Is the Illegal Trade of Glass Eels (Anguilla anguilla) Increasing the Spread of Disease? A Case of EVEX
Abstract
1. Introduction
2. Materials and Methods
2.1. Gross Pathology, Parasitological, Bacteriological and Histopathological Examination
2.2. Ethical Approval
2.3. DNA Extraction and Amplification for Barcoding
2.4. Virological Examination and Virus Identification
2.4.1. ELISA for Detection of Infectious Pancreatic Necrosis Virus (IPNV)
2.4.2. DNA/RNA Extraction
2.4.3. PCR Testing for the Presence of AnHV
2.4.4. Real-Time RT-PCR for the Presence of EVE and EVEX
2.5. Sequencing and Phylogeny of EVEX
2.5.1. Primer and Probe Design
2.5.2. Bayesian Phylogeny
- substitution model General time reversible (GTR) [37], invariant sites were set to be estimated with four categories of gamma-distributed rate heterogeneity and a proportion of invariant sites GTR (GTR + Г4 + I), for the complete sequence. For partitions codon models Shapiro–Rambault–Drummond 2006 (SRD06) [38] uncorrelated relaxed lognormal [39], Coalescent Bayesian Skyline model;
- for complete sequence, same as above. Shapiro–Rambault–Drummond 2006 (SRD06) [38] for genes N, M, G and L while for overlapping genes P and C substitution model GTR [37], invariant sites were set to be estimated or to be empirical with four categories of gamma-distributed rate heterogeneity and a proportion of invariant sites GTR (GTR + Г4 + I). We used uncorrelated relaxed lognormal [39] and the Coalescent Bayesian Skyline model;
- for complete sequence, same as above. For all partitions, codon models Yang 1996 (YANG96) [40] we used the uncorrelated relaxed lognormal Coalescent Bayesian Skyline model;
3. Results
3.1. Gross Pathology, Parasitological and Bacteriological Examination
3.2. Barcoding
3.3. Virological Examination and Identification
3.4. Phylogenetic Analysis
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Van Ginneken, V.; Haenen, O.; Coldenhoff, K.; Willemze, R.; Antonissen, E.; van Tulden, P.; Dijkstra, S.; Wagenaar, F.; Van den Thillart, G. Presence of eel viruses in eel species from various geographic regions. Bull. Eur. Assoc. Fish Pathol. 2004, 24, 268–272. [Google Scholar]
- Pike, C.; Crook, V.; Gollock, M. Anguilla anguilla. In The IUCN Red List of Threatened Species; International Union for Conservation of Nature and Natural Resources (IUCN): Cambrige, UK, 2020. [Google Scholar]
- Piria, M.; Šprem, N.; Tomljanović, T.; Slišković, M.; Jelić Mrčelić, G.; Treer, T. Length-weight relationship of European eel Anguilla Anguilla (Linnaeus, 1758) from six karst catchments of the Adriatic basin, Croatia. Ribar. Croat. J. Fish. 2014, 72, 32–35. [Google Scholar] [CrossRef] [Scilit]
- Dekker, W.; Casselman, J.M.; Cairns, D.K.; Tsukamoto, K.; Jellyman, D.; Lickers, H. Worldwide decline of eel resources necessitates immediate action, Québec Declaration of Concern. Fisheries 2003, 28, 28–30. [Google Scholar]
- Székely., C.; Palstra, A.; Molnár, K.; van den Thillart, G. Impact of the swim-bladder parasite on the health and performance of European eels. In Spawning Migration of the European Eel: Reproduction Index, a Useful Tool for Conservation Management; Fish & Fisheries Series; van den Thillart, G., Dufour, S., Rankin, J., Eds.; Springer: Berlin/Heidelberg, Germany, 2009; Volume 30, pp. 201–226. [Google Scholar]
- Esteve, C.; Alcaide, E. Influence of diseases on the wild eel stock: The case of Albufera Lake. Aquaculture 2009, 289, 143–149. [Google Scholar] [CrossRef] [Scilit]
- Haenen, O.; van Ginneken, V.; Engelsma, M.; van den Thillart, G. Impact of eel viruses on recruitment of European eel. In Spawning Migration of the European Eel: Reproduction Index, a Useful Tool for Conservation Management; Fish & Fisheries Series; van den Thillart, G., Dufour, S., Rankin, J., Eds.; Springer: Berlin/Heidelberg, Germany, 2009; Volume 30, pp. 387–400. [Google Scholar]
- van Beurden, S.J.; Engelsma, M.Y.; Roozenburg, I.; Voorbergen-Laarman, M.A.; van Tulden, P.W.; Kerkhoff, S.; van Nieuwstadt, A.P.; Davidse, A.; Haenen, O.L.M. Viral diseases of wild and farmed European eel Anguilla anguilla with particular reference to the Netherlands. Dis. Aquat. Org. 2012, 101, 69–86. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fichtner, D.; Philips, A.; Groth, M.; Schmidt-Posthaus, H.; Granzow, H.; Dauber, M.; Bergmann, S.M.; Schrudde, D.; Sauerbrei, A.; Zell, R. Characterization of a novel picornavirus isolate from a diseased European eel (Anguilla anguilla). J. Virol. 2013, 87, 1089–10899. [Google Scholar] [CrossRef] [Scilit]
- Heinsbroek, L.T.N. A review of eel culture in Japan and Europe. Aquac. Res. 2008, 22, 57–72. [Google Scholar] [CrossRef] [Scilit]
- Okamura, A.; Horie, N.; Mikawa, N.; Yamada, Y.; Tsukamoto, K. Recent advances in artificial production of glass eels for conservation of anguillid eel populations. Ecol. Freshw. Fish 2014, 23, 95–110. [Google Scholar] [CrossRef] [Scilit]
- Haenen, O. Major eel diseases in Europe: The past 30 years. In Eels Biology, Management, Monitoring, Culture and Exploitation: Proceedings of the First International Eel Science Symposium; Coulson, P., Don, A., Eds.; 5m Publishing: Sheffield, UK, 2019; p. 448. [Google Scholar]
- Sano, T. Viral diseases of cultured fishes in Japan. Fish Pathol. 1976, 10, 221–226. [Google Scholar] [CrossRef] [Scilit]
- Sano, T.; Nishimura, T.; Okamoto, N.; Fukuda, H. Studies on viral diseases of Japanese fishes 7. A rhabdovirus isolated from European eel, Anguilla anguilla. Bull. Jpn. Soc. Sci. Fish 1977, 43, 491–495. [Google Scholar] [CrossRef] [Scilit]
- Sano, M.; Fukuda, H.; Sano, T. Isolation and characterization of a new herpesvirus from eel. In Pathology in Marine Sciences; Perkins, F.O., Cheng, T.C., Eds.; Academic Press: San Diego, CA, USA, 1990; pp. 15–31. [Google Scholar]
- Castric, J.; Chastel, C. Isolation and characterization attempts of three viruses from European eel, Anguilla anguilla: Preliminary results. Ann. Inst. Pasteur. Virol. 1980, 131, 435–448. [Google Scholar] [CrossRef] [Scilit]
- Bucke, D. A note on IPNV from eels in the U.K. Bull. Eur. Assoc. Fish Pathol. 1981, 1, 12. [Google Scholar]
- Castric, J.; Rasschaert, D.; Bernard, J. Evidence of lyssaviruses among rhabdovirus isolates from the European eel Anguilla anguilla. Ann. Inst. Pasteur. Virol. 1984, 135, 35–55. [Google Scholar] [CrossRef] [Scilit]
- Chen, S.N.; Kou, G.H.; Hedrick, R.P.; Fryer, J.L. The occurrence of viral infections of fish in Taiwan. In Fish and Shellfish Pathology; Ellis, A.E., Ed.; Academic Press: London, UK, 1985; pp. 313–319. [Google Scholar]
- Shchelkunov, I.S.; Skurat, E.K.; Sivolotskaia, V.A.; Sapot’ko, K.V.; Shimko, V.V.; Linnik, Y. Rhabdovirus anguilla in eel in the USSR and its pathogenicity for fish. Vopr. Virusol. 1989, 34, 81–84. [Google Scholar]
- Haenen, O.L.M.; Dijkstra, S.G.; Tulden, P.W.; Davidse, A.; van Nieuwstadt, A.P.; Wagenaar, F.; Wellenberg, G.J. Herpesvirus anguillae (HVA) isolations from disease outbreaks in cultured European eel, Anguilla anguilla in the Netherlands since 1996. Bull. Eur. Assoc. Fish Pathol. 2002, 22, 247–257. [Google Scholar]
- Ahne, W.; Thomsen, I. The existence of three different viral agents in a tumour bearing European eel (Anguilla anguilla). Zent. Vet. Reihe B 1985, 32, 228–235. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Varvarigos, P.; Vendramin, N.; Cappellozza, E.; Bovo, G. First confirmation of herpesvirus anguillae (HVA) and infectious pancreatic necrosis (IPN) virus infecting European eel Anguilla anguilla farmed in Greece. Bull. Eur. Assoc. Fish Pathol. 2011, 31, 101–111. [Google Scholar]
- Hill, B.J.; Williams, R.F.; Smale, C.J.; Underwood, B.O.; Brown, F. Physicochemical and serological characterization of two rhabdoviruses isolated from eels. Intervirology 1980, 14, 208–212. [Google Scholar] [CrossRef] [Scilit]
- Jørgensen, P.; Castric, J.; Hill, B.; Ljungberg, O.; De Kinkelin, P. The occurrence of virus infections in elvers and eels (Anguilla anguilla) in Europe with particular reference to VHSV and IHNV. Aquaculture 1994, 123, 11–19. [Google Scholar] [CrossRef] [Scilit]
- Van Ginneken, V.; Van Ballieux, B.; Willemze, R.; Coldenhoff, K.; Lentjes, E.; Antonissen, E.; Haenen, O.; Van den Thillart, G. Hematology patterns of migrating European eels and the role of EVEX virus. Comp. Biochem. Physiol. C 2005, 140, 97–102. [Google Scholar] [CrossRef] [Scilit]
- Van Beurden, S.J.; Voorbergen-Laarman, M.A.; Roozenburg, I.; Boerlage, A.S.; Haenen, O.L.M.; Engelsma, M.Y. Development and validation of a two-step real-time RT-PCR for the detection of eel virus European X in European eel, Anguilla Anguilla. J. Virol. Methods 2011, 171, 352–359. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Act on Animal Protection in Research Purposes. Off. Gaz. 2013, 55, 1129.
- Ward, R.D.; Zemlak, T.S.; Ines, B.H.; Last, P.R.; Hebert, P.D.N. DNA barcoding Australia’s fish species. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2005, 360, 1847–1857. [Google Scholar] [CrossRef] [Scilit]
- Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [Scilit]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Scilit]
- Fijan, N.; Sulimanović, D.; Bearzotti, M.; Mužinić, D.; Zwillenberg, L.O.; Chilmonczyk, S.; Vautherot, J.F.; de Kinkelin, P. Some properties of the epithelioma papulosum cyprini (EPC) cell line from carp Cyprinus carpio. Ann. Inst. Pasteur. Virol. 1983, 134, 207–220. [Google Scholar] [CrossRef] [Scilit]
- Wolf, K.; Quimby, M.C. Established eurythermic line of fish cells. Science 1962, 135, 1065–1066. [Google Scholar] [CrossRef] [Scilit]
- Rijsewijk, F.; Pritz-Verschuren, S.; Kerkhoff, S.; Botter, A.; Willemsen, M.; van Nieuwstadt, T.; Haenen, O. Development of a polymerase chain reaction for the detection of Anguillid herpesvirus DNA in eels based on the herpesvirus DNA polymerase gene. J. Virol. Methods 2005, 124, 87–94. [Google Scholar] [CrossRef] [Scilit]
- Janssen, T.H.P.M. Aquabirnavirus of European Eel and Rainbow Trout. Master’s Thesis, Faculty of Veterinary Medicine, University of Utrecht, Utrecht, The Netherlands, 2013; p. 21. [Google Scholar]
- Kazutaka, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Scilit]
- Lanave, C.; Preparata, G.; Saccone, C.; Serio, G. A new method for calculating evolutionary substitution rates. J. Mol. Evol. 1984, 20, 86–93. [Google Scholar] [CrossRef] [Scilit]
- Shapiro, B.; Rambaut, A.; Drummond, A.J. Choosing appropriate substitution models for the phylogenetic analysis of protein-coding sequences. Mol. Biol. Evol. 2006, 23, 7–9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Drummond, A.J.; Ho, S.Y.W.; Phillips, M.J.; Rambaut, A. Relaxed phylogenetics and dating with confidence. PLoS Biol. 2006, 4, e88. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rannala, B.; Yang, Z. Probability distribution of molecular evolutionary trees: A new method of phylogenetic inference. J. Mol. Evol. 1996, 43, 304–311. [Google Scholar] [CrossRef] [PubMed]
- Baele, G.; Lemey, P.; Bedford, T.; Rambaut, A.; Suchard, M.A.; Alekseyenko, A.V. Improving the Accuracy of Demographic and Molecular Clock Model Comparison While Accommodating Phylogenetic Uncertainty. Mol. Biol. Evol. 2012, 29, 2157–2167. [Google Scholar] [CrossRef] [Scilit]
- Raftery, A.E.; Niu, X.; Hoff, P.D.; Yeung, K.Y. Fast Inference for the Latent Space Network Model Using a Case-Control Approximate Likelihood. J. Comput. Graph. Stat. 2012, 21, 901–919. [Google Scholar] [CrossRef] [Scilit]
- Drummond, A.J.; Suchard, M.A.; Xie, D.; Rambaut, A. Bayesian phylogenetics with BEAUti and the BEAST 1.7. Mol. Biol. Evol. 2012, 29, 1969–1973. [Google Scholar] [CrossRef] [Scilit]
- Dekker, W. Slipping through Our Hands: Population Dynamics of the European Eel. Ph.D. Thesis, Faculty of Science, University of Amsterdam, Amsterdam, The Netherlands, 2004. [Google Scholar]
- Basrur, T.V.; Longland, R.; Wilkinson, R.J. Effects of repeated crowding on the stress response and growth performance in Atlantic salmon (Salmo salar). Fish Physiol. Biochem. 2010, 36, 445–450. [Google Scholar] [CrossRef] [Scilit]
- Williams, C.; Cable, J.; James, J.; Britton, T. From detection to regulation—20 years of new and emerging diseases in freshwater fisheries. In Proceedings of the 19th EAFP International Conference on Diseases of Fish and Shellfish, Porto, Portugal, 9–12 September 2019; p. 342. [Google Scholar]
- McConville, J.; Fringuelli, E.; Evans, D.; Savage, P. First examination of the Lough Neagh European eel (Anguilla anguilla) population for eel virus European, eel virus European X and Anguillid Herpesvirus-1 infection by employing novel molecular techniques. J. Fish Dis. 2018, 41, 1783–1791. [Google Scholar] [CrossRef] [Scilit]
- Danne, L.; Horn, L.; Feldhaus, A.; Fey, D.; Emde, S.; Schütze, H.; Adamek, M.; Hellmann, J. Virus infections of the European Eel in North Rhine Westphalian rivers. J. Fish Dis. 2022, 45, 69–76. [Google Scholar] [CrossRef] [Scilit]
- Caruso, C.; Peletto, S.; Gustinelli, A.; Arsieni, P.; Mordenti, O.; Modesto, P.; Acutis, P.L.; Masoero, L.; Fioravanti, M.L.; Prearo, M. Detection of a phylogenetically divergent eel virus European X (EVEX) isolate in European eels (Anguilla anguilla) farmed in experimental tanks in Italy. Aquaculture 2014, 434, 115–120. [Google Scholar] [CrossRef] [Scilit]
- Stone, D.M.; Kerr, R.C.; Hughes, M.; Radford, A.D.; Darby, A.D. Characterisation of the genomes of four putative vesiculoviruses; tench rhabdovirus, grass carp rhabdovirus, perch rhabdovirus and eel rhabdovirus European X. Arch. Virol. 2013, 158, 2371–2377. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Galinier, R.; van Beurden, S.; Amilhat, E.; Castric, J.; Schoehn, G.; Verneau, O.; Fazio, G.; Allienne, J.F.; Engelsma, M.; Sasal, P.; et al. Complete genomic sequence and taxonomic position of eel virus European X (EVEX), a rhabdovirus of European eel. Virus Res. 2012, 166, 1–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bellec, L.; Bergmann, S.; de Boisséson, C.; Engelsma, M.; Haenen, O.; Morin, T.; Olesen, N.J.; Schuetze, H.; Toffan, A.; Way, K.; et al. Evolutionary dynamics and genetic diversity from three genes of Anguillid rhabdovirus. J. Gen. Virol. 2014, 95, 2390–2401. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stone, D.M. Comparison of the Complete Genome Sequence of Four Fish Vesiculoviruses. Unpublished Data. 2012. Available online: https://www.ncbi.nlm.nih.gov/nucleotide/JX827265.1?report=genbank&log$=nucltop&blast_rank=1&RID=PM4P1568016 (accessed on 30 September 2022).
- Meistertzheim, A.-L.; Galinier, R.; Morin, T.; Van Beurden, S.; Schutze, H.; Sasal, P.; Faliex, E. Direct Submission—Centre de Formation et de Recherche sur les Environnements Mediterraneens, CEFREM UMR 5110 CNRS; Universite de Perpignan Via Domitia: Perpignan, France, 2013. [Google Scholar]
- Meistertzheim, A.-L.; Galinier, R.; Morin, T.; Van Beurden, S.; Schutze, H.; Sasal, P.; Faliex, E. Phylogeny of Eel Virus American (EVA) and Eel Virus European X (EVEX), Two Fish Rhabdoviruses: Brother or Not? 2013; Unpublished. Available online: https://www.ncbi.nlm.nih.gov/nucleotide/KC608034.1?report=genbank&log$=nucltop&blast_rank=8&RID=PM4P1568016 (accessed on 30 September 2022).




| Sequence 5′–3′ | Amplicon Length (bp) | Annealing Temperature | |
|---|---|---|---|
| EVEX-N-F1 | GGCTATTCTTTAACAGACATCTG | 1559 | 50 °C |
| EVEX-N-R2 | CTTTTGCCAGCAATTGTATCCC | ||
| EVEX-P-F1 | GTGAGTTGAAGCAGRAATGARTC | 1223 | 50 °C |
| EVEX-P-R2 | GATTCTGTYTTCTTCCCCTTC | ||
| EVEX-M-F1 | GATGCCTTRAATTGGCTTGAC | 989 | 50 °C |
| EVEX-M-R2 | CTCRAAAYAATSGTGTATCACTG | ||
| EVEX-G-F1 | GGTGTTCAATCTTGATTCTG | 2088 | 46 °C |
| EVEX-G-R2 | CTTCGTCATACATGATGACTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zupičić, I.G.; Oraić, D.; Pavlinec, Ž.; Novosel, D.; Žuvić, L.; Šegvić-Bubić, T.; Zrnčić, S. Is the Illegal Trade of Glass Eels (Anguilla anguilla) Increasing the Spread of Disease? A Case of EVEX. Microorganisms 2022, 10, 2208. https://doi.org/10.3390/microorganisms10112208
Zupičić IG, Oraić D, Pavlinec Ž, Novosel D, Žuvić L, Šegvić-Bubić T, Zrnčić S. Is the Illegal Trade of Glass Eels (Anguilla anguilla) Increasing the Spread of Disease? A Case of EVEX. Microorganisms. 2022; 10(11):2208. https://doi.org/10.3390/microorganisms10112208
Chicago/Turabian StyleZupičić, Ivana Giovanna, Dražen Oraić, Željko Pavlinec, Dinko Novosel, Luka Žuvić, Tanja Šegvić-Bubić, and Snježana Zrnčić. 2022. "Is the Illegal Trade of Glass Eels (Anguilla anguilla) Increasing the Spread of Disease? A Case of EVEX" Microorganisms 10, no. 11: 2208. https://doi.org/10.3390/microorganisms10112208
APA StyleZupičić, I. G., Oraić, D., Pavlinec, Ž., Novosel, D., Žuvić, L., Šegvić-Bubić, T., & Zrnčić, S. (2022). Is the Illegal Trade of Glass Eels (Anguilla anguilla) Increasing the Spread of Disease? A Case of EVEX. Microorganisms, 10(11), 2208. https://doi.org/10.3390/microorganisms10112208

