Next Article in Journal
Microbial Quality of Leafy Greens Grown Under Soilless Production Systems
Previous Article in Journal
Oral Fluid Sampling in Group-Housed Sows: Field Observations
Previous Article in Special Issue
Uncovering Hidden Transmission: Active Surveillance Reveals Cryptic Circulation of Yellow Fever Virus in Urban Marmosets in Belo Horizonte, Brazil, 2024
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 14
Issue 9
10.3390/pathogens14090944
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

SFTSV Prevalence in Ticks and Livestock in an SFTSV-Endemic Area in Central China

by
Hui-Ya Lu
1,†,
Guan-Du Wu
1,†,
Meng Peng
2,†,
Li-Bang Wu
2,†,
Yi-Ming Luo
1,
Bin Xia
1,
Dan Xiong
2,
Xiang-Rong Qin
3,*,
Fang Guo
2,* and
Xue-Jie Yu
1,*
1
State Key Laboratory of Virology, School of Public Health, Wuhan University, Wuhan 430071, China
2
Suizhou City Disease Prevention and Control Center, Suizhou 441300, China
3
Department of Clinical Laboratory, The Second Qilu Hospital of Shandong University, Jinan 250000, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Pathogens 2025, 14(9), 944; https://doi.org/10.3390/pathogens14090944
Submission received: 20 July 2025 / Revised: 12 September 2025 / Accepted: 13 September 2025 / Published: 18 September 2025
(This article belongs to the Special Issue One Health—Viral Zoonosis: Epidemiology, Pathogenesis, Surveillance and Early Warning, Novel Prevention and Control Technologies)
Browse Figures
Versions Notes

Abstract

Severe fever with thrombocytopenia syndrome virus (SFTSV) is an emerging tick-borne bunyavirus that causes a severe viral hemorrhagic fever (SFTS), with a very high case mortality rate, expanding epidemic areas, and increasing incidence. Due to the lack of an effective drug or vaccine for SFTS, reducing the incidence and mortality of SFTS primarily relies on decreasing the density of ticks and the number of their host animals. However, which tick species and vertebrate animal serve as the major reservoir and animal host of SFTSV are not clearly understood. In May of 2023 and June of 2024, we collected 2437 ticks from domesticated animals and grassland in Suizhou City, a prefecture of Hubei Province in central China. A total of 195 domesticated animal blood samples were collected, including 152 goats, 26 cattle, and 17 dogs. Ticks were grouped for RNA extraction according to their life stages and feeding status. RNA from each animal’s blood and each group of ticks was extracted with an RNA extraction kit and tested for SFTSV with RT-PCR. Ticks were classified according to morphology, and representative ticks of each stage were confirmed with PCR amplification and DNA sequencing of the mitochondrial 16S RNA gene. Among the collected ticks, the majority were from goats (72.7%, 1772/2437), and Haemaphysalis longicornis was predominant, accounting for 99.47% (2425/2437), and other tick species were very rare, with 0.45% (11/2437) Rhipicephalus microplus, and 0.04% (1/2437) H. flava and Ixodes sinensis, respectively. We found SFTSV RNA in H. longicornis ticks with a minimum infection rate of 0.17% (4/2424) and in one goat (0.66%,1/152). In summary, we demonstrated that the H. longicornis tick is positive for SFTSV and that the goat is the major host of Haemaphysalis longicornis in Suizhou, central China. Our study suggests that controlling ticks on goats may play an important role in preventing SFTSV infection in China.
Keywords:
ticks; goats; SFTSV; China

1. Introduction

Ticks are obligate blood-feeding arthropods that can transmit pathogens to humans and animals through bites. In 2009, a severe viral hemorrhagic fever known as severe fever with thrombocytopenia syndrome (SFTS) was discovered in central China, which is caused by a tick-borne bunyavirus named after the disease, as sever fever with thrombocytopenia virus (SFTSV) [1]. The primary clinical symptoms of SFTS are fever, fatigue, muscle pain, thrombocytopenia, and leukopenia, with a case mortality rate ranging from 16 to 30% [1,2,3,4]. Currently, there are no effective drugs or vaccines for SFTS, and the primary approach is symptomatic treatment. SFTSV is a negative-sense, single-stranded RNA virus belonging to the genus Bandavirus in the Phenuiviridae family [1,5]. SFTSV is primary transmitted through tick bites, but can also be transmitted to humans from patients or infected animals such as cats, dogs, and mink [6,7,8,9] through mucous membranes or aerosol [10,11,12]. From 2010 to 2021, a total of 18,968 SFTS cases were reported in 27 provinces of China, with the number of cases increasing yearly and endemic areas continuing to expand [13]. Most of the SFTS cases (99.3%) have been concentrated in the hilly and mountainous forest areas of central China (Henan, Shandong, Anhui, Hubei, and Jiangsu) [14], and it has also been reported in South Korea, Japan, and Southeast Asian countries [15,16,17,18,19,20]. The hard tick Haemaphysalis longicornis has been demonstrated as a vector and reservoir of SFTSV, and it is the most abundant tick species collected in endemic areas in East China and South Korea [21,22,23,24]. The central region of China was the first to discover SFTSV and is also the area most severely affected by SFTSV [1,13]. However, we are not clear about the tick species and the major vector of SFTSV in central China. The aim of this study was to investigate tick species and the prevalence of SFTSV in ticks and domesticated animals in Suizhou City, Hubei Province, in central China. Suizhou City is an SFTS endemic area [25], with 277 and 248 cases in 2023 and 2024, respectively, according to surveillance data from the Chinese Center for Disease Control and Prevention.

2. Materials and Methods

2.1. Sample Collection Sites

Suizhou City (31°19′ N to 32°26′ N, 112°43′ E to 113°46′ E) is a prefecture-level city located in northern Hubei Province in central China (Figure 1). The landscape of Suizhou City is dominated by low mountains, hills, and alluvial plains. Suizhou has a monsoon climate, with distinct seasons, abundant rainfall, and an average annual precipitation of 865 to 1070 mm across most regions. The region is rich in vegetation, with over 50% forest coverage, including subtropical evergreen broadleaf forests and deciduous broadleaf forests.

2.2. Animal Blood and Tick Collection

In May of 2023 and June of 2024, we collected questing ticks on grasslands and feeding ticks from goats, dogs, and cattle in rural areas in eight towns in Suizhou City, Hubei Province (Figure 1). The towns included Gaocheng, Wanhedo, Yindian, Wushan, Xiaolin, Hedian, Xihe, and rural areas under the jurisdiction of Beijiao Street. Sampling was conducted within a 5 km radius around residences of reported SFTS cases.
Questing ticks were collected by flagging grasses near farms and feeding ticks were collected from goats, cattle, and dogs with tweezers. According to the number of parasitic ticks on each host, 20 to 40 parasitic ticks were collected from different parasitic sites on each animal. Ticks from each animal were placed in an EP tube with breathable film to cover the punched holes in the top of the tube and prevent ticks escaping. Tick sample collection information is listed in Table 1.
Five milliliters of jugular blood was obtained from each animal by veterinarians, placed in an EDTA tube, and stored at −80 °C. A total of 195 domesticated animal blood samples were collected, of which 77.95% (152/195) were from goats, 13.33% (26/195) were from cattle, and 8.72% (17/195) were from dogs.

2.3. Nucleic Acid Extraction

Ticks were soaked in 75% ethanol and then in sterilized ultrapure water for 5 min each, washing three times to remove residual ethanol. Each group of ticks was flash-frozen in liquid nitrogen for 5 min in a 2 mL centrifuge tube; 200 μL of sterilized ultrapure water, 200 μL of proteinase K, and sterilized grinding beads were added; and the sample was ground using a cryogenic grinder (parameters: 25 Hz, 5–10 min) until completely lysed. To each tube was added 200 μL of anhydrous ethanol, vortexing for 30 s and centrifuging at 12,000× g for 5 min. The supernatant was used to extract nucleic acids with a DNA extraction kit (Beijing Tsingke Biotech Co., Ltd., Beijing, China) or an RNA extraction kit (Servicebio, Wuhan, China).

2.4. Tick Identification and Grouping

Ticks were classified according to morphology and representative ticks of each stage were confirmed with PCR amplification and DNA sequencing of the mitochondrial 16S RNA gene [21,26,27,28]. Ticks were grouped for RNA extraction according to their life stages and feeding status. The pooling strategy was designed based on the biological characteristics and feeding status of the ticks, aiming to balance detection sensitivity with practical feasibility. For feeding ticks, we used smaller pool sizes (1 engorged tick or 2–3 partially fed ticks), as because of their large body size, using individual or small pools for these specimens may reduce the risk of false negatives caused by dilution effects. For unfed ticks, we employed larger pool sizes (10–15 females, 15–20 males, or 30–40 larvae/nymphs) due to the small size of their bodies.

2.5. PCR and RT-PCR

The tick mitochondrial 16S rRNA gene was amplified using the PCR primers in Table 1, following a previously described protocol [21]. All PCR primers used in this study were synthesized by SinoBioscience (Shanghai, China). Ticks and animal blood RNA were reverse transcribed using the NovoScript® Plus All-in-One 1st Strand cDNA Synthesis SuperMix (gDNA Purge) (Proxima Protein Technology, Suzhou, Jiangsu, China). Tick and animal cDNA were amplified with nested PCR for SFTSV L, M, and S segments, respectively. The PCR protocol was as follows: initial denaturation at 95 °C for 3 min; denaturation at 95 °C for 30 s; annealing for 30 s, with the annealing temperature for each pair of primers in Table 1; extension at 72 °C for 40 s, repeated for 35 cycles; and final extension at 72 °C for 10 min. The PCR primers are listed in Table 2.
The PCR product was separated with agarose gel electrophoresis, purified with a DNA gel extraction kit (Beijing Qikeweitech Co., Ltd., Beijing, China), cloned into the pMD 19-T vector (Takara Corporation), and transformed into DH5α competent cells. Positive clones were sequenced bidirectionally (Shenggong Biotechnology, Shanghai, China). The DNA sequences were assembled with the SeqMan Pro program in DNASTAR (7.0) software by removing the primer sequences, and they were compared with published sequences using BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) accessed on 14 August 2025. Selected sequences were analyzed with MEGA 12.0 software for phylogenetic analysis and phylogenetic trees were constructed using the maximum likelihood method based on the Kimura 2-parameter model.

3. Results

3.1. Tick Species in Suizhou City

We collected 2437 ticks, with the majority obtained from goats (72.7%, 1772/2437). Haemaphysalis longicornis accounted for 99.47% (2425/2437), Rhipicephalus microplus accounted for 0.45% (11/2437), and H. flava and Ixodes sinensis accounted for only 0.04% (1/2437), respectively.

3.2. Prevalence of SFTSV in Ticks and Animals from Suizhou City

The PCR results showed that one goat blood was positive for SFTSV S segment, four H. longicornis tick samples from goats were positive with the M segment, and one of them was also positive for the L segments. The positivity rate of SFTSV in goats was 0.66% (1/152), while the minimum infection rate of ticks (number of positive tick pools/total number of ticks) was 0.17% (4/2424) (Table 3). SFTSV was not detected in R. microplus, Ixodes sinensis, Haemaphysalis flava, cattle blood samples, or dog blood samples.

3.3. Phylogenetic Analysis of SFTSV from Ticks and Goats in Suizhou City

The SFTSV sequences from ticks and goats were deposited in the GenBank with accession numbers of PX242194-PX242195 and PX349239-PX349242. DNA sequence analysis indicated that the S segment gene sequence (G23, PX242194) from one goat in this study was closely related (98.93% homology) to the sequence (KF791952.1) from a H. longicornis tick from Beijing, next to the sequence (OR915871.1) from a patient in Jiangsu Province with a nucleotide homology of 97.69% (Figure 2). In the phylogenetic tree, the SFTSV M segment sequences of T9 (PX349240) and T24 (PX349242) from ticks were 99.01% homology and were located on the same branch with an M segment (OM451812.1) from a patient in Henan Province, the M segments (MZ773032.1, OR915872.1) from patients in Zhejiang and Jiangxi provinces (Figure 3). The homology between gene sequences T58 (PX349239) and T50 (PX349241) was 98.51%, and they were closely related to the SFTSV M segments from a goat and a hedgehog in Jiangsu Province (KC473538.1, OP899817.1) (Figure 3).
One tick (T24) was positive for SFTSV, with both the M segment and L segment. The L segment sequence (PX242195) was closely related to SFTSV strains from a patient and a H. longicornis tick from Beijing (MN509848.2 and OR915873.1) (Figure 4), with nucleotide homologies of 99.10% and 99.10%, respectively.

4. Discussion

Studies in eastern China and South Korea have proven that H. longicornis is the primary vector of SFTSV [21,22,23,24]; however, the vectors of SFTSV in central and western China and Southeast Asia are largely uninvestigated. In this study, we collected questing and feeding ticks in grasslands and domesticated animals in Suizhou City, an SFTSV endemic area in Hubei Province in central China. Four types of ticks were collected, including H. longiconis, H. flava, R. microplus, and Ixodes sinensis, with H. longiconis as the major tick species (99.47%). Most feeding ticks (96.20%, 1772/1842) were obtained from goats. We investigated the prevalence of SFTSV in ticks and livestock collected in Suizhou City. The infection rate of SFTSV in ticks (0.17%) from Suizhou City was consistent with previous studies from China and South Korea [21,23]. A study from an unspecified location in Hubei Province indicated that H. longicornis was negative for SFTSV [30]. Another study in Hubei found that the SFTSV infection rate of Haemaphysalis longicornis was 0.07% (3/4595) [25]. A study in Shandong Province showed that the infection rate of SFTSV in H. longicornis was 0.2% (8/3300) [21]. SFTSV has been found in several ticks species, including H. longicornis, H. flava, H. concinna, Rhipicephalus microplus, and R. sanguinensis [1,21,31,32,33,34]. Among these tick species, H. longicornis and H. flava have been demonstrated to be a reservoir and vector of SFTSV [21,32]. We did not found SFTSV in H. flava, R. microplus, or Ixodes sinensis, possibly due to small sample size of these tick species.
Our study demonstrated that H. longiconis is the primary tick species in central China, which is consistent with previous studies performed in East China and South Korea [21,23,24]. A large scale tick collection (27,029 ticks) from April to October in 2013, in South Korea, showed that H. longiconis was the primary tick species (64.76%) with H. flava second (29.22%) [35]. A year round study of ticks in South Korea demonstrated that among the 10,343 ticks collected from wild animals, H. longicornis constituted the majority (65.5%), followed by H. flava (33.8%) [23]. The prevalence of SFTSV-positive H. longicornis ticks peaked during the summer months and H. flava exhibited a higher prevalence during the winter season [23]. These studies indicated that both H. longicornis and H. flava are reservoirs of SFTSV in East Asia, but H. longicornis may be the more important vector for transmission of SFTSV because its peak activity aligns with agricultural planting times. Haemaphysalis flava has been reported on migratory birds [36,37], indicating H. flava may play a role in long distance transmission of SFTSV. Haemaphysalis longicornis has bisexual and parthenogenetic populations, and both populations are effective in transmission of SFTSV [21,38]. Haemaphysalis longicornis not only exists in East Asia, but has also spread to Australia, New Zealand, and the United States [39,40,41]. Metagenome sequence analysis of Haemaphysalis longicornis from China showed the tick harbored 48 virus species, with 22 novel viruses [42,43,44]. Haemaphysalis longicornis poses a risk of pathogen spillover due to its broad host range and ability to reproduce parthenogenetically [45].
A limitation of this study is that it focused only on endemic areas, without including non-endemic areas, making it difficult to infer regional risks or ecological patterns.

5. Conclusions

We found SFTSV in H. longicornis ticks and goats from Suizhou City, Hubei Provence, China. In SFTSV-endemic areas, H. longicornis tick is the primary tick species and goats are the main animal hosts for the H. longicornis tick, suggesting control of ticks on goats may play an important role in preventing SFTSV infection.

Author Contributions

Conceptualization, F.G. and X.-J.Y.; Data curation, G.-D.W., Y.-M.L., and B.X.; Formal analysis, H.-Y.L. and L.-B.W.; Funding acquisition, M.P. and X.-R.Q.; Investigation, B.X., D.X. and F.G.; Methodology, H.-Y.L. and G.-D.W.; Writing—original draft, H.-Y.L. and X.-J.Y.; Writing—review and editing, X.-J.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the National Natural Science Foundation of China (grant number 32470155 to XJY) and the Natural Science Foundation of Shandong Province of China (ZR2021QC212 to XRQ). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and approved by the Ethics Committee of the Medical School, Wuhan University (protocol code 2018010 and approved on 3 July 2018).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The original contributions presented in the study are included in the article, further in-queries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Yu, X.J.; Liang, M.F.; Zhang, S.Y.; Liu, Y.; Li, J.D.; Sun, Y.L.; Zhang, L.; Zhang, Q.F.; Popov, V.L.; Li, C.; et al. Fever with thrombocytopenia associated with a novel bunyavirus in China. N. Engl. J. Med. 2011, 364, 1523–1532. [Google Scholar] [CrossRef]
  2. Li, H.; Lu, Q.B.; Xing, B.; Zhang, S.F.; Liu, K.; Du, J.; Li, X.K.; Cui, N.; Yang, Z.D.; Wang, L.Y.; et al. Epidemiological and clinical features of laboratory-diagnosed severe fever with thrombocytopenia syndrome in China, 2011-17: A prospective observational study. Lancet Infect. Dis. 2018, 18, 1127–1137. [Google Scholar] [CrossRef]
  3. Yu, X.-j. Risk factors for death in severe fever with thrombocytopenia syndrome. Lancet Infect. Dis. 2018, 18, 1056–1057. [Google Scholar] [CrossRef]
  4. Fang, L.Z.; Dong, Y.H.; Yan, Z.J.; Zhou, C.M.; Yu, X.J.; Qin, X.R. Reactivation of Epstein-Barr virus in SFTSV infected patients. Infect. Med. 2023, 2, 195–201. [Google Scholar] [CrossRef]
  5. Kuhn, J.H.; Adkins, S.; Alioto, D.; Alkhovsky, S.V.; Amarasinghe, G.K.; Anthony, S.J.; Avšič-Županc, T.; Ayllón, M.A.; Bahl, J.; Balkema-Buschmann, A. 2020 taxonomic update for phylum Negarnaviricota (Riboviria: Orthornavirae), including the large orders Bunyavirales and Mononegavirales. Arch. Virol. 2020, 165, 3023–3072. [Google Scholar] [CrossRef]
  6. Bao, C.; Qi, X.; Wang, H. A novel bunyavirus in China. N. Engl. J. Med. 2011, 365, 862–863. [Google Scholar]
  7. Liu, Y.; Li, Q.; Hu, W.; Wu, J.; Wang, Y.; Mei, L.; Walker, D.H.; Ren, J.; Wang, Y.; Yu, X.-J. Person-to-person transmission of severe fever with thrombocytopenia syndrome virus. Vector-Borne Zoonotic Dis. 2012, 12, 156–160. [Google Scholar] [CrossRef]
  8. Kida, K.; Matsuoka, Y.; Shimoda, T.; Matsuoka, H.; Yamada, H.; Saito, T.; Imataki, O.; Kadowaki, N.; Noguchi, K.; Maeda, K. A case of cat-to-human transmission of severe fever with thrombocytopenia syndrome virus. Jpn. J. Infect. Dis. 2019, 72, 356–358. [Google Scholar] [CrossRef] [PubMed]
  9. Li, J.; Wang, C.; Li, X.; Zhang, G.; Sun, S.; Wang, Z.; Zhao, J.; Xiu, L.; Jiang, N.; Zhang, H.; et al. Direct transmission of severe fever with thrombocytopenia syndrome virus from farm-raised fur animals to workers in Weihai, China. Virol. J. 2024, 21, 113. [Google Scholar] [CrossRef] [PubMed]
  10. Zhou, C.-M.; Qi, R.; Qin, X.-R.; Fang, L.-Z.; Han, H.-J.; Lei, X.-Y.; Yu, X.-J. Oral and ocular transmission of severe fever with thrombocytopenia syndrome virus. Infect. Med. 2022, 1, 2–6. [Google Scholar] [CrossRef] [PubMed]
  11. Gong, Z.; Gu, S.; Zhang, Y.; Sun, J.; Wu, X.; Ling, F.; Shi, W.; Zhang, P.; Li, D.; Mao, H. Probable aerosol transmission of severe fever with thrombocytopenia syndrome virus in southeastern China. Clin. Microbiol. Infect. 2015, 21, 1115–1120. [Google Scholar] [CrossRef]
  12. Wei, X.; Li, S.; Lu, Y.; Qiu, L.; Xu, N.; Guo, X.; Chen, M.; Liang, H.; Cheng, D.; Zhao, L.; et al. Severe fever with thrombocytopenia syndrome virus aerosol infection in C57/BL6 mice. Virology 2023, 581, 58–62. [Google Scholar] [CrossRef]
  13. Yue, Y.; Ren, D.; Lu, L. Epidemiological characteristics of severe fever with thrombocytopenia syndrome in China, 2010–2021. Dis. Surveill. 2024, 39, 824–830. [Google Scholar] [CrossRef]
  14. Huang, X.; Li, J.; Li, A.; Wang, S.; Li, D. Epidemiological Characteristics of Severe Fever with Thrombocytopenia Syndrome from 2010 to 2019 in Mainland China. Int. J. Environ. Res. Public Health 2021, 18, 3902. [Google Scholar] [CrossRef] [PubMed]
  15. Li, J.-C.; Zhao, J.; Li, H.; Fang, L.-Q.; Liu, W. Epidemiology, clinical characteristics, and treatment of severe fever with thrombocytopenia syndrome. Infect. Med. 2022, 1, 40–49. [Google Scholar] [CrossRef]
  16. Sato, Y.; Mekata, H.; Sudaryatma, P.E.; Kirino, Y.; Yamamoto, S.; Ando, S.; Sugimoto, T.; Okabayashi, T. Isolation of severe fever with thrombocytopenia syndrome virus from various tick species in area with human severe fever with thrombocytopenia syndrome cases. Vector-Borne Zoonotic Dis. 2021, 21, 378–384. [Google Scholar] [CrossRef] [PubMed]
  17. Kim, K.-H.; Yi, J.; Kim, G.; Choi, S.J.; Jun, K.I.; Kim, N.-H.; Choe, P.G.; Kim, N.-J.; Lee, J.-K.; Oh, M.-d. Severe fever with thrombocytopenia syndrome, South Korea, 2012. Emerg. Infect. Dis. 2013, 19, 1892. [Google Scholar] [CrossRef]
  18. Ongkittikul, S.; Watanawong, R.; Rompho, P. Severe fever with thrombocytopenia syndrome virus: The first case report in Thailand. Bangk. Med. J. 2020, 16, 204. [Google Scholar]
  19. Tran, X.C.; Yun, Y.; Kim, S.-H.; Thao, N.T.P.; Man, P.K.C.; Yoo, J.R.; Heo, S.T.; Cho, N.-H.; Lee, K.H. Endemic severe fever with thrombocytopenia syndrome, Vietnam. Emerg. Infect. Dis. 2019, 25, 1029. [Google Scholar] [CrossRef]
  20. Win, A.M.; Nguyen, Y.T.H.; Kim, Y.; Ha, N.Y.; Kang, J.G.; Kim, H.; San, B.; Kyaw, O.; Htike, W.W.; Choi, D.O.; et al. Genotypic Heterogeneity of Orientia tsutsugamushi in Scrub Typhus Patients and Thrombocytopenia Syndrome Co-infection, Myanmar. Emerg. Infect. Dis. 2020, 26, 1878–1881. [Google Scholar] [CrossRef]
  21. Luo, L.-M.; Zhao, L.; Wen, H.-L.; Zhang, Z.-T.; Liu, J.-W.; Fang, L.-Z.; Xue, Z.-F.; Ma, D.-Q.; Zhang, X.-S.; Ding, S.-J. Haemaphysalis longicornis ticks as reservoir and vector of severe fever with thrombocytopenia syndrome virus in China. Emerg. Infect. Dis. 2015, 21, 1770. [Google Scholar] [CrossRef]
  22. Wang, S.; Li, J.; Niu, G.; Wang, X.; Ding, S.; Jiang, X.; Li, C.; Zhang, Q.; Liang, M.; Bi, Z.; et al. SFTS virus in ticks in an endemic area of China. Am. J. Trop. Med. Hyg. 2015, 92, 684–689. [Google Scholar] [CrossRef]
  23. Jang, H.; Casel, M.A.B.; Jang, S.g.; Choi, J.H.; Gil, J.; Rollon, R.; Cheun, S.; Kim, Y.I.; Song, M.S.; Choi, Y.K. Seasonal dynamics of Haemaphysalis tick species as SFTSV vectors in South Korea. Microbiol. Spectr. 2024, 12, e0048924. [Google Scholar] [CrossRef]
  24. Li, Z.; Bao, C.; Hu, J.; Liu, W.; Wang, X.; Zhang, L.; Ji, Z.; Feng, Z.; Li, L.; Shen, A.; et al. Ecology of the Tick-Borne Phlebovirus Causing Severe Fever with Thrombocytopenia Syndrome in an Endemic Area of China. PLoS Negl. Trop. Dis. 2016, 10, e0004574. [Google Scholar] [CrossRef]
  25. Yang, L.E.; Zhao, Z.; Hou, G.; Zhang, C.; Liu, J.; Xu, L.; Li, W.; Tan, Z.; Tu, C.; He, B. Genomes and seroprevalence of severe fever with thrombocytopenia syndrome virus and Nairobi sheep disease virus in Haemaphysalis longicornis ticks and goats in Hubei, China. Virology 2019, 529, 234–245. [Google Scholar] [CrossRef]
  26. Intirach, J.; Lv, X.; Han, Q.; Lv, Z.-Y.; Chen, T. Morphological and molecular identification of hard ticks in Hainan Island, China. Genes 2023, 14, 1592. [Google Scholar] [CrossRef] [PubMed]
  27. Wu, G.; Zhou, X.; Guo, F.; Xu, J.; Song, J.; Jin, Z.; Cao, H.; Tang, J.; Lu, H.; Jiang, Z.; et al. Babesia infection in cattle and dogs in Suizhou City, Hubei Province, China. Infect. Med. 2025, 4, 100170. [Google Scholar] [CrossRef]
  28. Roy, B.C.; Estrada-Peña, A.; Krücken, J.; Rehman, A.; Nijhof, A.M. Morphological and phylogenetic analyses of Rhipicephalus microplus ticks from Bangladesh, Pakistan and Myanmar. Ticks Tick Borne Dis. 2018, 9, 1069–1079. [Google Scholar] [CrossRef]
  29. Gu, X.L.; Su, W.Q.; Zhou, C.M.; Fang, L.Z.; Zhu, K.; Ma, D.Q.; Jiang, F.C.; Li, Z.M.; Li, D.; Duan, S.H.; et al. SFTSV infection in rodents and their ectoparasitic chiggers. PLoS Negl. Trop. Dis. 2022, 16, e0010698. [Google Scholar] [CrossRef] [PubMed]
  30. Luo, Y.; Liu, L.; Huang, X.; Xu, J.; Liu, M.; Li, F.; Guan, X.; Tong, Y.; Wu, Y. Epidemiological investigation of an epidemic of severe fever with thrombocytopenia syndrome in a county in Hubei, 2023. Dis. Surveill. 2024, 39, 1085–1089. [Google Scholar] [CrossRef]
  31. Meng, K.; Sun, W.; Cheng, Z.; Guo, H.; Liu, J.; Chai, T. First detection of severe fever with thrombocytopenia syndrome virus in the tick species Haemaphysalis concinna in Shandong Province, China. Parasitol. Res. 2015, 114, 4703–4707. [Google Scholar] [CrossRef]
  32. Fang, L.-Z.; Xiao, X.; Lei, S.-C.; Liu, J.-W.; Yu, X.-J. Haemaphysalis flava ticks as a competent vector of severe fever with thrombocytopenia syndrome virus. Ticks Tick-Borne Dis. 2023, 14, 102100. [Google Scholar] [CrossRef] [PubMed]
  33. Li, J.; Kelly, P.; Guo, W.; Zhang, J.; Yang, Y.; Liu, W.; Wang, C. Molecular detection of Rickettsia, Hepatozoon, Ehrlichia and SFTSV in goat ticks. Vet. Parasitol. Reg. Stud. Rep. 2020, 20, 100407. [Google Scholar] [CrossRef]
  34. Hu, Y.-Y.; Zhuang, L.; Liu, K.; Sun, Y.; Dai, K.; Zhang, X.-A.; Zhang, P.-H.; Feng, Z.-C.; Li, H.; Liu, W. Role of three tick species in the maintenance and transmission of severe fever with thrombocytopenia syndrome virus. PLoS Negl. Trop. Dis. 2020, 14, e0008368. [Google Scholar] [CrossRef] [PubMed]
  35. Takhampunya, R.; Kim, H.C.; Chong, S.T.; Korkusol, A.; Tippayachai, B.; Davidson, S.A.; Petersen, J.M.; Klein, T.A. Francisella-Like Endosymbiont Detected in Haemaphysalis Ticks (Acari: Ixodidae) From the Republic of Korea. J. Med. Entomol. 2017, 54, 1735–1742. [Google Scholar] [CrossRef]
  36. Hasle, G. Transport of ixodid ticks and tick-borne pathogens by migratory birds. Front. Cell. Infect. Microbiol. 2013, 3, 48. [Google Scholar] [CrossRef]
  37. Seo, H.J.; Noh, J.; Kim, H.C.; Chong, S.T.; Klein, T.A.; Park, C.U.; Choi, C.Y.; Kwon, Y.S.; Kim, M.; Min, S.; et al. Molecular Detection and Phylogenetic Analysis of Anaplasma and Borrelia Species in Ticks Collected from Migratory Birds at Heuksan, Hong, and Nan Islands, Republic of Korea. Vector Borne Zoonotic Dis. 2021, 21, 20–31. [Google Scholar] [CrossRef]
  38. Zhao, C.; Cai, G.; Zhang, X.; Liu, X.; Wang, P.; Zheng, A. Comparative Analysis of Bisexual and Parthenogenetic Populations in Haemaphysalis Longicornis. Microorganisms 2024, 12, 823. [Google Scholar] [CrossRef]
  39. Heath, A. Biology, ecology and distribution of the tick, Haemaphysalis longicornis Neumann (Acari: Ixodidae) in New Zealand. N. Z. Vet. J. 2016, 64, 10–20. [Google Scholar] [CrossRef]
  40. Price, K.J.; Witmier, B.J.; Eckert, R.A.; Boyer, C.N.; Helwig, M.W.; Kyle, A.D. Distribution and Density of Haemaphysalis longicornis (Acari: Ixodidae) on Public Lands in Pennsylvania, United States. J. Med. Entomol. 2021, 58, 1433–1438. [Google Scholar] [CrossRef] [PubMed]
  41. Yabsley, M.J.; Thompson, A.T. Haemaphysalis longicornis (Asian longhorned tick). Trends Parasitol. 2023, 39, 305–306. [Google Scholar] [CrossRef] [PubMed]
  42. Jia, N.; Wang, J.; Shi, W.; Du, L.; Ye, R.-Z.; Zhao, F.; Cao, W.-C. Haemaphysalis longicornis. Trends Genet. 2021, 37, 292–293. [Google Scholar] [CrossRef]
  43. Ni, X.B.; Cui, X.M.; Liu, J.Y.; Ye, R.Z.; Wu, Y.Q.; Jiang, J.F.; Sun, Y.; Wang, Q.; Shum, M.H.; Chang, Q.C.; et al. Metavirome of 31 tick species provides a compendium of 1,801 RNA virus genomes. Nat. Microbiol. 2023, 8, 162–173. [Google Scholar] [CrossRef]
  44. Ye, R.Z.; Li, Y.Y.; Xu, D.L.; Wang, B.H.; Wang, X.Y.; Zhang, M.Z.; Wang, N.; Gao, W.Y.; Li, C.; Han, X.Y.; et al. Virome diversity shaped by genetic evolution and ecological landscape of Haemaphysalis longicornis. Microbiome 2024, 12, 35. [Google Scholar] [CrossRef] [PubMed]
  45. Gregory, N.; Fernandez, M.P.; Diuk-Wasser, M. Risk of tick-borne pathogen spillover into urban yards in New York City. Parasites Vectors 2022, 15, 288. [Google Scholar] [CrossRef] [PubMed]
Pathogens 14 00944 g001
Figure 1. Sampling sites in Suizhou City, Hubei Province.
Figure 1. Sampling sites in Suizhou City, Hubei Province.
Pathogens 14 00944 g001
Pathogens 14 00944 g002
Figure 2. Phylogenetic tree of SFTSV S segment. G23 is the S segment sequence of SFTSV obtained from a goat blood sample in this study.
Figure 2. Phylogenetic tree of SFTSV S segment. G23 is the S segment sequence of SFTSV obtained from a goat blood sample in this study.
Pathogens 14 00944 g002
Pathogens 14 00944 g003
Figure 3. Phylogenetic tree of SFTSV M segment. Note: T9, T24, T50, and T58 are SFTSV M segment sequences obtained from ticks in this study.
Figure 3. Phylogenetic tree of SFTSV M segment. Note: T9, T24, T50, and T58 are SFTSV M segment sequences obtained from ticks in this study.
Pathogens 14 00944 g003
Pathogens 14 00944 g004
Figure 4. Phylogenetic tree of SFTSV L. Note: T24 refers to the SFTSV L segment sequence obtained from a tick in this study.
Figure 4. Phylogenetic tree of SFTSV L. Note: T24 refers to the SFTSV L segment sequence obtained from a tick in this study.
Pathogens 14 00944 g004
Table 1. Tick sample collection information.
Table 1. Tick sample collection information.
Source of TicksAdult Female TicksAdult Male TicksNymphsLarvaeTotal
Free-living tick2035630531595
Parasitic ticksGoats1248328183131772
Dogs4260048
Cattle787022
Total1500398495442437
Table 2. Primer information and PCR annealing temperature.
Table 2. Primer information and PCR annealing temperature.
Tick and SFTSVPrimerPrimer SequencesTEM
(°C) 		Size (bp)Reference
Tick mitochondrialFAGTATTTTGACTATACAAAGGTATTG55402
16S RNARGTAGGATTTTAAAAGTTGAACAAACTT
SFTSVOut-FCAGCCAGTTTACCCGAACAT57679[20]
S segmentOut-RGAAAGACGCAAAGGAGT
In-FTGGCTCCGCGCATCTTCACA57560
In-RTGGCTCCGCGCATCTTCACA
SFTSVOut-FGRCATCTGARGCCAARTGYA50335This study
M segmentOut-RRACRTGKATWGCTRYTTTYCC
In-FAARCCYGGRGAAGTYGTWGT50278
In-RCRACYARYGAYCCWGARTGGA
SFTSVOut-FAATGATGCCAAGAAGTGGAAT52855[29]
L segmentOut-RATGTAAGCATAGTCCTAGAAGC
In-FCCACAGATTCATTTGGGCT55367
In-RATCATGATCGCTGAGTCGTC
Note: TEM, annealing temperature.
Table 3. Prevalence of SFTSV in samples collected in Suizhou, Hubei, China.
Table 3. Prevalence of SFTSV in samples collected in Suizhou, Hubei, China.
HostInfection Rate
Haemaphysalis longicornis0.17% (4/2424)
Goats’ blood samples0.66% (1/152)
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lu, H.-Y.; Wu, G.-D.; Peng, M.; Wu, L.-B.; Luo, Y.-M.; Xia, B.; Xiong, D.; Qin, X.-R.; Guo, F.; Yu, X.-J. SFTSV Prevalence in Ticks and Livestock in an SFTSV-Endemic Area in Central China. Pathogens 2025, 14, 944. https://doi.org/10.3390/pathogens14090944

AMA Style

Lu H-Y, Wu G-D, Peng M, Wu L-B, Luo Y-M, Xia B, Xiong D, Qin X-R, Guo F, Yu X-J. SFTSV Prevalence in Ticks and Livestock in an SFTSV-Endemic Area in Central China. Pathogens. 2025; 14(9):944. https://doi.org/10.3390/pathogens14090944

Chicago/Turabian Style

Lu, Hui-Ya, Guan-Du Wu, Meng Peng, Li-Bang Wu, Yi-Ming Luo, Bin Xia, Dan Xiong, Xiang-Rong Qin, Fang Guo, and Xue-Jie Yu. 2025. "SFTSV Prevalence in Ticks and Livestock in an SFTSV-Endemic Area in Central China" Pathogens 14, no. 9: 944. https://doi.org/10.3390/pathogens14090944

APA Style

Lu, H.-Y., Wu, G.-D., Peng, M., Wu, L.-B., Luo, Y.-M., Xia, B., Xiong, D., Qin, X.-R., Guo, F., & Yu, X.-J. (2025). SFTSV Prevalence in Ticks and Livestock in an SFTSV-Endemic Area in Central China. Pathogens, 14(9), 944. https://doi.org/10.3390/pathogens14090944

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop