Hiring of the Anti-Quorum Sensing Activities of Hypoglycemic Agent Linagliptin to Alleviate the Pseudomonas aeruginosa Pathogenesis
Abstract
1. Introduction
2. Materials and Methods
2.1. Microbiological Media, Chemicals, and Bacterial Strain
2.2. Detection of MIC of Linagliptin
2.3. Evaluation of the Effect of the Linagliptin on P. aeruginosa Growth
2.4. Determination of the Antibiofilm Activity of Linagliptin
2.5. Evaluation of the Effect of Linagliptin on P. aeruginosa Motility
2.6. Determination of the Effect of Linagliptin on the Protease Production
2.7. Detection of the Effect of Linagliptin on Pyocyanin Production
2.8. Quantification of QS-Encoding Genes
2.9. Histopathological Evaluation
2.10. Molecular Docking Study
2.11. Statistical Analysis
3. Results
3.1. Effect of Linagliptin on the P. aeruginosa Growth
3.2. Antibiofilm Activity of Linagliptin
3.3. Linagliptin Cripples the P. aeruginosa Motility
3.4. Linagliptin Decreases the Production of Protease
3.5. Linagliptin Decreases the Production of Pyocyanin
3.6. Linagliptin Diminishes the P. aeruginosa Pathogenesis
3.7. Linagliptin Anti-Virulence Activity Is Owed to Interfering with QS Systems
3.7.1. Linagliptin Downregulates the Expression of the Encoding Genes of Three P. aeruginosa QS Systems
3.7.2. Multi-Target Docking Analysis of Linagliptin on P. aeruginosa QS Systems
Docking Analysis at LasI-Type AHL Synthase Binding Site
Docking Analysis at QscR-Type Quorum-Sensing Protein Binding Site
Docking Analysis at LasR-Type Quorum-Sensing Protein Binding Site
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Rutherford, S.T.; Bassler, B.L. Bacterial quorum sensing: Its role in virulence and possibilities for its control. Cold Spring Harb. Perspect. Med. 2012, 2, a012427. [Google Scholar] [CrossRef] [PubMed]
- Hegazy, W.A.H.; Khayat, M.T.; Ibrahim, T.S.; Nassar, M.S.; Bakhrebah, M.A.; Abdulaal, W.H.; Alhakamy, N.A.; Bendary, M.M. Repurposing Anti-diabetic Drugs to Cripple Quorum Sensing in Pseudomonas aeruginosa. Microorganisms 2020, 8, 1285. [Google Scholar] [CrossRef] [PubMed]
- Aldawsari, M.F.; Khafagy, E.S.; Saqr, A.A.; Alalaiwe, A.; Abbas, H.A.; Shaldam, M.A.; Hegazy, W.A.H.; Goda, R.M. Tackling Virulence of Pseudomonas aeruginosa by the Natural Furanone Sotolon. Antibiotics 2021, 10, 871. [Google Scholar] [CrossRef] [PubMed]
- Khayat, M.T.; Ibrahim, T.S.; Khayyat, A.N.; Alharbi, M.; Shaldam, M.A.; Mohammad, K.A.; Khafagy, E.-S.; El-damasy, D.A.; Hegazy, W.A.H.; Abbas, H.A. Sodium Citrate Alleviates Virulence in Pseudomonas aeruginosa. Microorganisms 2022, 10, 1046. [Google Scholar] [CrossRef] [PubMed]
- Lim, S.M.; Webb, S.A. Nosocomial bacterial infections in Intensive Care Units. I: Organisms and mechanisms of antibiotic resistance. Anaesthesia 2005, 60, 887–902. [Google Scholar] [CrossRef]
- Saqr, A.A.; Aldawsari, M.F.; Khafagy, E.-S.; Shaldam, M.A.; Hegazy, W.A.H.; Abbas, H.A. A Novel Use of Allopurinol as A Quorum-Sensing Inhibitor in Pseudomonas aeruginosa. Antibiotics 2021, 10, 1385. [Google Scholar] [CrossRef]
- Gellatly, S.L.; Hancock, R.E. Pseudomonas aeruginosa: New insights into pathogenesis and host defenses. Pathog. Dis. 2013, 67, 159–173. [Google Scholar] [CrossRef]
- Moradali, M.F.; Ghods, S.; Rehm, B.H. Pseudomonas aeruginosa Lifestyle: A Paradigm for Adaptation, Survival, and Persistence. Front. Cell. Infect. Microbiol. 2017, 7, 39. [Google Scholar] [CrossRef]
- Lyczak, J.B.; Cannon, C.L.; Pier, G.B. Establishment of Pseudomonas aeruginosa infection: Lessons from a versatile opportunist. Microbes. Infect. 2000, 2, 1051–1060. [Google Scholar] [CrossRef]
- Juhas, M.; Eberl, L.; Tummler, B. Quorum sensing: The power of cooperation in the world of Pseudomonas. Environ. Microbiol. 2005, 7, 459–471. [Google Scholar] [CrossRef]
- Oliver, A.; Mulet, X.; Lopez-Causape, C.; Juan, C. The increasing threat of Pseudomonas aeruginosa high-risk clones. Drug Resist. Update Rev. Comment. Antimicrob. Anticancer Chemother. 2015, 21–22, 41–59. [Google Scholar] [CrossRef] [PubMed]
- Tan, S.Y.; Chua, S.L.; Chen, Y.; Rice, S.A.; Kjelleberg, S.; Nielsen, T.E.; Yang, L.; Givskov, M. Identification of five structurally unrelated quorum-sensing inhibitors of Pseudomonas aeruginosa from a natural-derivative database. Antimicrob. Agents Chemother. 2013, 57, 5629–5641. [Google Scholar] [CrossRef] [PubMed]
- Bottomley, M.J.; Muraglia, E.; Bazzo, R.; Carfi, A. Molecular insights into quorum sensing in the human pathogen Pseudomonas aeruginosa from the structure of the virulence regulator LasR bound to its autoinducer. J. Biol. Chem. 2007, 282, 13592–13600. [Google Scholar] [CrossRef] [PubMed]
- Hentzer, M.; Wu, H.; Andersen, J.B.; Riedel, K.; Rasmussen, T.B.; Bagge, N.; Kumar, N.; Schembri, M.A.; Song, Z.; Kristoffersen, P.; et al. Attenuation of Pseudomonas aeruginosa virulence by quorum sensing inhibitors. EMBO J. 2003, 22, 3803–3815. [Google Scholar] [CrossRef] [PubMed]
- Horcajada, J.P.; Montero, M.; Oliver, A.; Sorli, L.; Luque, S.; Gomez-Zorrilla, S.; Benito, N.; Grau, S. Epidemiology and Treatment of Multidrug-Resistant and Extensively Drug-Resistant Pseudomonas aeruginosa Infections. Clin. Microbiol. Rev. 2019, 32. [Google Scholar] [CrossRef]
- Rossolini, G.M.; Mantengoli, E. Treatment and control of severe infections caused by multiresistant Pseudomonas aeruginosa. Clin. Microbiol. Infect. 2005, 11 (Suppl. S4), 17–32. [Google Scholar] [CrossRef] [PubMed]
- Jakobsen, T.H.; Bjarnsholt, T.; Jensen, P.O.; Givskov, M.; Hoiby, N. Targeting quorum sensing in Pseudomonas aeruginosa biofilms: Current and emerging inhibitors. Future Microbiol. 2013, 8, 901–921. [Google Scholar] [CrossRef]
- Shang, D.; Han, X.; Du, W.; Kou, Z.; Jiang, F. Trp-Containing Antibacterial Peptides Impair Quorum Sensing and Biofilm Development in Multidrug-Resistant Pseudomonas aeruginosa and Exhibit Synergistic Effects with Antibiotics. Front. Microbiol. 2021, 12, 611009. [Google Scholar] [CrossRef]
- Abbas, H.A.; Hegazy, W.A.H. Repurposing anti-diabetic drug “Sitagliptin” as a novel virulence attenuating agent in Serratia marcescens. PLoS ONE 2020, 15, e0231625. [Google Scholar] [CrossRef]
- Hegazy, W.A.H.; Khayat, M.T.; Ibrahim, T.S.; Youns, M.; Mosbah, R.; Soliman, W.E. Repurposing of antidiabetics as Serratia marcescens virulence inhibitors. Braz. J. Microbiol. 2021, 52, 627–638. [Google Scholar] [CrossRef]
- Almalki, A.J.; Ibrahim, T.S.; Elhady, S.S.; Darwish, K.M.; Hegazy, W.A.H. Repurposing α-Adrenoreceptor Blockers as Promising Anti-Virulence Agents in Gram-Negative Bacteria. Antibiotics 2022, 11, 178. [Google Scholar] [CrossRef]
- Almalki, A.J.; Ibrahim, T.S.; Elhady, S.S.; Hegazy, W.A.H.; Darwish, K.M. Computational and Biological Evaluation of β-Adrenoreceptor Blockers as Promising Bacterial Anti-Virulence Agents. Pharmaceuticals 2022, 15, 110. [Google Scholar] [CrossRef] [PubMed]
- Abisado, R.G.; Benomar, S.; Klaus, J.R.; Dandekar, A.A.; Chandler, J.R. Bacterial Quorum Sensing and Microbial Community Interactions. mBio 2018, 9, e02331-17. [Google Scholar] [CrossRef] [PubMed]
- Abbas, H.A.; Hegazy, W.A.H. Targeting the virulence factors of Serratia marcescens by ambroxol. Roum. Arch. Microbiol. Immunol. 2017, 76, 27–32. [Google Scholar]
- Khayyat, A.N.; Hegazy, W.A.H.; Shaldam, M.A.; Mosbah, R.; Almalki, A.J.; Ibrahim, T.S.; Khayat, M.T.; Khafagy, E.S.; Soliman, W.E.; Abbas, H.A. Xylitol Inhibits Growth and Blocks Virulence in Serratia marcescens. Microorganisms 2021, 9, 1083. [Google Scholar] [CrossRef]
- Askoura, M.; Almalki, A.J.; Lila, A.S.A.; Almansour, K.; Alshammari, F.; Khafagy, E.-S.; Ibrahim, T.S.; Hegazy, W.A.H. Alteration of Salmonella enterica Virulence and Host Pathogenesis through Targeting sdiA by Using the CRISPR-Cas9 System. Microorganisms 2021, 9, 2564. [Google Scholar] [CrossRef]
- Blair, J.M.; Webber, M.A.; Baylay, A.J.; Ogbolu, D.O.; Piddock, L.J. Molecular mechanisms of antibiotic resistance. Nat. Rev. Microbiol. 2015, 13, 42–51. [Google Scholar] [CrossRef]
- Hoiby, N.; Bjarnsholt, T.; Givskov, M.; Molin, S.; Ciofu, O. Antibiotic resistance of bacterial biofilms. Int. J. Antimicrob. Agents 2010, 35, 322–332. [Google Scholar] [CrossRef]
- Aldawsari, M.F.; Alalaiwe, A.; Khafagy, E.S.; Al Saqr, A.; Alshahrani, S.M.; Alsulays, B.B.; Alshehri, S.; Abu Lila, A.S.; Danish Rizvi, S.M.; Hegazy, W.A.H. Efficacy of SPG-ODN 1826 Nanovehicles in Inducing M1 Phenotype through TLR-9 Activation in Murine Alveolar J774A.1 Cells: Plausible Nano-Immunotherapy for Lung Carcinoma. Int. J. Mol. Sci. 2021, 22, 6833. [Google Scholar] [CrossRef]
- Alshahrani, S.M.; Khafagy, E.S.; Riadi, Y.; Al Saqr, A.; Alfadhel, M.M.; Hegazy, W.A.H. Amphotericin B-PEG Conjugates of ZnO Nanoparticles: Enhancement Antifungal Activity with Minimal Toxicity. Pharmaceutics 2022, 14, 1646. [Google Scholar] [CrossRef]
- Thabit, A.K.; Eljaaly, K.; Zawawi, A.; Ibrahim, T.S.; Eissa, A.G.; Elbaramawi, S.S.; Hegazy, W.A.H.; Elfaky, M.A. Muting Bacterial Communication: Evaluation of Prazosin Anti-Quorum Sensing Activities against Gram-Negative Bacteria Pseudomonas aeruginosa, Proteus mirabilis, and Serratia marcescens. Biology 2022, 11, 1349. [Google Scholar] [CrossRef] [PubMed]
- Brackman, G.; Cos, P.; Maes, L.; Nelis, H.J.; Coenye, T. Quorum sensing inhibitors increase the susceptibility of bacterial biofilms to antibiotics in vitro and in vivo. Antimicrob. Agents Chemother. 2011, 55, 2655–2661. [Google Scholar] [CrossRef] [PubMed]
- Agha, K.A.; Abo-Dya, N.E.; Ibrahim, T.S.; Abdel-Aal, E.H.; Hegazy, W.A. Benzotriazole-Mediated Synthesis and Antibacterial Activity of Novel N-Acylcephalexins. Sci. Pharm. 2016, 84, 484–496. [Google Scholar] [CrossRef] [PubMed]
- Almalki, A.J.; Ibrahim, T.S.; Taher, E.S.; Mohamed, M.F.A.; Youns, M.; Hegazy, W.A.H.; Al-Mahmoudy, A.M.M. Synthesis, Antimicrobial, Anti-Virulence and Anticancer Evaluation of New 5(4H)-Oxazolone-Based Sulfonamides. Molecules 2022, 27, 671. [Google Scholar] [CrossRef]
- Hegazy, W.A.H.; Rajab, A.A.H.; Abu Lila, A.S.; Abbas, H.A. Anti-diabetics and antimicrobials: Harmony of mutual interplay. World J. Diabetes 2021, 12, 1832–1855. [Google Scholar] [CrossRef]
- Askoura, M.; Hegazy, W.A.H. Ciprofloxacin interferes with Salmonella Typhimurium intracellular survival and host virulence through repression of Salmonella pathogenicity island-2 (SPI-2) genes expression. Pathog. Dis. 2020, 78, ftaa011. [Google Scholar] [CrossRef]
- Khayyat, A.N.; Abbas, H.A.; Mohamed, M.F.A.; Asfour, H.Z.; Khayat, M.T.; Ibrahim, T.S.; Youns, M.; Khafagy, E.-S.; Abu Lila, A.S.; Safo, M.K.; et al. Not Only Antimicrobial: Metronidazole Mitigates the Virulence of Proteus mirabilis Isolated from Macerated Diabetic Foot Ulcer. Appl. Sci. 2021, 11, 6847. [Google Scholar] [CrossRef]
- Khayat, M.T.; Abbas, H.A.; Ibrahim, T.S.; Khayyat, A.N.; Alharbi, M.; Darwish, K.M.; Elhady, S.S.; Khafagy, E.-S.; Safo, M.K.; Hegazy, W.A.H. Anti-Quorum Sensing Activities of Gliptins against Pseudomonas aeruginosa and Staphylococcus aureus. Biomedicines 2022, 10, 1169. [Google Scholar] [CrossRef]
- Hegazy, W.A.H.; Abbas, H.A. Evaluation of the role of SsaV ‘Salmonella pathogenicity island-2 dependent type III secretion system components on the virulence behavior of Salmonella enterica serovar Typhimurium. Afr. J. Biotechnol. 2017, 16, 718–726. [Google Scholar] [CrossRef]
- Khayyat, A.N.; Abbas, H.A.; Khayat, M.T.; Shaldam, M.A.; Askoura, M.; Asfour, H.Z.; Khafagy, E.-S.; Abu Lila, A.S.; Allam, A.N.; Hegazy, W.A.H. Secnidazole Is a Promising Imidazole Mitigator of Serratia marcescens Virulence. Microorganisms 2021, 9, 2333. [Google Scholar] [CrossRef]
- Youns, M.; Askoura, M.; Abbas, H.A.; Attia, G.H.; Khayyat, A.N.; Goda, R.M.; Almalki, A.J.; Khafagy, E.S.; Hegazy, W.A.H. Celastrol Modulates Multiple Signaling Pathways to Inhibit Proliferation of Pancreatic Cancer via DDIT3 and ATF3 Up-Regulation and RRM2 and MCM4 Down-Regulation. OncoTargets 2021, 14, 3849–3860. [Google Scholar] [CrossRef] [PubMed]
- Askoura, M.; Abbas, H.A.; Al Sadoun, H.; Abdulaal, W.H.; Abu Lila, A.S.; Almansour, K.; Alshammari, F.; Khafagy, E.-S.; Ibrahim, T.S.; Hegazy, W.A.H. Elevated Levels of IL-33, IL-17 and IL-25 Indicate the Progression from Chronicity to Hepatocellular Carcinoma in Hepatitis C Virus Patients. Pathogens 2022, 11, 57. [Google Scholar] [CrossRef] [PubMed]
- Askoura, M.; Youns, M.; Halim Hegazy, W.A. Investigating the influence of iron on Campylobacter jejuni transcriptome in response to acid stress. Microb. Pathog. 2020, 138, 103777. [Google Scholar] [CrossRef] [PubMed]
- Emara, N.A.; Mahmoud, M.F.; El Fayoumi, H.M.; Mahmoud, A.A.A. The renoprotective effect of glycyrrhizic acid in insulin-resistant rats exposed to aluminum involves the inhibition of TLR4/NF-kappaB signaling pathway. Naunyn Schmiedebergs Arch. Pharm. 2021, 394, 863–872. [Google Scholar] [CrossRef] [PubMed]
- Hegazy, W.A.H.; Henaway, M. Hepatitis C virus pathogenesis: Serum IL-33 level indicates liver damage. Afr. J. Microbiol. Res. 2015, 9, 1386–1393. [Google Scholar]
- Wadie, M.A.; Kishk, S.M.; Darwish, K.M.; Mostafa, S.M.; Elgawish, M.S. Simultaneous Determination of Losartan and Rosuvastatin in Rat Plasma Using Liquid Chromatography–Tandem Mass Spectrometric Technique for Application into Pharmacokinetic and Drug–Drug Interaction Studies. Chromatographia 2020, 83, 1477–1494. [Google Scholar] [CrossRef]
- Malebari, A.; Ibrahim, T.; Salem, I.; Salama, I.; Khayyat, A.; Mostafa, S.; El-Sabbagh, O.; Darwish, K. The Anticancer Activity for the Bumetanide-Based Analogs via Targeting the Tumor-Associated Membrane Bound Human Carbonic Anhydrase-IX Enzyme. 2020, 13, 252. Pharmaceuticals 2012, 13, 252. [Google Scholar] [CrossRef]
- El Raey, M.A.; El-Hagrassi, A.M.; Osman, A.F.; Darwish, K.M.; Emam, M. Acalypha wilkesiana flowers: Phenolic profiling, cytotoxic activity of their biosynthesized silver nanoparticles and molecular docking study for its constituents as Topoisomerase-I inhibitors. Biocatal. Agric. Biotechnol. 2019, 20, 101243. [Google Scholar] [CrossRef]
- Kitchen, D.B.; Decornez, H.; Furr, J.R.; Bajorath, J. Docking and scoring in virtual screening for drug discovery: Methods and applications. Nat. Rev. Drug Discov. 2004, 3, 935–949. [Google Scholar] [CrossRef]
- Wojciechowski, M.; Lesyng, B. Generalized Born Model: Analysis, Refinement, and Applications to Proteins. J. Phys. Chem. B 2004, 108, 18368–18376. [Google Scholar] [CrossRef]
- Labute, P. The generalized Born/volume integral implicit solvent model: Estimation of the free energy of hydration using London dispersion instead of atomic surface area. J. Comput. Chem. 2008, 29, 1693–1698. [Google Scholar] [CrossRef] [PubMed]
- The PyMOL Molecular Graphics System, 2.0.6; Schrödinger, LLC: New York, NY, USA, 2016; Impact, Schrödinger, LLC, New York, NY, 2016; Prime, Schrödinger, LLC, New York, NY, 2020. Available online: https://www.schrodinger.com/products/pymol (accessed on 25 April 2022).
- Gould, T.A.; Schweizer, H.P.; Churchill, M.E. Structure of the Pseudomonas aeruginosa acyl-homoserinelactone synthase LasI. Mol. Microbiol. 2004, 53, 1135–1146. [Google Scholar] [CrossRef] [PubMed]
- Wysoczynski-Horita, C.L.; Boursier, M.E.; Hill, R.; Hansen, K.; Blackwell, H.E.; Churchill, M.E.A. Mechanism of agonism and antagonism of the Pseudomonas aeruginosa quorum sensing regulator QscR with non-native ligands. Mol. Microbiol. 2018, 108, 240–257. [Google Scholar] [CrossRef] [PubMed]
- McCready, A.R.; Paczkowski, J.E.; Henke, B.R.; Bassler, B.L. Structural determinants driving homoserine lactone ligand selection in the Pseudomonas aeruginosa LasR quorum-sensing receptor. Proc. Natl. Acad. Sci. USA 2019, 116, 245–254. [Google Scholar] [CrossRef] [PubMed]
- Lidor, O.; Al-Quntar, A.; Pesci, E.C.; Steinberg, D. Mechanistic analysis of a synthetic inhibitor of the Pseudomonas aeruginosa LasI quorum-sensing signal synthase. Sci. Rep. 2015, 5, 16569. [Google Scholar] [CrossRef]
- Albuquerque, S.O.; Barros, T.G.; Dias, L.R.S.; Lima, C.; Azevedo, P.; Flores-Junior, L.A.P.; Dos Santos, E.G.; Loponte, H.F.; Pinheiro, S.; Dias, W.B.; et al. Biological evaluation and molecular modeling of peptidomimetic compounds as inhibitors for O-GlcNAc transferase (OGT). Eur. J. Pharm. Sci. Off. J. Eur. Fed. Pharm. Sci. 2020, 154, 105510. [Google Scholar] [CrossRef]
- de Souza, A.S.; Pacheco, B.D.C.; Pinheiro, S.; Muri, E.M.F.; Dias, L.R.S.; Lima, C.H.S.; Garrett, R.; de Moraes, M.B.M.; de Souza, B.E.G.; Puzer, L. 3-Acyltetramic acids as a novel class of inhibitors for human kallikreins 5 and 7. Bioorg. Med. Chem. Lett. 2019, 29, 1094–1098. [Google Scholar] [CrossRef]
- Elhady, S.S.; Abdelhameed, R.F.A.; Malatani, R.T.; Alahdal, A.M.; Bogari, H.A.; Almalki, A.J.; Mohammad, K.A.; Ahmed, S.A.; Khedr, A.I.M.; Darwish, K.M. Molecular Docking and Dynamics Simulation Study of Hyrtios erectus Isolated Scalarane Sesterterpenes as Potential SARS-CoV-2 Dual Target Inhibitors. Biology 2021, 10, 389. [Google Scholar] [CrossRef]
- Kontoyianni, M.; McClellan, L.M.; Sokol, G.S. Evaluation of Docking Performance: Comparative Data on Docking Algorithms. J. Med. Chem. 2004, 47, 558–565. [Google Scholar] [CrossRef]
- Moore, J.D.; Rossi, F.M.; Welsh, M.A.; Nyffeler, K.E.; Blackwell, H.E. A Comparative Analysis of Synthetic Quorum Sensing Modulators in Pseudomonas aeruginosa: New Insights into Mechanism, Active Efflux Susceptibility, Phenotypic Response, and Next-Generation Ligand Design. J. Am. Chem. Soc. 2015, 137, 14626–14639. [Google Scholar] [CrossRef]
- Livermore, D.M. British Society for Antimicrobial Chemotherapy Working Party on The Urgent Need: Regenerating Antibacterial Drug, D.; Development. Discovery research: The scientific challenge of finding new antibiotics. J. Antimicrob. Chemother. 2011, 66, 1941–1944. [Google Scholar] [CrossRef] [PubMed]
- Mohr, K.I. History of Antibiotics Research. Curr. Top. Microbiol. Immunol. 2016, 398, 237–272. [Google Scholar] [CrossRef] [PubMed]
- Abd El-Hamid, M.I.; Sewid, A.H.; Samir, M.; Hegazy, W.A.H.; Bahnass, M.M.; Mosbah, R.A.; Ghaith, D.M.; Khalifa, E.; Ramadan, H.; Alshareef, W.A.; et al. Clonal Diversity and Epidemiological Characteristics of ST239-MRSA Strains. Front. Cell. Infect. Microbiol. 2022, 12. [Google Scholar] [CrossRef] [PubMed]
- Medzhitov, R. Toll-like receptors and innate immunity. Nat. Rev. Immunol. 2001, 1, 135–145. [Google Scholar] [CrossRef]
- Alandiyjany, M.N.; Abdelaziz, A.S.; Abdelfattah-Hassan, A.; Hegazy, W.A.H.; Hassan, A.A.; Elazab, S.T.; Mohamed, E.A.A.; El-Shetry, E.S.; Saleh, A.A.; ElSawy, N.A.; et al. Novel In Vivo Assessment of Antimicrobial Efficacy of Ciprofloxacin Loaded Mesoporous Silica Nanoparticles against Salmonella typhimurium Infection. Pharmaceuticals 2022, 15, 357. [Google Scholar] [CrossRef]
- Hegazy, W.A.H.; Salem, I.M.; Alotaibi, H.F.; Khafagy, E.-S.; Ibrahim, D. Terazosin Interferes with Quorum Sensing and Type Three Secretion System and Diminishes the Bacterial Espionage to Mitigate the Salmonella Typhimurium Pathogenesis. Antibiotics 2022, 11, 465. [Google Scholar] [CrossRef]
- Li, J.; Turnidge, J.; Milne, R.; Nation, R.L.; Coulthard, K. In vitro pharmacodynamic properties of colistin and colistin methanesulfonate against Pseudomonas aeruginosa isolates from patients with cystic fibrosis. Antimicrob. Agents Chemother. 2001, 45, 781–785. [Google Scholar] [CrossRef]
- Garcia-Contreras, R. Is Quorum Sensing Interference a Viable Alternative to Treat Pseudomonas aeruginosa Infections? Front. Microbiol. 2016, 7, 1454. [Google Scholar] [CrossRef]
- Kim, W.; Surette, M.G. Coordinated regulation of two independent cell-cell signaling systems and swarmer differentiation in Salmonella enterica serovar Typhimurium. J. Bacteriol. 2006, 188, 431–440. [Google Scholar] [CrossRef]
- Voynow, J.A.; Fischer, B.M.; Zheng, S. Proteases and cystic fibrosis. Int. J. Biochem. Cell Biol. 2008, 40, 1238–1245. [Google Scholar] [CrossRef]
- Das, T.; Manefield, M. Pyocyanin promotes extracellular DNA release in Pseudomonas aeruginosa. PLoS ONE 2012, 7, e46718. [Google Scholar] [CrossRef] [PubMed]
- Hall, S.; McDermott, C.; Anoopkumar-Dukie, S.; McFarland, A.J.; Forbes, A.; Perkins, A.V.; Davey, A.K.; Chess-Williams, R.; Kiefel, M.J.; Arora, D.; et al. Cellular Effects of Pyocyanin, a Secreted Virulence Factor of Pseudomonas aeruginosa. Toxins 2016, 8, 236. [Google Scholar] [CrossRef]
- Winzer, K.; Williams, P. Quorum sensing and the regulation of virulence gene expression in pathogenic bacteria. Int. J. Med. Microbiol. 2001, 291, 131–143. [Google Scholar] [CrossRef]
- Jiang, Q.; Chen, J.; Yang, C.; Yin, Y.; Yao, K. Quorum Sensing: A Prospective Therapeutic Target for Bacterial Diseases. BioMed Res. Int. 2019, 2019, 2015978. [Google Scholar] [CrossRef] [PubMed]
- Smith, R.S.; Iglewski, B.H.P. aeruginosa quorum-sensing systems and virulence. Curr. Opin. Microbiol. 2003, 6, 56–60. [Google Scholar] [CrossRef]
- Lintz, M.J.; Oinuma, K.; Wysoczynski, C.L.; Greenberg, E.P.; Churchill, M.E. Crystal structure of QscR, a Pseudomonas aeruginosa quorum sensing signal receptor. Proc. Natl. Acad. Sci. USA 2011, 108, 15763–15768. [Google Scholar] [CrossRef] [PubMed]
- Smalley, N.E.; An, D.; Parsek, M.R.; Chandler, J.R.; Dandekar, A.A. Quorum Sensing Protects Pseudomonas aeruginosa against Cheating by Other Species in a Laboratory Coculture Model. J. Bacteriol. 2015, 197, 3154–3159. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Tong, X.; Sun, P.; Bi, L.; Lin, K. Virtual screening and biological evaluation of biofilm inhibitors on dual targets in quorum sensing system. Future Med. Chem. 2017, 9, 1983–1994. [Google Scholar] [CrossRef]
- Vetrivel, A.; Natchimuthu, S.; Subramanian, V.; Murugesan, R. High-Throughput Virtual Screening for a New Class of Antagonist Targeting LasR of Pseudomonas aeruginosa. ACS Omega 2021, 6, 18314–18324. [Google Scholar] [CrossRef]
- Sadiq, S.; Rana, N.F.; Zahid, M.A.; Zargaham, M.K.; Tanweer, T.; Batool, A.; Naeem, A.; Nawaz, A.; Rizwan Ur, R.; Muneer, Z.; et al. Virtual Screening of FDA-Approved Drugs against LasR of Pseudomonas aeruginosa for Antibiofilm Potential. Molecules 2020, 25, 3723. [Google Scholar] [CrossRef]
- Hernando-Amado, S.; Alcalde-Rico, M.; Gil-Gil, T.; Valverde, J.R.; Martínez, J.L. Naringenin Inhibition of the Pseudomonas aeruginosa Quorum Sensing Response Is Based on Its Time-Dependent Competition With N-(3-Oxo-dodecanoyl)-L-homoserine Lactone for LasR Binding. Front. Mol. Biosci. 2020, 7, 25. [Google Scholar] [CrossRef] [PubMed]
- Nain, Z.; Sayed, S.B.; Karim, M.M.; Islam, M.A.; Adhikari, U.K. Energy-optimized pharmacophore coupled virtual screening in the discovery of quorum sensing inhibitors of LasR protein of Pseudomonas aeruginosa. J. Biomol. Struct. Dyn. 2020, 38, 5374–5388. [Google Scholar] [CrossRef] [PubMed]














| Target Gene | Sequence (5′–3′) | Reference | 
|---|---|---|
| lasI | For: CTACAGCCTGCAGAACGACA Rev: ATCTGGGTCTTGGCATTGAG | [2,21,22] | 
| lasR | For: ACGCTCAAGTGGAAAATTGG Rev: GTAGATGGACGGTTCCCAGA | [2,21,22] | 
| rhlI | For: CTCTCTGAATCGCTGGAAGG Rev: GACGTCCTTGAGCAGGTAGG | [2,3,21,22] | 
| rhlR | For: AGGAATGACGGAGGCTTTTT Rev: CCCGTAGTTCTGCATCTGGT | [2,21,22] | 
| pqsA | For: TTCTGTTCCGCCTCGATTTC Rev: AGTCGTTCAACGCCAGCAC | [2,21,22] | 
| pqsR | For: AACCTGGAAATCGACCTGTG Rev: TGAAATCGTCGAGCAGTACG | [2,21,22] | 
| rpoD | For: GGGCGAAGAAGGAAATGGTC Rev: CAGGTGGCGTAGGTGGAGAAC | [2,21,22] | 
| Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. | 
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khayat, M.T.; Ibrahim, T.S.; Darwish, K.M.; Khayyat, A.N.; Alharbi, M.; Khafagy, E.-S.; Ali, M.A.M.; Hegazy, W.A.H.; Abbas, H.A. Hiring of the Anti-Quorum Sensing Activities of Hypoglycemic Agent Linagliptin to Alleviate the Pseudomonas aeruginosa Pathogenesis. Microorganisms 2022, 10, 2455. https://doi.org/10.3390/microorganisms10122455
Khayat MT, Ibrahim TS, Darwish KM, Khayyat AN, Alharbi M, Khafagy E-S, Ali MAM, Hegazy WAH, Abbas HA. Hiring of the Anti-Quorum Sensing Activities of Hypoglycemic Agent Linagliptin to Alleviate the Pseudomonas aeruginosa Pathogenesis. Microorganisms. 2022; 10(12):2455. https://doi.org/10.3390/microorganisms10122455
Chicago/Turabian StyleKhayat, Maan T., Tarek S. Ibrahim, Khaled M. Darwish, Ahdab N. Khayyat, Majed Alharbi, El-Sayed Khafagy, Mohamed A. M. Ali, Wael A. H. Hegazy, and Hisham A. Abbas. 2022. "Hiring of the Anti-Quorum Sensing Activities of Hypoglycemic Agent Linagliptin to Alleviate the Pseudomonas aeruginosa Pathogenesis" Microorganisms 10, no. 12: 2455. https://doi.org/10.3390/microorganisms10122455
APA StyleKhayat, M. T., Ibrahim, T. S., Darwish, K. M., Khayyat, A. N., Alharbi, M., Khafagy, E.-S., Ali, M. A. M., Hegazy, W. A. H., & Abbas, H. A. (2022). Hiring of the Anti-Quorum Sensing Activities of Hypoglycemic Agent Linagliptin to Alleviate the Pseudomonas aeruginosa Pathogenesis. Microorganisms, 10(12), 2455. https://doi.org/10.3390/microorganisms10122455
 
        




 
       