receive the conjugative IncP1 plasmid, pKJK10, is different in a mixed community compared to single strains. FEMS Microbiol. Lett. 2013, 338, 95–100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bahl, M.I.; Hansen, L.H.; Goesmann, A.; Sørensen, S.J. The multiple antibiotic resistance IncP-1 plasmid pKJK5 isolated from a soil environment is phylogenetically divergent from members of the previously established α, β and δ sub-groups. Plasmid 2007, 58, 31–43. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sørensen, S.J.; Sørensen, A.H.; Hansen, L.H.; Oregaard, G.; Veal, D. Direct detection and quantification of horizontal gene transfer by using flow cytometry and gfp as a reporter gene. Curr. Microbiol. 2003, 47, 129–133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sengeløv, G.; Kristensen, K.J.; Sørensen, A.H.; Kroer, N.; Sørensen, S.J. Effect of genomic location on horizontal transfer of a recombinant gene cassette between Pseudomonas strains in the rhizosphere and spermosphere of barley seedlings. Curr. Microbiol. 2001, 42, 160–167. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Benkwitz-Bedford, S.; Palm, M.; Demirtas, T.Y.; Mustonen, V.; Farewell, A.; Warringer, J.; Parts, L.; Moradigaravand, D. Machine Learning Prediction of Resistance to Subinhibitory Antimicrobial Concentrations from Escherichia coli Genomes. mSystems 2021, 6, e00346-21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seemann, T. Prokka: Rapid prokaryotic genome annotation. Bioinformatics 2014, 30, 2068–2069. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D.; et al. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Larsen, M.V.; Cosentino, S.; Rasmussen, S.; Friis, C.; Hasman, H.; Marvig, R.L.; Jelsbak, L.; Sicheritz-Pontén, T.; Ussery, D.W.; Aarestrup, F.M.; et al. Multilocus sequence typing of total-genome-sequenced bacteria. J. Clin. Microbiol. 2012, 50, 1355–1361. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Joensen, K.G.; Tetzschner, A.M.M.; Iguchi, A.; Aarestrup, F.M.; Scheutz, F. Rapid and easy in silico serotyping of Escherichia coli isolates by use of whole-genome sequencing data. J. Clin. Microbiol. 2015, 53, 2410–2426. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beghain, J.; Bridier-Nahmias, A.; Le Nagard, H.; Denamur, E.; Clermont, O. ClermonTyping: An easy-to-use and accurate in silico method for Escherichia genus strain phylotyping. Microb. Genom. 2018, 4, e000192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seemann, T. Snippy: Fast Bacterial Variant Calling from NGS Reads. Available online: https://github.com/tseemann/snippy (accessed on 16 December 2021).
- Page, A.J.; Cummins, C.A.; Hunt, M.; Wong, V.K.; Reuter, S.; Holden, M.T.G.; Fookes, M.; Falush, D.; Keane, J.A.; Parkhill, J. Roary: Rapid large-scale prokaryote pan genome analysis. Bioinformatics 2015, 31, 3691–3693. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Holley, G.; Melsted, P. Bifrost: Highly parallel construction and indexing of colored and compacted de Bruijn graphs. Genome Biol. 2020, 21, 249. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Välimäki, N.; Lees, J. Frequency-Based String Mining (Lite). Available online: https://github.com/nvalimak/fsm-lite (accessed on 31 December 2021).
- Lees, J.; Galardini, M.; Bentley, S.; Weiser, J.; Corander, J. pyseer: A comprehensive tool for microbial pangenome-wide association studies. Bioinformatics 2018, 34, 4310–4312. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Earle, S.G.; Wu, C.H.; Charlesworth, J.; Stoesser, N.; Gordon, N.C.; Walker, T.M.; Spencer, C.C.A.; Iqbal, Z.; Clifton, D.A.; Hopkins, K.L.; et al. Identifying lineage effects when controlling for population structure improves power in bacterial association studies. Nat. Microbiol. 2016, 1, 16041. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chaguza, C.; Yang, M.; Cornick, J.E.; du Plessis, M.; Gladstone, R.A.; Kwambana-Adams, B.A.; Lo, S.W.; Ebruke, C.; Tonkin-Hill, G.; Peno, C.; et al. Bacterial genome-wide association study of hyper-virulent pneumococcal serotype 1 identifies genetic variation associated with neurotropism. Commun. Biol. 2020, 3, 559. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Klümper, U.; Riber, L.; Dechesne, A.; Sannazzarro, A.; Hansen, L.H.; Sørensen, S.J.; Smets, B.F. Broad host range plasmids can invade an unexpectedly diverse fraction of a soil bacterial community. ISME J. 2015, 9, 934–945. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- del Campo, I.; Ruiz, R.; Cuevas, A.; Revilla, C.; Vielva, L.; De la Cruz, F. Determination of conjugation rates on solid surfaces. Plasmid 2012, 67, 174–182. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seoane, J.; Yankelevich, T.; Dechesne, A.; Merkey, B.; Sternberg, C.; Smets, B.F. An individual-based approach to explain plasmid invasion in bacterial populations. FEMS Microbiol. Ecol. 2011, 75, 17–27. [Google Scholar] [CrossRef] [Scilit]
- Dimitriu, T.; Marchant, L.; Buckling, A.; Raymond, B. Bacteria from natural populations transfer plasmids mostly towards their kin. Proc. R. Soc. B Biol. Sci. 2019, 286, 20191110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Power, R.A.; Parkhill, J.; de Oliveira, T. Microbial genome-wide association studies: Lessons from human GWAS. Nat. Rev. Genet. 2017, 18, 41–50. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jaillard, M.; Lima, L.; Tournoud, M.; Mahé, P.; van Belkum, A.; Lacroix, V.; Jacob, L. A fast and agnostic method for bacterial genome-wide association studies: Bridging the gap between k-mers and genetic events. PLoS Genet. 2018, 14, e1007758. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lippert, C.; Listgarten, J.; Liu, Y.; Kadie, C.M.; Davidson, R.I.; Heckerman, D. FaST linear mixed models for genome-wide association studies. Nat. Methods 2011, 8, 833–835. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lees, J.A.; Vehkala, M.; Välimäki, N.; Harris, S.R.; Chewapreecha, C.; Croucher, N.J.; Marttinen, P.; Davies, M.R.; Steer, A.C.; Tong, S.Y.C.; et al. Sequence element enrichment analysis to determine the genetic basis of bacterial phenotypes. Nat. Commun. 2016, 7, 12797. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mateus, A.; Shah, M.; Hevler, J.; Kurzawa, N.; Bobonis, J.; Typas, A.; Savitski, M.M. Transcriptional and post-transcriptional polar effects in bacterial gene deletion libraries. mSystems 2021, 6, e00813-21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Farhat, M.R.; Shapiro, B.J.; Kieser, K.J.; Sultana, R.; Jacobson, K.R.; Victor, T.C.; Warren, R.M.; Streicher, E.M.; Calver, A.; Sloutsky, A.; et al. Genomic analysis identifies targets of convergent positive selection in drug-resistant Mycobacterium tuberculosis. Nat. Genet. 2013, 45, 1183–1189. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Salipante, S.J.; Roach, D.J.; Kitzman, J.O.; Snyder, M.W.; Stackhouse, B.; Butler-Wu, S.M.; Lee, C.; Cookson, B.T.; Shendure, J. Large-scale genomic sequencing of extraintestinal pathogenic Escherichia coli strains. Genome Res. 2015, 25, 119–128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chewapreecha, C.; Marttinen, P.; Croucher, N.J.; Salter, S.J.; Harris, S.R.; Mather, A.E.; Hanage, W.P.; Goldblatt, D.; Nosten, F.H.; Turner, C.; et al. Comprehensive identification of single nucleotide polymorphisms associated with beta-lactam resistance within pneumococcal mosaic genes. PLoS Genet. 2014, 10, e1004547. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alam, M.T.; Petit, R.A.; Crispell, E.K.; Thornton, T.A.; Conneely, K.N.; Jiang, Y.; Satola, S.W.; Read, T.D. Dissecting vancomycin-intermediate resistance in Staphylococcus aureus using genome-wide association. Genome Biol. Evol. 2014, 6, 1174–1185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mobegi, F.M.; Cremers, A.J.H.; De Jonge, M.I.; Bentley, S.D.; Van Hijum, S.A.F.T.; Zomer, A. Deciphering the distance to antibiotic resistance for the pneumococcus using genome sequencing data. Sci. Rep. 2017, 7, 42808. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Farhat, M.R.; Freschi, L.; Calderon, R.; Ioerger, T.; Snyder, M.; Meehan, C.J.; de Jong, B.; Rigouts, L.; Sloutsky, A.; Kaur, D.; et al. GWAS for quantitative resistance phenotypes in Mycobacterium tuberculosis reveals resistance genes and regulatory regions. Nat. Commun. 2019, 10, 2128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Laabei, M.; Recker, M.; Rudkin, J.K.; Aldeljawi, M.; Gulay, Z.; Sloan, T.J.; Williams, P.; Endres, J.L.; Bayles, K.W.; Fey, P.D.; et al. Predicting the virulence of MRSA from its genome sequence. Genome Res. 2014, 24, 839–849. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Holt, K.E.; Wertheim, H.; Zadoks, R.N.; Baker, S.; Whitehouse, C.A.; Dance, D.; Jenney, A.; Connor, T.R.; Hsu, L.Y.; Severin, J.; et al. Genomic analysis of diversity, population structure, virulence, and antimicrobial resistance in Klebsiella pneumoniae, an urgent threat to public health. Proc. Natl. Acad. Sci. USA 2015, 112, E3574–E3581. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Berthenet, E.; Yahara, K.; Thorell, K.; Pascoe, B.; Meric, G.; Mikhail, J.M.; Engstrand, L.; Enroth, H.; Burette, A.; Megraud, F.; et al. A GWAS on Helicobacter pylori strains points to genetic variants associated with gastric cancer risk. BMC Biol. 2018, 16, 84. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sheppard, S.K.; Didelot, X.; Meric, G.; Torralbo, A.; Jolley, K.A.; Kelly, D.J.; Bentley, S.D.; Maiden, M.C.J.; Parkhill, J.; Falush, D. Genome-wide association study identifies vitamin B5 biosynthesis as a host specificity factor in Campylobacter. Proc. Natl. Acad. Sci. USA 2013, 110, 11923–11927. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Hemert, S.; Meijerink, M.; Molenaar, D.; Bron, P.A.; De Vos, P.; Kleerebezem, M.; Wells, J.M.; Marco, M.L. Identification of Lactobacillus plantarum genes modulating the cytokine response of human peripheral blood mononuclear cells. BMC Microbiol. 2010, 10, 293. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chaston, J.M.; Newell, P.D.; Douglas, A.E. Metagenome-wide association of microbial determinants of host phenotype in Drosophila melanogaster. mBio 2014, 5, e01631-14. [Google Scholar] [CrossRef] [Scilit]
- Nakamura, S.; Minamino, T. Flagella-driven motility of bacteria. Biomolecules 2019, 9, 279. [Google Scholar] [CrossRef] [Scilit]
- Grünenfelder, B.; Gehrig, S.; Jena, U. Role of the cytoplasmic C terminus of the FliF motor protein in flagellar assembly and rotation. J. Bacteriol. 2003, 185, 1624–1633. [Google Scholar] [CrossRef] [Scilit]
- Zhao, K.; Liu, M.; Burgess, R.R. Adaptation in bacterial flagellar and motility systems: From regulon members to ‘foraging’-like behavior in E. coli. Nucleic Acids Res. 2007, 35, 4441–4452. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kalir, S.; McClure, J.; Pabbaraju, K.; Southward, C.; Ronen, M.; Leibler, S.; Surette, M.G.; Alon, U. Ordering Genes in a Flagella Pathway by Analysis of Expression Kinetics from Living Bacteria. Science 2001, 292, 2080–2083. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Waters, R.C.; O’Toole, P.W.; Ryan, K.A. The FliK protein and flagellar hook-length control. Protein Sci. 2007, 16, 769–780. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhong, X.; Droesch, J.; Fox, R.; Top, E.M.; Krone, S.M. On the meaning and estimation of plasmid transfer rates for surface-associated and well-mixed bacterial populations. J. Theor. Biol. 2012, 294, 144–152. [Google Scholar] [CrossRef] [Scilit]
- Fox, R.E.; Zhong, X.; Krone, S.M.; Top, E.M. Spatial structure and nutrients promote invasion of IncP-1 plasmids in bacterial populations. ISME J. 2008, 2, 1024–1039. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luque, A.; Paytubi, S.; Sánchez-Montejo, J.; Gibert, M.; Balsalobre, C.; Madrid, C. Crosstalk between bacterial conjugation and motility is mediated by plasmid-borne regulators. Environ. Microbiol. Rep. 2019, 11, 708–717. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takahashi, Y.; Shintani, M.; Takase, N.; Kazo, Y.; Kawamura, F.; Hara, H.; Nishida, H.; Okada, K.; Yamane, H.; Nojiri, H. Modulation of primary cell function of host Pseudomonas bacteria by the conjugative plasmid pCAR1. Environ. Microbiol. 2015, 17, 134–155. [Google Scholar] [CrossRef] [Scilit]
- Rösch, T.C.; Golman, W.; Hucklesby, L.; Gonzalez-Pastor, J.E.; Graumann, P.L. The presence of conjugative plasmid pLS20 affects global transcription of its Bacillus subtilis host and confers beneficial stress resistance to cells. Appl. Environ. Microbiol. 2014, 80, 1349–1358. [Google Scholar] [CrossRef] [Scilit]
- Reisner, A.; Wolinski, H.; Zechner, E.L. In situ monitoring of IncF plasmid transfer on semi-solid agar surfaces reveals a limited invasion of plasmids in recipient colonies. Plasmid 2012, 67, 155–161. [Google Scholar] [CrossRef] [Scilit]
- González Barrios, A.F.; Zuo, R.; Ren, D.; Wood, T.K. Hha, YbaJ, and OmpA regulate Escherichia coli K12 biofilm formation and conjugation plasmids abolish motility. Biotechnol. Bioeng. 2006, 93, 188–200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bohlin, T.; Burman, L.G. Influence on motility of Escherichia coli and Salmonella Typhimurium by a naturally occurring conjugative plasmid. J. Bacteriol. 1977, 130, 604–609. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ferguson, G.P.; Nikolaev, Y.; McLaggan, D.; Maclean, M.; Booth, I.R. Survival during exposure to the electrophilic reagent N-ethylmaleimide in Escherichia coli: Role of KefB and KefC potassium channels. J. Bacteriol. 1997, 179, 1007–1012. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ferguson, G. Protective mechanisms against toxic electrophiles in Escherichia coli. Trends Microbiol. 1999, 7, 242–247. [Google Scholar] [CrossRef] [Scilit]
- Ferguson, G.P.; Battista, J.R.; Lee, A.T.; Booth, I.R. Protection of the DNA during the exposure of Escherichia coli cells to a toxic metabolite: The role of the KefB and KefC potassium channels. Mol. Microbiol. 2000, 35, 113–122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reed, J.L.; Vo, T.D.; Schilling, C.H.; Palsson, B.O. An expanded genome-scale model of Escherichia coli K-12 (iJR904 GSM/GPR). Genome Biol. 2003, 4, R54. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liang, K.; Shen, C.R. Selection of an endogenous 2,3-butanediol pathway in Escherichia coli by fermentative redox balance. Metab. Eng. 2017, 39, 181–191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Miller, E.N.; Yomano, L.P.; Shanmugam, K.T.; Ingram, L.O. Increased Furan Tolerance in Escherichia coli Due to a Cryptic ucpA Gene. Appl. Environ. Microbiol. 2012, 78, 2452–2455. [Google Scholar] [CrossRef] [Scilit]
- Booth, I.R.; Ferguson, G.P.; Miller, S.; Li, C.; Gunasekera, B.; Kinghorn, S. Bacterial production of methylglyoxal: A survival strategy or death by misadventure? Biochem. Soc. Trans. 2003, 31, 1406–1408. [Google Scholar] [CrossRef] [Scilit]
- Ferguson, G.P.; Tötemeyer, S.; MacLean, M.J.; Booth, I.R. Methylglyoxal production in bacteria: Suicide or survival? Arch. Microbiol. 1998, 170, 209–218. [Google Scholar] [CrossRef] [Scilit]
- Dörries, K.; Lalk, M. Metabolic footprint analysis uncovers strain specific overflow metabolism and D-isoleucine production of Staphylococcus aureus COL and HG001. PLoS ONE 2013, 8, e81500. [Google Scholar] [CrossRef] [Scilit]
- Berg, J.M.; Tymoczko, J.L.; Stryer, L. Glycolysis is an energy-conversion pathway in many organisms. In Biochemistry, 7th ed.; W.H. Freeman and Company: New York, NY, USA, 2012; pp. 471–488. [Google Scholar]
- Rochelle, P.A.; Fry, J.C.; Day, M.J. Factors affecting conjugal transfer of plasmids encoding mercury resistance from pure cultures and mixed natural suspensions of epilithic bacteria. Microbiology 1989, 135, 409–424. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qiu, Z.; Yu, Y.; Chen, Z.; Jin, M.; Yang, D.; Zhao, Z.; Wang, J.; Shen, Z.; Wang, X.; Qian, D.; et al. Nanoalumina promotes the horizontal transfer of multiresistance genes mediated by plasmids across genera. Proc. Natl. Acad. Sci. USA 2012, 109, 4944–4949. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Richaume, A.; Angle, J.S.; Sadowsky, M.J. Influence of soil variables on in situ plasmid transfer from Escherichia coli to Rhizobium fredii. Appl. Environ. Microbiol. 1989, 55, 1730–1734. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsau, J.-L.; Guffanti, A.A.; Montville, T.J. Conversion of pyruvate to acetoin helps to maintain pH homeostasis in Lactobacillus plantarum. Appl. Environ. Microbiol. 1992, 58, 891–894. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Headd, B.; Bradford, S.A. Physicochemical factors that favor conjugation of an antibiotic resistant plasmid in non-growing bacterial cultures in the absence and presence of antibiotics. Front. Microbiol. 2018, 9, 2122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aviv, G.; Rahav, G.; Gal-Mor, O. Horizontal transfer of the Salmonella enterica serovar Infantis resistance and virulence plasmid pESI to the gut microbiota of warm-blooded hosts. mBio 2016, 7, e01395-16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- García-Quintanilla, M.; Ramos-Morales, F.; Casadesús, J. Conjugal transfer of the Salmonella enterica virulence plasmid in the mouse intestine. J. Bacteriol. 2008, 190, 1922–1927. [Google Scholar] [CrossRef] [Scilit]



| Time | Annotation | Variant Position: SNP | Effect Size β | Allele Frequency | p-Value SNPs | p-Value Unitigs | |
|---|---|---|---|---|---|---|---|
| 24 h | tdh | Threonine dehydrogenase | 3783911: CT | −0.61 | 0.63 | 4.34 × 10−6 | 5.19 × 10−5 |
| 48 h | fliF | Flagellar basal body MS ring and collar protein | 2008002: CT | 0.70 | 0.11 | 5.56 × 10−6 | 2.67 × 10−5 |
| Time | Annotation | Number of Isolates | Effect Size β | Allele Frequency | p-Value COGs | p-Value Unitigs | |
|---|---|---|---|---|---|---|---|
| 24 h | group_9935 (yncL 1) | Hypothetical protein | 13 | 1.00 | 0.12 | 2.37 × 10−5 | 3.08 × 10−2 |
| 48 h | yedN | Putative type III secreted effector | 13 | 0.65 | 0.12 | 3.07 × 10−5 | 3.07 × 10−5 |
| Time | Annotation | Variant | Effect Size β | Allele Frequency | p-Value | |
|---|---|---|---|---|---|---|
| 24 h | gnd | 6-phosphogluconate dehydrogenase | CCAATATAGGTAACGCACGGTTCGCCATCTTCA | 0.64 | 0.12 | 4.65 × 10−7 |
| yhhS | Putative transporter | GACCGCTCAAAAAGCAGCCGCATAAACCGAA | 0.86 | 0.85 | 1.11 × 10−6 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Van Wonterghem, L.; De Chiara, M.; Liti, G.; Warringer, J.; Farewell, A.; Verstraeten, N.; Michiels, J. Genome-Wide Association Study Reveals Host Factors Affecting Conjugation in Escherichia coli. Microorganisms 2022, 10, 608. https://doi.org/10.3390/microorganisms10030608
Van Wonterghem L, De Chiara M, Liti G, Warringer J, Farewell A, Verstraeten N, Michiels J. Genome-Wide Association Study Reveals Host Factors Affecting Conjugation in Escherichia coli. Microorganisms. 2022; 10(3):608. https://doi.org/10.3390/microorganisms10030608
Chicago/Turabian StyleVan Wonterghem, Laetitia, Matteo De Chiara, Gianni Liti, Jonas Warringer, Anne Farewell, Natalie Verstraeten, and Jan Michiels. 2022. "Genome-Wide Association Study Reveals Host Factors Affecting Conjugation in Escherichia coli" Microorganisms 10, no. 3: 608. https://doi.org/10.3390/microorganisms10030608
APA StyleVan Wonterghem, L., De Chiara, M., Liti, G., Warringer, J., Farewell, A., Verstraeten, N., & Michiels, J. (2022). Genome-Wide Association Study Reveals Host Factors Affecting Conjugation in Escherichia coli. Microorganisms, 10(3), 608. https://doi.org/10.3390/microorganisms10030608

