Distribution and Characterization of Antimicrobial Resistant Pathogens in a Pig Farm, Slaughterhouse, Meat Processing Plant, and in Retail Stores
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sampling and Treatment
2.2. Pathogen’s Isolation and Identification
2.3. Antimicrobial Susceptibility Assay
2.4. Pulsed-Field Gel Electrophoresis (PFGE) Analysis
3. Results
3.1. Distribution of the Pathogens in the Pork Meats and Their Producing Environmental Samples
3.2. Antimicrobial Resistance in the Important Foodborne Pathogens
3.3. Genetic Diversity of STEC Isolates
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Van Boeckel, T.P.; Pires, J.; Silvester, R.; Zhao, C.; Song, J.; Criscuolo, N.G.; Gilbert, M.; Bonhoeffer, S.; Laxminarayan, R. Global trends in antimicrobial resistance in animals in low- and middle-income countries. Science 2019, 365, 1266. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dewulf, J.; Sternberg-Lewerin, S.; Ryan, M. Tackling antimicrobial resistance in the food and livestock sector. In Challenges to Tackling Antimicrobial Resistance; Anderson, M., Cecchini, M., Mossialos, E., Eds.; Cambridge University Press: Cambridge, UK, 2020; pp. 99–123. [Google Scholar]
- APQA. Animal and Plant Quarantine Agency. In Korean Veterinary Antimicrobial Resistance Monitoring Report; APQA: Gimcheon, Korea, 2019. [Google Scholar]
- Bae, D.; Kweon, O.; Khan, A.A. Isolation and characterization of antimicrobial-resistant nontyphoidal Salmonella enterica serovars from imported food products. J. Food Protect. 2016, 79, 1348–1354. [Google Scholar] [CrossRef] [PubMed]
- Pollock, J.; Muwonge, A.; Hutchings, M.R.; Mainda, G.; Bronsvoort, B.M.; Gally, D.L.; Corbishley, A. Resistance to change: AMR gene dynamics on a commercial pig farm with high antimicrobial usage. Sci. Rep. 2020, 10, 1708. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Avraam, C.; Lambrou, A.S.; Jiang, W.; Siddiqui, S. Antimicrobial resistance and livestock trade for low and middle income countries: Regional analysis of global coordination policies. Front. Sustain. Food Syst. 2021, 5, 650315. [Google Scholar] [CrossRef]
- Hughes, D. Selection and evolution of resistance to antimicrobial drugs. IUBMB Life 2014, 66, 521–529. [Google Scholar] [CrossRef] [PubMed]
- Ryu, S. The new Korean action plan for containment of antimicrobial resistance. J. Glob. Antimicrob. Resist. 2017, 8, 70–73. [Google Scholar] [CrossRef]
- Ceccarelli, D.; Hesp, A.; van der Goot, J.; Joosten, P.; Sarrazin, S.; Wagenaar, J.A.; Dewulf, J.; Mevius, D.J.; Effort Consortium, O. Antimicrobial resistance prevalence in commensal Escherichia coli from broilers, fattening turkeys, fattening pigs and veal calves in European countries and association with antimicrobial usage at country level. J. Med. Microbiol. 2020, 69, 537–547. [Google Scholar] [CrossRef]
- Vanderhaeghen, W.; Dewulf, J. Antimicrobial use and resistance in animals and human beings. Lancet Planet Health 2017, 1, E307–E308. [Google Scholar] [CrossRef]
- Zwirzitz, B.; Wetzels, S.U.; Dixon, E.D.; Stessl, B.; Zaiser, A.; Rabanser, I.; Thalguter, S.; Pinior, B.; Roch, F.F.; Strachan, C.; et al. The sources and transmission routes of microbial populations throughout a meat processing facility. Npj Biofilms Microbiomes 2020, 6, 26. [Google Scholar] [CrossRef]
- Caekebeke, N.; Jonquiere, F.J.; Ringenier, M.; Tobias, T.J.; Postma, M.; van den Hoogen, A.; Houben, M.A.M.; Velkers, F.C.; Sleeckx, N.; Stegeman, J.A.; et al. Comparing farm biosecurity and antimicrobial use in high-antimicrobial-consuming broiler and pig farms in the Belgian-Dutch border region. Front. Vet. Sci. 2020, 7, 558455. [Google Scholar] [CrossRef]
- OIE. Annual Report on Antimicrobial Agents Intended for Use in Animals. Available online: https://www.oie.int/fileadmin/Home/eng/Our_scientific_expertise/docs/pdf/AMR/Annual_Report_AMR_3.pdf (accessed on 12 June 2020).
- Holmer, I.; Salomonsen, C.M.; Jorsal, S.E.; Astrup, L.B.; Jensen, V.F.; Hog, B.B.; Pedersen, K. Antibiotic resistance in porcine pathogenic bacteria and relation to antibiotic usage. BMC Vet. Res. 2019, 15, 449. [Google Scholar] [CrossRef] [Green Version]
- Trongjit, S.; Angkititrakul, S.; Tuttle, R.E.; Poungseree, J.; Padungtod, P.; Chuanchuen, R. Prevalence and antimicrobial resistance in Salmonella enterica isolated from broiler chickens, pigs and meat products in Thailand-Cambodia border provinces. Microbiol. Immunol. 2017, 61, 23–33. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lunha, K.; Leangapichart, T.; Jiwakanon, J.; Angkititrakul, S.; Sunde, M.; Jarhult, J.D.; Hallenberg, G.S.; Hickman, R.A.; Van Boeckel, T.; Magnusson, U. Antimicrobial resistance in fecal Escherichia coli from humans and pigs at farms at different levels of intensification. Antibiotics 2020, 9, 662. [Google Scholar] [CrossRef] [PubMed]
- Im, M.C.; Seo, K.W.; Bae, D.H.; Lee, Y.J. Bacterial quality and prevalence of foodborne pathogens in edible offal from slaughterhouses in Korea. J. Food Protect. 2016, 79, 163–168. [Google Scholar] [CrossRef]
- Ballash, G.A.; Albers, A.L.; Mollenkopf, D.F.; Sechrist, E.; Adams, R.J.; Wittum, T.E. Antimicrobial resistant bacteria recovered from retail ground meat products in the US include a Raoultella ornithinolytica co-harboring blaKPC-2 and blaNDM-5. Sci. Rep. 2021, 11, 14041. [Google Scholar] [CrossRef]
- Self, J.L.; Luna-Gierke, R.E.; Fothergill, A.; Holt, K.G.; Vieira, A.R. Outbreaks attributed to pork in the United States, 1998–2015. Epidemiol. Infect. 2017, 145, 2980–2990. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Doyle, M.E. Multidrug-resistant pathogens in the food supply. Foodborne Pathog. Dis. 2015, 12, 261–279. [Google Scholar] [CrossRef]
- Nogva, H.K.; Rudi, K.; Naterstad, K.; Holck, A.; Lillehaug, D. Application of 5’-nuclease PCR for quantitative detection of Listeria monocytogenes in pure cultures, water, skim milk, and unpasteurized whole milk. Appl. Environ. Microbiol. 2000, 66, 4266–4271. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.Z.; Duan, R.; Liang, J.R.; Huang, Y.; Xiao, Y.C.; Qiu, H.Y.; Wang, X.; Jing, H.Q. Real-time TaqMan PCR for Yersinia enterocolitica detection based on the ail and foxA genes. J. Clin. Microbiol. 2014, 52, 4443–4444. [Google Scholar] [CrossRef] [Green Version]
- Paton, A.W.; Paton, J.C. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex-PCR assays for stx1, stx2, eaeA, enterohaemorrhagic E. coli hlyA, rfbO111 and rfbO157. J. Clin. Microbiol. 1998, 36, 598–602. [Google Scholar] [CrossRef]
- Chen, J.; Griffiths, M.W. PCR differentiation of Escherichia coli from other gram-negative bacteria using primers derived from the nucleotide sequences flanking the gene encoding the universal stress protein. Lett. Appl. Microbiol. 1998, 27, 369–371. [Google Scholar] [CrossRef] [PubMed]
- Chiefari, A.K.; Perry, M.J.; Kelly-Cirino, C.; Egan, C.T. Detection of Staphylococcus aureus enterotoxin production genes from patient samples using an automated extraction platform and multiplex real-time PCR. Mol. Cell Probe 2015, 29, 461–467. [Google Scholar] [CrossRef] [PubMed]
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing. In Twentieth Informational Supplement; CLSI: Wayne, PA, USA, 2018. [Google Scholar]
- Gkouletsos, T.; Patas, K.; Lambrinidis, G.; Neubauer, H.; Sprague, L.D.; Ioannidis, A.; Chatzipanagiotou, S. Antimicrobial resistance of Yersinia enterocolitica and presence of plasmid pYV virulence genes in human and animal isolates. New Microbes New Infect. 2019, 32, 100604. [Google Scholar] [CrossRef] [PubMed]
- Younis, G.; Mady, M.; Awad, A. Yersinia enterocolitica: Prevalence, virulence, and antimicrobial resistance from retail and processed meat in Egypt. Vet. World 2019, 12, 1078–1084. [Google Scholar] [CrossRef]
- Baumgartner, A.; Kuffer, M.; Suter, D.; Jemmi, T.; Rohner, P. Antimicrobial resistance of Yersinia enterocolitica strains from human patients, pigs and retail pork in Switzerland. Int. J. Food Microbiol. 2007, 115, 110–114. [Google Scholar] [CrossRef]
- CDC. Yersinia enterocolitica (Yersiniosis). Available online: https://www.cdc.gov/yersinia/faq.html (accessed on 6 October 2021).
- Wang, Y.; Zhang, S.Y.; Yu, J.Y.; Zhang, H.; Yuan, Z.Q.; Sun, Y.S.; Zhang, L.; Zhu, Y.F.; Song, H.B. An outbreak of Proteus mirabilis food poisoning associated with eating stewed pork balls in brown sauce, Beijing. Food Control 2010, 21, 302–305. [Google Scholar] [CrossRef]
- Drzewiecka, D. Significance and roles of Proteus spp. bacteria in natural environments. Microb Ecol. 2016, 72, 741–758. [Google Scholar] [CrossRef] [Green Version]
- Hola, V.; Peroutkova, T.; Ruzicka, F. Virulence factors in Proteus bacteria from biofilm communities of catheter-associated urinary tract infections. Fems Immunol. Med. Mic. 2012, 65, 343–349. [Google Scholar] [CrossRef] [Green Version]
- Gong, Z.L.; Shi, X.L.; Bai, F.; He, X.L.; Zhang, H.Y.; Li, Y.B.; Wan, Y.; Lin, Y.M.; Qiu, Y.Q.; Chen, Q.C.; et al. Characterization of a novel diarrheagenic strain of Proteus mirabilis associated with food poisoning in China. Front. Microbiol. 2019, 10, 2810. [Google Scholar] [CrossRef] [Green Version]
- Chinnam, B.K.; Nelapati, S.; Tumati, S.R.; Bobbadi, S.; Peddada, V.C.; Bodempudi, B. Detection of beta-lactamase-producing Proteus mirabilis strains of animal origin in Andhra Pradesh, India and their genetic diversity. J. Food Protect. 2021, 84, 1374–1379. [Google Scholar] [CrossRef]
Selective Agar | Target Bacteria | Characteristics/Cultivation Conditions | Primer Sequences | Gene/Product Size | References |
---|---|---|---|---|---|
Oxford | Listeria monocytogenes | Gray colony with a black halo, 37 °C for 24 h | F: TGCAAGTCCTAAGACGCCA R: CACTGCATCTCCGTGGTATACTAA | hlyA/113 bp | [21] |
MacConkey | Yersinia enterocolitica | Pale pink or colorless colony, 30 °C for 36 h | F: TTTGGAAGCGGGTTGAATTG R: GCTCACGGAAAGGTTAAGTCATCT | ail/101 bp | [22] |
TC-SMAC | STEC | Clear or colorless colony, 37 °C for 24 h | F: ATAAATCGCCATTCGTTGACTAC R: AGAACGCCCACTGAGATCATC F: GGCACTGTCTGAAACTGCTCC R: TCGCCAGTTATCTGACATTCTG | stx1/180 bp stx2/255 bp | [23] |
BCIG | E. coli | Bluish green colony, 37 °C for 24 h | F: CCGATACGCTGCCAATCAGT R: CTGGTATCAGCGCGAAGTCT | uspA/884bp | [24] |
Baird-Parker | Staphylococcus aureus | Gray to less black with opaque zone, 35 °C for 48 h | F: AAGTGCCGATCAATTTATGGCTA R: CCTGAACAGTTACATTTTTCTTATTCGT | entA/90 bp | [25] |
ID | Species | AMC | AMP | CHL | CIP | GEN | ERY | KAN | RIF | STR | SXT | TET | VAN | Source (Site 2) |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
GNU-YE 1 | Y. enterocolitica | − | − | − | − | − | − | − | − | − | − | − | NA | Carcass (S) |
GNU-YE 2 | Y. enterocolitica | − | − | − | − | − | − | − | − | − | − | − | NA | Carcass (S) |
GNU-YE 3 | Y. enterocolitica | − | − | − | − | − | − | − | − | − | − | − | NA | Carcass (S) |
GNU-YE 4 | Y. enterocolitica | − | − | − | − | − | − | − | − | − | − | − | NA | Carcass (S) |
GNU-YE 5 | Y. enterocolitica | + | + | − | − | − | + | − | + | − | − | − | NA | Glove (S) |
GNU-YE 6 | Y. enterocolitica | + | ++ | − | − | − | + | − | + | − | − | − | NA | Knife (S) |
GNU-YE 7 | Y. enterocolitica | + | + | − | − | − | + | − | + | − | − | − | NA | Glove (S) |
GNU-YE 8 | Y. enterocolitica | − | + | − | − | − | − | − | − | − | − | − | NA | Belly meat (R) |
GNU-YE 9 | Y. enterocolitica | − | − | − | − | − | − | − | − | − | − | − | NA | Carcass (S) |
GNU-EC 1 | STEC 3 | − | ++ | − | − | − | ++ | − | − | − | − | + | NA | Carcass (S) |
GNU-EC 2 | STEC | − | ++ | ++ | − | − | + | − | − | + | − | + | NA | Feces (F) |
GNU-EC 3 | STEC | − | ++ | ++ | − | − | + | − | + | + | ++ | + | NA | Glove (S) |
GNU-EC 4 | STEC | − | ++ | + | − | − | + | ++ | + | ++ | ++ | ++ | NA | Belly meat (R) |
GNU-EC 5 | STEC | − | ++ | + | − | − | ++ | + | + | ++ | + | ++ | NA | Belly meat (R) |
GNU-EC 6 | STEC | − | + | + | − | − | + | ++ | + | ++ | ++ | + | NA | Belly meat (R) |
GNU-EC 7 | STEC | − | ++ | + | − | − | + | ++ | + | ++ | + | ++ | NA | Belly meat (R) |
GNU-EC 8 | STEC | − | ++ | + | − | − | + | ++ | + | ++ | + | ++ | NA | Belly meat (R) |
GNU-EC 9 | STEC | − | ++ | + | − | − | + | ++ | + | ++ | ++ | ++ | NA | Belly meat (R) |
GNU-EC 10 | STEC | − | ++ | + | − | − | + | ++ | + | ++ | ++ | ++ | NA | Belly meat (R) |
GNU-EC 11 | STEC | − | ++ | + | − | − | + | ++ | + | ++ | ++ | ++ | NA | Belly meat (R) |
GNU-EC 12 | STEC | − | ++ | + | − | − | ++ | ++ | + | ++ | ++ | ++ | NA | Belly meat (R) |
GNU-SA 1 | S. aureus | − | ++ | − | − | − | ++ | − | + | − | − | + | ++ | Table (P) |
GNU-LM 1 | L. monocytogenes | − | ++ | − | − | − | ++ | − | − | − | − | + | ++ | Meat (P) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bae, D.; Macoy, D.M.; Ahmad, W.; Peseth, S.; Kim, B.; Chon, J.-W.; Ryu, G.R.; Ban, G.-H.; Kim, S.A.; Kang, H.J.; et al. Distribution and Characterization of Antimicrobial Resistant Pathogens in a Pig Farm, Slaughterhouse, Meat Processing Plant, and in Retail Stores. Microorganisms 2022, 10, 2252. https://doi.org/10.3390/microorganisms10112252
Bae D, Macoy DM, Ahmad W, Peseth S, Kim B, Chon J-W, Ryu GR, Ban G-H, Kim SA, Kang HJ, et al. Distribution and Characterization of Antimicrobial Resistant Pathogens in a Pig Farm, Slaughterhouse, Meat Processing Plant, and in Retail Stores. Microorganisms. 2022; 10(11):2252. https://doi.org/10.3390/microorganisms10112252
Chicago/Turabian StyleBae, Dongryeoul, Donah Mary Macoy, Waqas Ahmad, Son Peseth, Binn Kim, Jung-Whan Chon, Gyeong Ryul Ryu, Ga-Hee Ban, Sun Ae Kim, Hye Jeong Kang, and et al. 2022. "Distribution and Characterization of Antimicrobial Resistant Pathogens in a Pig Farm, Slaughterhouse, Meat Processing Plant, and in Retail Stores" Microorganisms 10, no. 11: 2252. https://doi.org/10.3390/microorganisms10112252
APA StyleBae, D., Macoy, D. M., Ahmad, W., Peseth, S., Kim, B., Chon, J.-W., Ryu, G. R., Ban, G.-H., Kim, S. A., Kang, H. J., Moon, J. S., & Kim, M. G. (2022). Distribution and Characterization of Antimicrobial Resistant Pathogens in a Pig Farm, Slaughterhouse, Meat Processing Plant, and in Retail Stores. Microorganisms, 10(11), 2252. https://doi.org/10.3390/microorganisms10112252