Next Article in Journal
Monitoring Multiple Sexually Transmitted Pathogens Through Wastewater Surveillance
Previous Article in Journal
Effect of Grape Pomace Inclusion in the Diet of Ewes Naturally Infected with Gastrointestinal Nematodes During Lactation
Previous Article in Special Issue
The First Molecular Detection of Theileria luwenshuni from Haemaphysalis mageshimaensis on Orchid Island, Taiwan, with No Evidence of SFTSV
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 14
Issue 6
10.3390/pathogens14060561
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Tick Species Identification and Zoonotic Bacteria Detection from Healthcare-Extracted Specimens from Humans in the Basque Country, Northern Iberian Peninsula

by
Patirke Ibarrondo-Mendiola
1,
Patricia Vázquez
1,
Miriam Alkorta
2,
Cristina Zugazaga
3,4,
Ana L. García-Pérez
1,
Jesús F. Barandika
1 and
Aitor Cevidanes
1,*
1
Department of Animal Health, NEIKER—Basque Institute for Agricultural Research and Development, Basque Research and Technology Alliance (BRTA), 48160 Derio, Spain
2
Department of Microbiology, Donostia University Hospital, 20014 Donostia-San Sebastián, Spain
3
Department of Microbiology, Basurto University Hospital, 48013 Bilbao, Spain
4
BioCruces Health Research Institute, 48903 Barakaldo, Spain
*
Author to whom correspondence should be addressed.
Pathogens 2025, 14(6), 561; https://doi.org/10.3390/pathogens14060561
Submission received: 30 April 2025 / Revised: 30 May 2025 / Accepted: 3 June 2025 / Published: 4 June 2025
(This article belongs to the Special Issue Ticks and Tick-Borne Pathogens in a Changing World)
Browse Figure
Versions Notes

Abstract

Hard ticks are vectors of a wide range of pathogens, with tick-borne bacteria being among the most frequently detected. This study presents a first approach to the identification of human-biting ticks in the Basque Country (northern Iberian Peninsula), where previous research has mainly focused on ticks from vegetation and domestic and wild animals. The aim of this study was (i) to identify tick species collected in hospitals and health centres and (ii) to determine the presence and identify of pathogenic bacteria that they may carry using PCR, RLB and sequencing methods. A total of 181 ticks were collected and grouped in pools of one, two or three specimens, resulting in 157 samples. Morphological and molecular identification of collected ticks revealed that most specimens belonged to Ixodes ricinus (88.5%). Additionally, Rhipicephalus bursa, Haemaphysalis punctata, Dermacentor reticulatus and Dermacentor marginatus were also identified. A total of 25 samples (15.9%) tested positive for DNA from the targeted pathogens. The most prevalent vector-borne bacteria were Borrelia spp. (6.4%), followed by Rickettsia spp. (5.1%), Anaplasma phagocytophilum (2.5%) and Coxiella spp. (1.9%). Species identified included B. afzelii, B. garinii, B. miyamotoi, B. valaisiana, B. burgdorferi s. s., R. monacensis, “Candidatus R. rioja”, R. helvetica and R. massiliae. This study highlights the usefulness of combining molecular diagnostics with passive surveillance of human-attached ticks as an effective tool for regional monitoring of ticks and tick-borne pathogens.

Graphical Abstract

1. Introduction

Hard ticks are obligate blood-feeding arthropods that parasitize mammals, birds, reptiles and even amphibians, distributed in almost all regions of the world [1]. Ticks are significant vectors responsible for transmitting a diverse array of pathogens. While viruses and bacteria are the most frequently detected tick-borne agents, protozoa and helminths can also be spread through tick bites [2]. The prevalence of tick-borne diseases (TBDs) caused by tick-borne pathogens (TBPs) depends largely on both the geographic distribution and the activity of their tick vectors [3]. The population dynamics of tick species depend on the effects of biotic and abiotic factors, including climate, vegetation type and host density [4]. Environmental conditions in the Basque Country, a region of the northern Iberian Peninsula with a temperate climate and abundant rainfall throughout the year, favour tick survival and reproduction [5] and 12 species of ticks collected from vegetation have been identified [5]. Moreover, outdoor activities such as forestry work, hunting, mushroom foraging and hiking are commonly practiced in the Basque Country, further increasing the likelihood of human exposure to ticks.
The maintenance of tick-borne bacteria in nature relies on complex transmission cycles involving ticks and a wide range of wild and domestic animal hosts, with humans acting as incidental hosts [3]. Among these bacteria, Borrelia spp., Rickettsia spp., Anaplasma phagocytophilum and Coxiella burnetii are the most important in northern Spain due to their clinical and epidemiological interest [6,7].
Lyme borreliosis (LB), a zoonotic disease caused by B. burgdorferi sensu lato (s.l.), is the most common TBP on humans and animals in Europe [8]. While the overall prevalence of LB may be stabilizing, its geographical distribution continues to expand [9]. In Europe, five genospecies of B. burgdorferi s.l. (B. afzelii, B. garinii, B. burgdorferi sensu stricto (s.s.), B. spielmanii and B. bavariensis) can cause the disease in humans [10,11,12]. In addition, other pathogenic genospecies such as B. bissettii, B. lusitaniae and B. valaisiana have sporadically been detected in patients [13,14,15], but are not recognized as important pathogens. In some areas of the Basque Country, LB is endemic [16] and five genospecies (B. afzelii, B. garinii, B. burgdorferi s.s., B. lusitaniae and B. valaisiana) have been identified in its main vector, Ixodes ricinus [16,17]. This tick species is also the vector of Borrelia miyamotoi, a zoonotic member of the relapsing fever group of TBPs [18]. Despite the increasing detection of B. miyamotoi across the Northern Hemisphere, its incidence in humans remains poorly studied, with most cases presenting mildly but potentially leading to severe disease in immunocompromised individuals [19]. Although this species has not yet been reported in the Basque Country, it has been detected in neighbouring regions such as La Rioja [20], suggesting the need to consider it in surveillance studies.
Rickettsioses are the oldest known infectious diseases [21]. In Europe, the majority of rickettsial infections are caused by tick-transmitted rickettsiae belonging to the spotted fever group (SFG) [6,7]. This group includes Rickettsia conorii subsp. conorii, the causative agent of Mediterranean spotted fever (MSF), as well as other Rickettsia spp. that cause MSF-like illnesses, such as R. helvetica, R. monacensis, R. massiliae or R. aeschlimannii [7,22]. Some years ago, R. monacensis was identified as the causative agent of illness in one patient from the Basque Country [23]. Additionally, several discovered rickettsiae of unknown pathogenicity have been reported in ixodid ticks removed from humans in Spain [24,25,26,27,28]. To date, only R. raoultii has been detected in ixodid questing ticks in the Basque Country [29], although in other regions of northern Spain, several rickettsial species (“Candidatus Rickettsia rioja”, R. raoultii and R. slovaca) have been detected in ticks [7,30,31].
Anaplasma phagocytophilum, a zoonotic bacterium, causes human granulocytic anaplasmosis (HGA), tick-borne fever in domestic ruminants, equine granulocytic anaplasmosis in horses and granulocytic anaplasmosis in dogs and cats [32,33]. The infection has been detected in several mammalian species, including humans, in areas on the Northern Hemisphere where I. ricinus is endemic and considered the primary vector [34,35]. In the Basque Country, A. phagocytophilum has been detected in questing ticks [29] and in domestic and wild animals [36,37,38]. Although several genetic variants of A. phagocytophilum with varying pathogenicity and host association have been identified [33], their presence and distribution remain largely uncharacterized in the Basque Country.
Coxiella burnetii is particularly relevant in northern Spain, where Q Fever pneumonia is endemic [39] and large outbreaks have been identified [40,41]. Over 40 tick species are found to be naturally infected with C. burnetii, suggesting that they may play a role in its transmission to vertebrate hosts in nature [42,43]. In the Basque Country, however, ticks do not appear to play a major role in the cycle of the disease [29].
Although several studies in the Basque Country have documented the diversity, seasonal dynamics and zoonotic TBPs in questing ticks [5,17,29] and those collected from non-human animals [16,36,44], no research to date has specifically addressed ticks biting humans. Existing on-host investigations have focused on livestock and wildlife, providing valuable ecological and epidemiological insights, but leaving a critical gap regarding human exposure. Understanding which tick species are feeding on humans, and when and where their bites occur, is essential to accurately assess the risk of TBD and to guide public health interventions in the region. The objective of this study is the identification of tick species biting humans and the detection of tick-borne zoonotic bacteria through the molecular analysis of specimens collected from individuals who attended hospitals and health centres of the Basque Health Service–Osakidetza primarily for tick removal.

2. Materials and Methods

2.1. Tick Collection and Identification

Between 2019 and 2024, ticks removed from humans have been collected throughout the year in hospitals and health centres across the Basque Country, northern Iberian Peninsula. These arthropods were identified at the species level based on morphological characteristics as soon as they were received [45], using an SMZ 18 stereo microscope (Nikon, Amstelveen, The Netherlands), and classified according to their life development stage (adult, nymph or larva) and feeding status (unfed or fed). Ticks that could not be confidently identified to the species level using morphological criteria were subjected to cytochrome oxidase I (COI) gene sequencing (406 bp amplicon) (Macrogen, Seoul, Republic of Korea) and homology-based identification using BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 22 January 2025), during the final year of the study. Ticks submitted by the health centres were stored at −20 °C until molecular analyses were performed. For the pathogen detection analyses, adult ticks were analysed individually, while nymphs and larvae were pooled—up to two nymphs or three larvae per pool—if provided they were collected from the same patient.

2.2. DNA Extraction

DNA extraction was carried out on collected specimens in pools of one, two or three individuals, grouped by patients when multiple ticks were collected from the same individual, as well as by species and life stage. Tick pools were homogenized in a 1.5 mL screw-cap vial with 400 µL of TE buffer (10 mM Tris, EDTA 1 mM pH = 8) in a TissueLyser II (Qiagen, Hilden, Germany) at 30 Hz for 10 min using 2.3 mm steel beads. The extraction was performed using 200 µL of the tick homogenate, 100 µL of 10% Chelex ® 100 sodium form (Sigma-Aldrich, St. Louis, MO, USA) resin and 0.15 mg of Proteinase K lyophilized (PanReac AppliChem, Darmstadt, Germany). The mixture was incubated at 56 °C for 30 min on a heating block, vortexed and then incubated at 95 °C in a thermostatic water bath for 10 min.
After centrifugation at 13,300 rpm for 10 min, the supernatant was transferred to a sterile 1.5 mL Eppendorf vial. A volume of 100–150 µL was recovered, avoiding carryover of 10% Chelex ® 100 sodium form beads. If additional volume was required, a second centrifugation under the same conditions was performed. The extracted DNA was stored at −40 °C until further processing. A negative control consisting of TE buffer was used for every 10 samples to verify that there was no contaminating DNA during the DNA extraction process.
To rule out the presence of PCR inhibitors in DNA samples, a conventional PCR of the COI gene [46] was used as internal control.

2.3. Molecular Detection and Identification of Tick-Borne Bacteria

The extracted DNA was subsequently analysed using various real-time PCRs to detect the presence of Borrelia spp., Rickettsia spp., A. phagocytophilum and C. burnetii.
A real-time duplex PCR was adapted for the specific detection of the Borrelia spp. and Rickettsia spp. using the 5S-23S intergenic spacer (IGS) and the gltA gene as target sequences, respectively, based on previously designed primers and probes [45,46]. For Borrelia spp., IGS-MGB Borrelia forward 5′-TCCTAGGCATTCACCATAGACT-3′, IGS-MGB Borrelia reverse 5′-TGGCAAAATAGAGATGGAAGAT-3′, IGS-MGB Borrelia probe 5′-[FAM]ATTACTTTGACCATATTT[MGBEQ]-3′ [47]. Regarding Rickettsia spp., CS-Forward 5′-TCGCAAATGTTCACGGTACTTT-3′, CS-Reverse 5′-TCGTGCATTTCTTTCCATTGTG-3′, CS-Probe 5′-[CY5]TGCAATAGCAAGAACCGTAGGCTGGATG[BHQ2]-3′ [48]. Although the real-time PCR assay was originally designed to detect B. burgdorferi s.l., it has also been shown to detect B. miyamotoi [49]. Therefore, positive samples were further analysed using species-specific methods to accurately identify the Borrelia species present, as described below. The Borrelia spp. probe (FAM-MGBEQ) and Rickettsia spp. probe (Cy5-BHQ2) have their fluorophores attached at the 5′ end and quenchers at the 3′ end, respectively. The PCR reaction was carried out using Premix Ex TaqTM (Takara Bio, Kusatsu, Shiga, Japan), 400 nM of each primer and 200 nM of each probe and 20 mg/mL of BSA for each reaction, and 3 µL of extracted DNA to a total reaction volume of 15 µL. The reactions were performed and analysed using an Applied Biosystems QuantStudio 5 Real-Time PCR System (Applied Biosystems™, Life Technologies, Carlsbad, CA, USA), with an initial temperature of 95 °C for 30 s, followed by 40 cycles of 95 °C for 15 s of annealing and 60 °C for 1 minute of extension. For the specific detection of the B. burgdorferi genospecies, a reverse line blot (RLB) was performed [50]. Positive DNA samples were analysed by a PCR targeting the 5S-23S rRNA IGS (PCR 5S-23S) followed by RLB with eight species-specific probes for B. burgdorferi s.l., B. burgdorferi s.s., B. afzelii, B. garinii, B. bissettii, B. spielmanii, B. valaisiana and B. lusitaniae [16,50,51,52]. Some samples positive for B. burgdorferi s.l. by real-time duplex PCR but negative by 5S-23S PCR were subsequently subjected to generic 16S rRNA PCR and sent for Sanger sequencing (Macrogen, Seoul, Republic of Korea). To identify the Rickettsia species in the positive samples, the gltA and ompA genes were amplified by conventional nested PCR [53,54,55], and subsequently sequenced by Sanger methods (Macrogen, Seoul, Republic of Korea).
In order to detect the presence of A. phagocytophilum and C. burnetii, previously described real-time PCR protocols were carried out, targeting the msp2 [56,57] and IS1111 genes, respectively [58]. Although the IS1111 protocol was originally designed to amplify C. burnetii, it is known to also detect Coxiella-like endosymbionts [59] and therefore results were reported conservatively as Coxiella spp.
To avoid cross-contamination, DNA extraction, mixing of DNA-free PCR reagents and template DNA addition were performed in separate areas with separate equipment and solutions. For PCR and RLB protocols, ultrapure water (Sigma-Aldrich, St. Louis, MO, USA) was used as negative PCR control and specifically designed plasmids for each bacterium were used as positive controls (Eurofins Genomics, Ebersberg, Germany).
Sequences obtained in this study were then compared to those in GenBank using BLAST analysis (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 22 January 2025). The consensus sequence for PCR products was generated using BioEdit v7.1.3 software.

3. Results

3.1. Tick Species, Stage and Season

A total of 181 ticks were collected from 148 patients, including 6 larvae (3.3%), 128 nymphs (70.7%) and 47 adults (26%), of which 40 (22.1%) were females and 7 (3.9%) were males (Table 1). The collected ticks belonged to four different genera, Ixodes (161, 89.0%), Dermacentor (8, 4.4%), Rhipicephalus (6, 3.3%) and Haemaphysalis (6, 3.3%). Nymphs belonged exclusively to the genera Ixodes and Dermacentor, and larvae only to Ixodes.
Among the Ixodes specimens, all were identified as I. ricinus. Two morphologically unidentifiable females, due to missing appendages or damaged scuta, were confirmed as I. ricinus via COI gene sequencing (100% identity). Two species of Dermacentor were identified: Dermacentor reticulatus (2.8%) and Dermacentor marginatus (1.7%). Rhipicephalus bursa (3.3%) and Haemaphysalis punctata (3.3%) were the only species identified from their respective genera.
The adult stage was the most frequently collected across all genera (for non-Ixodes: 90.5% adults and 9.5% nymphs), except for Ixodes, in which nymphs accounted for most specimens (26.4% adults, 78.3% nymphs and 3.7% larvae). All adults of I. ricinus were females, while in the other species both females and males were collected. Ticks were collected throughout the year, with the highest abundance recorded in spring (38.6%) and summer (49.7%), particularly in June and July, when 91.1% of all summer-collected ticks were recovered. Of all collected ticks, 63 (35%) showed some evidence of feeding, with partial or full increase in body size indicating blood ingestion, and attachment to a host.

3.2. Pathogen Detection and Identification

In total, 22 pools of two ticks and one pool of three ticks were analysed, along with 134 individual specimens, resulting in 157 pathogen detection analyses. All the ticks analysed for the COI gene, used as an internal control to assess DNA quality and the absence of PCR inhibitors, showed a positive result.
DNA from the studied pathogens was detected in 25 samples or pools (15.9%), all consisting of a single specimen except for two pools, each of which contained two I. ricinus nymphs. Of these, ten (6.4%) were positive for Borrelia spp., eight (5.1%) for Rickettsia spp., four (2.5%) for A. phagocytophilum and three (1.9%) for Coxiella spp. (Table 1).
Among Borrelia spp. positive samples, seven (8.7% of the I. ricinus nymphs analysed) hybridised with probes targeting the B. burgdorferi s.l. complex. Regarding the B. burgdorferi genospecies detected in the RLB, B. afzelii was identified four times, B. garinii and B. valaisiana twice and B. burgdorferi s.s. once (Table 2). Mixed Borrelia infections were found in two samples: one containing a single nymph testing positive for B. afzelii and B. burgdorferi s.s., confirming a true coinfection; and another consisting of a pool of two nymphs testing positive for B. afzelii and B. garinii, in which coinfection at the individual level could not be confirmed. Furthermore, two samples of I. ricinus nymphs positive in the Borrelia-Rickettsia real-time duplex PCR but negative in the RLB were identified as B. miyamotoi by Sanger sequencing of the 16S gene. These sequences showed 100% identity with a B. miyamotoi sequence previously detected in I. ricinus from Austria (GenBank Accession Number: PV203587.1) and represent 1.9% of the I. ricinus nymphs analysed in this study. In contrast, the sequence obtained from a male of H. punctata showed 100% identity with a Borrelia sp. sequence previously detected in a H. punctata from France (Genbank Accession Number: MW301926) [60].
Among Rickettsia spp., R. monacensis was identified in three samples of I. ricinus nymphs and R. helvetica in another. “Candidatus R. rioja” was detected in two adults of D. reticulatus and in one nymph of D. marginatus and R. massiliae was identified in one adult of R. bursa (Table 3).
Coinfection with two pathogen species was found in one I. ricinus nymph, which carried a combination of A. phagocytophilum and R. helvetica. A mixed infection with three species (R. monacensis, B. burgdorferi s.s. and B. afzelii) was detected in another I. ricinus nymph.
Pathogen detection showed variation across seasons in the percentage of positive samples, but this should be considered in the context of the lower number of samples analysed in autumn and winter (Table 1). Detection of at least one pathogen was recorded in every season, with Borrelia spp., being the only pathogen present throughout the entire year.

4. Discussion

The emergence and re-emergence of TBD in recent years highlights the need to understand tick population distribution and the detection of TBPs. The presence of four groups of human tick-borne bacteria was investigated in ixodid ticks from Basque Country (northern Spain) between 2019 and 2024 using molecular methods.
The predominance of I. ricinus among ticks collected from patients attending healthcare centres is consistent with previous vegetation and host-based tick surveys conducted in northern Spain [5,36,37,61,62]. The high occurrence of I. ricinus aligns with the humid and mild climate typical of the Basque region, which favours the survival and development of this tick species [29]. Furthermore, the three stages of development of this species are exophilic, therefore each development stage presents a potential risk for human exposure. However, although the larvae represent the most abundant stage [5,61,63,64], in our study the nymph stage was the most frequently observed in humans.
The number of specimens from other species was small compared to I. ricinus. Although the exact region of exposure in unknown, R. bursa deserves to be highlighted, as it is a more xerophilic species and typically less abundant in this region. Despite this, a similar number of specimens were collected as for H. punctata or D. reticulatus, which are more hydrophilic and generally more abundant in the area [61]. In the study carried out by Vieira et al. [65] in the neighbouring region of Castilla y León, R. bursa was the second most abundant species collected from patients. These findings suggest that this species may have a notable affinity for feeding on humans.
Ixodes ricinus has a wide host range at all stages of development [66]. Larvae usually feed on small vertebrates [67], nymphs on small and large vertebrates [68], while adults frequently feed on larger mammals [69]. These feeding habits, together with the high abundance of these tick species in this region, may be the reason why nymphs are the most frequently collected stage, rather than larvae.
The duration of tick attachment is crucial for pathogen transmission and risk assessment of TBD [70]. In our study, around one-third of the ticks were classified as fed, indicating that the majority were removed before initiating blood feeding and therefore posed a limited risk to patients. In the Basque Country there is a strong tradition of outdoor activities in the mountains such as hiking, mushroom foraging, hunting or forestry work, which increases the likelihood of tick exposure. However, self-checks for ticks upon returning home are becoming more common among the population engaged in outdoor activities. This may explain the reason why most of the ticks removed from patients were unfed [70].
In this geographical region, ixodid ticks are active all year round [5] and since leisure activities are also carried out throughout the year, ticks can be collected in any month. However, the number of ticks removed was higher in spring and summer than in autumn and winter. These results are consistent with those reported in a neighbouring region [65], and in addition to the fact that outdoor activity may be higher during these seasons.
In addition to being the most abundant tick species in northern Spain and Europe, I. ricinus is recognised as a major vector, transmitting over twenty different potentially pathogenic parasites, bacteria and viruses to vertebrate hosts. The zoonotic multisystemic illness known as LB is considered the most prevalent TBD worldwide [8] and its primary vector is I. ricinus. In northern Spain, there are endemic areas of LB, coinciding with the distribution of this Ixodidae tick, in which five genospecies have been identified: B. burgdorferi s.s., B. garinii, B. afzelii, B. valaisiana and B. lusitaniae [16]. In line with this pattern, the first four genospecies were found in I. ricinus nymphs, while no detection of B. lusitaniae was observed. Of particular interest, two B. miyamotoi-positive ticks were detected after removal from patients who sought healthcare in the Basque Country, where no prior detections of this pathogen had been reported, although the exact place of exposure could not be determined. The observed prevalence was three to four times higher than that reported in other regions of northern Spain [20,71,72]. In contrast to these previous studies, none of the I. ricinus females were positive for Borrelia spp., although in this case the small number of available samples may have limited the detection. However, the Borrelia prevalence detected in nymphs (8.7%) was higher than that reported in previous studies in questing ticks in the Basque Country (1.5–2%) [16,17] and that found in La Rioja (4.6%) [20], similar to that found in Galicia (10%), northwestern Spain [71], but lower than that reported in more northern European countries [73]. The higher prevalence currently detected suggests that the risk of B. burgdorferi s.l. transmission may have increased in recent decades in the Basque Country.
Herein, we also report that Rickettsia was the second most commonly identified group of bacteria, detected across multiple tick species. The most prevalent SFG Rickettsia species was R. monacensis, consistently reported across Europe together with its main vector, I. ricinus [74]. The prevalence of infected ticks in Spain reaches 6–27% [31,75]. Four cases have been reported in Europe so far [7], but it is interesting to note that one of the two cases diagnosed in Spain have been in the Basque Country [23]. In addition, R. helvetica, a human-pathogenic SFG Rickettsia previously reported in other parts of northers Spain [24], was detected in I. ricinus nymphs. This represents the first detection of this pathogen in a tick retrieved from a person who sought healthcare in the Basque Country. [24]. However, unlike in other European regions, it has not yet been reported in humans in the Iberian Peninsula, to the best of our knowledge [76]. Another SFG-Rickettsia identified in this study was R. massiliae, a species typically associated with ticks of the R. sanguineus complex [7], although in our study it was detected in a female R. bursa. The detection of one positive among only six specimens analysed suggests a high prevalence of this SFG Rickettsia in R. bursa. Nevertheless, a larger sample size would be required to confirm this observation. Furthermore, the presence of “Candidatus R. rioja” was also identified on three occasions. This agent is one of the involved in the group of diseases known as TIBOLA/DEBONEL/SENLAT, whose main vectors are ticks of the genus Dermacentor, mainly D. marginatus [7]. However, in northern Spain it has also been found in other genera [30,31]. In our case, they were found in two adult specimens of D. reticulatus and in a nymph of D. marginatus.
Ixodes ricinus, the primary vector of A. phagocytophilum in Europe [6], also tested positive in the present study, with the prevalence slightly lower than that previously reported in the Basque Country [29]. Unlike in the United States, very few cases of HGA have been reported in Spain and elsewhere in Europe, which may reflect the lower pathogenicity of the circulating strains, vector differences (I. ricinus vs. Ixodes scapularis) [77] and, in the case of Spain, generally low prevalence rates in ticks [29,30,71].
Although ticks are suggested both reservoir and vector of C. burnetii [42,43], with higher infection rates reports in Central Spain in ticks collected from animals and questing ticks [78], available data from the Basque Country suggest a low circulation of the pathogen in local tick populations. Low infection rates in questing ticks collected from vegetation, as well as the absence of C. burnetii in adult ticks removed from wild animals, have been previously reported in the Basque Country [29] and in another region of northern Spain [30]. These findings align with our results, suggesting that ticks do not appear to play a significant role in the transmission cycle of C. burnetii in this area. It should be noted that the PCR protocol used may also amplify Coxiella-like endosymbionts, which are genetically similar but non-pathogenic. If the three ticks testing positive for Coxiella were indeed carrying such endosymbionts instead of C. burnetii, this would further support the hypothesis that ticks play a negligible role in the local epidemiology of this pathogen.
Co-occurrences of different pathogens in I. ricinus, highlights the possibility of simultaneous infections. In the study, examples include R. monacensis, B. burgdorferi s.s. and B. afzelii, representing a triple infection, as well as dual infection with R. helvetica and A. phagocytophilum. The combination of R. monacensis and B. burgdorferi s.l. had already been reported in questing ticks in a previous study [30]. These coinfections may result from the co-transmission of pathogens during blood feeding on the host [79] or from infections acquired across multiple feedings. The presence of multiple pathogens highlights a potential risk for both humans and animals to contract coinfections, which should be considered in the diagnosis and treatment of TBD. It should be noted that no personal information was available for the patients included in this study (e.g., travel history or animal contact), so it is possible that some of the ticks were acquired outside the Basque Country. Nevertheless, the presence of these pathogens remains relevant for regional public health services, as any potential disease would likely manifest and require diagnosis and treatment within the region.

5. Conclusions

This study provides valuable insight into the growing body of evidence on the presence of the tick species parasitizing humans in the Basque Country, the diversity of zoonotic pathogens they may carry and the circulation of TBPs in northern Spain. While the exact region of tick acquisition cannot be confirmed, the first detection of B. miyamotoi and R. helvetica in ticks removed from individuals seeking healthcare in the Basque Country supports the value of patient-derived ticks as a tool for early detection and surveillance of emerging TBPs relevant to regional public health. To improve the interpretation of entomological data in future surveillance efforts, incorporating a standardized epidemiological questionnaire is recommended, as it would provide valuable context on potential exposure pathways. In addition, the detection of coinfections, including cases involving three zoonotic bacteria, reflects the complexity of TBP circulation. Altogether, this work underlines the value of integrating molecular diagnostics with passive surveillance based on human-attached ticks as a practical and informative tool for regional tick and pathogen monitoring within a One Health framework. Future research should focus on factors influencing human exposure to ticks and TBPs to optimize surveillance efforts and better inform public health strategies.

Author Contributions

Conceptualization, A.L.G.-P., J.F.B. and A.C.; methodology, P.I.-M., P.V., M.A., C.Z., A.L.G.-P. and J.F.B.; formal analysis, P.I.-M. and A.C.; investigation, P.I.-M., P.V., M.A., C.Z., A.L.G.-P., J.F.B. and A.C.; data curation, P.I.-M. and A.C.; writing—original draft preparation, P.I.-M., J.F.B. and A.C.; writing—review and editing, P.I.-M., P.V., M.A., C.Z., A.L.G.-P., J.F.B. and A.C.; supervision, project administration and funding acquisition, A.C. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Department of Food, Rural Development, Agriculture and Fisheries of the Basque Government, the EU-LIFE project 18 IPC/ES/000001 (Urban Klima 2050), and the PyrTick project EFA100/01, co-funded at 65% by the European Union through the Interreg VI-A Spain-France-Andorra Programme (POCTEFA 2021–2027). A.C. is supported by a “Ramón y. Cajal” postdoctoral fellowship (RYC2021-033084-I), funded by MCIN/AEI/10.13039/501100011033 and the European Union NextGeneration EU/PRTR. P.I.-M. is supported by an IKERTALENT grant from the Department of Economic Development, Sustainability and Environment of the Basque Government.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The data presented in this study are available within the article.

Acknowledgments

We thank the staff of Osakidetza for their participation in tick collection. We thank Beatriz Oporto for the assistance in the lab protocol adaptations.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

Abbreviations

The following abbreviations are used in this manuscript:
COICytochrome c oxidase subunit I
DNADeoxyribonucleic acid
gltACitrate synthase gene
HGAHuman granulocytic anaplasmosis
IGSIntergenic spacer
IS1111IS1111 gene
LBLyme borreliosis
MSFMediterranean spotted fever
msp2Merozoite surface protein 2
ompAOuter membrane protein A gene
PCRPolymerase chain reaction
RLBReverse line blot
s.l.sensu lato
s.s.sensu stricto
SFGSpotted fever group
TBDTick-borne disease
TBPTick-borne pathogen

References

  1. Nicholson, W.L.; Sonenshine, D.E.; Noden, B.H.; Brown, R.N. Ticks (Ixodida). In Medical and Veterinary Entomology; Academic Press: Cambridge, MA, USA, 2019; pp. 603–672. ISBN 9780128140437. [Google Scholar]
  2. Mehlhorn, H. Encyclopedia of Parasitology, 3rd ed.; Mehlhorn, H., Ed.; Springer Science & Business Media: Berlin/Heidelberg, Germany, 2008; Volume 1, ISBN 978-3-540-48994-8. [Google Scholar]
  3. Pustijanac, E.; Buršić, M.; Millotti, G.; Paliaga, P.; Iveša, N.; Cvek, M. Tick-Borne Bacterial Diseases in Europe: Threats to Public Health. Eur. J. Clin. Microbiol. Infect. Dis. 2024, 43, 1261–1295. [Google Scholar] [CrossRef] [PubMed]
  4. Sonenshine, D.; Roe, M. Biology of Ticks; Oxford University Press: Oxford, UK, 2014; Volume 2, ISBN 978-0-19-974405-3. [Google Scholar]
  5. Barandika, J.F.; Berriatua, E.; Barral, M.; Juste, R.A.; Anda, P.; García-Pérez, A.L. Risk Factors Associated with Ixodid Tick Species Distributions in the Basque Region in Spain. Med. Vet. Entomol. 2006, 20, 177–188. [Google Scholar] [CrossRef]
  6. Parola, P.; Raoult, D. Ticks and Tickborne Bacterial Diseases in Humans: An Emerging Infectious Threat. Clin. Infect. Dis. 2001, 32, 897–928. [Google Scholar] [CrossRef]
  7. Portillo, A.; Santibáñez, S.; García-Álvarez, L.; Palomar, A.M.; Oteo, J.A. Rickettsioses in Europe. Microbes Infect. 2015, 17, 834–838. [Google Scholar] [CrossRef]
  8. Piesman, J.; Gern, L. Lyme Borreliosis in Europe and North America. Parasitology 2004, 129, S191–S220. [Google Scholar] [CrossRef] [PubMed]
  9. Rizzoli, A.; Hauffe, H.C.; Carpi, G.; Vourc’h, G.I.; Neteler, M.; Rosà, R. Lyme Borreliosis in Europe. Euro Surveill. 2011, 7, 19906. [Google Scholar] [CrossRef]
  10. Margos, G.; Vollmer, S.A.; Cornet, M.; Garnier, M.; Fingerle, V.; Wilske, B.; Bormane, A.; Vitorino, L.; Collares-Pereira, M.; Drancourt, M.; et al. A New Borrelia Species Defined by Multilocus Sequence Analysis of Housekeeping Genes. Appl. Environ. Microbiol. 2009, 75, 5410–5416. [Google Scholar] [CrossRef] [PubMed]
  11. Fingerle, V.; Schulte-Spechtel, U.C.; Ruzic-Sabljic, E.; Leonhard, S.; Hofmann, H.; Weber, K.; Pfister, K.; Strle, F.; Wilske, B. Epidemiological Aspects and Molecular Characterization of Borrelia burgdorferi s.l. from Southern Germany with Special Respect to the New Species Borrelia spielmanii sp. Nov. Int. J. Med. Microbiol. 2008, 298, 279–290. [Google Scholar] [CrossRef]
  12. Baranton, G.; Postic, D.; Girons, I.S.; Boerlin, P.; Piffaretti, J.-C.; Assous, M.; Grimonp, P.A.D. Delineation of Borrelia burgdorferi Sensu Stricto, Borrelia garinii sp. Nov., and Group VS461 Associated with Lyme Borreliosis. Int. J. Syst. Bacteriol. 1992, 42, 378–383. [Google Scholar] [CrossRef]
  13. Collares-Pereira, M.; Couceiro, S.; Franca, I.; Kurtenbach, K.; Schäfer, S.M.; Vitorino, L.; Gonçalves, L.; Baptista, S.; Vieira, M.L.; Cunha, C. First Isolation of Borrelia lusitaniae from a Human Patient. J. Clin. Microbiol. 2004, 42, 1316–1318. [Google Scholar] [CrossRef]
  14. Rudenko, N.; Golovchenko, M.; Mokráček, A.; Piskunová, N.; Růžek, D.; Mallatová, N.; Grubhoffer, L. Detection of Borrelia bissettii in Cardiac Valve Tissue of a Patient with Endocarditis and Aortic Valve Stenosis in the Czech Republic. J. Clin. Microbiol. 2008, 46, 3540–3543. [Google Scholar] [CrossRef] [PubMed]
  15. Diza, E.; Papa, A.; Vezyri, E.; Tsounis, S.; Milonas, I.; Antoniadis, A. Borrelia valaisiana in Cerebrospinal Fluid. Emerg. Infect. Dis. 2004, 10, 1692–1693. [Google Scholar] [CrossRef]
  16. Gil, H.; Barral, M.; Escudero, R.; García-Pérez, A.L.; Anda, P. Identification of a New Borrelia Species among Small Mammals in Areas of Northern Spain Where Lyme Disease Is Endemic. Appl. Environ. Microbiol. 2005, 71, 1336–1345. [Google Scholar] [CrossRef] [PubMed]
  17. Barral, M.; García-Pérez, A.L.; Juste, R.A.; Hurtado, A.; Escudero, R.; Sellek, R.E.; Anda, P. Distribution of Borrelia burgdorferi Sensu Lato in Ixodes ricinus (Acari: Ixodidae) Ticks from the Basque Country, Spain. J. Med. Entomol. 2002, 39, 177–184. [Google Scholar] [CrossRef]
  18. Takano, A.; Sugimori, C.; Fujita, H.; Kadosaka, T.; Taylor, K.R.; Tsubota, T.; Konnai, S.; Tajima, T.; Sato, K.; Watanabe, H.; et al. A Novel Relapsing Fever Borrelia sp. Infects the Salivary Glands of the Molted Hard Tick, Amblyomma geoemydae. Ticks Tick-Borne Dis. 2012, 3, 259–261. [Google Scholar] [CrossRef]
  19. Cutler, S.J.; Vayssier-Taussat, M.; Estrada-Peña, A.; Potkonjak, A.; Mihalca, A.D.; Zeller, H. A New Borrelia on the Block: Borrelia Miyamotoi—A Human Health Risk? Euro Surveill. 2019, 24, 1800170. [Google Scholar] [CrossRef]
  20. Palomar, A.M.; Portillo, A.; Santibáñez, P.; Santibáñez, S.; Oteo, J.A. Borrelia miyamotoi: Should This Pathogen Be Considered for the Diagnosis of Tick-Borne Infectious Diseases in Spain? Enferm. Infecc. Microbiol. Clin. 2018, 36, 568–571. [Google Scholar] [CrossRef]
  21. Raoult, D.; Roux, V.R. Rickettsioses as Paradigms of New or Emerging Infectious Diseases. Clin. Microbiol. Rev. 1997, 10, 694–719. [Google Scholar] [CrossRef] [PubMed]
  22. Parola, P.; Davoust, B.; Raoult, D. Tick- and Flea-Borne Rickettsial Emerging Zoonoses. Vet. Res. 2005, 36, 469–492. [Google Scholar] [CrossRef]
  23. Jado, I.; Oteo, J.A.; Aldámiz, M.; Gil, H.; Escudero, R.; Ibarra, V.; Portu, J.; Portillo, A.; Lezaun, M.J.; García-Amil, C.; et al. Rickettsia monacensis and Human Disease, Spain. Emerg. Infect. Dis. 2007, 13, 1405–1407. [Google Scholar] [CrossRef]
  24. Fernández-Soto, P.; Pérez-Sánchez, R.; Álamo-Sanz, R.; Encinas-Grandes, A. Spotted Fever Group Rickettsiae in Ticks Feeding on Humans in Northwestern Spain: Is Rickettsia conorii Vanishing? Ann. N. Y. Acad. Sci. 2006, 1078, 331–333. [Google Scholar] [CrossRef] [PubMed]
  25. Fernández-Soto, P.; Pérez-Sánchez, R.; Encinas-Grandes, A.; Sanz, R.Á. Detection and Identification of Rickettsia helvetica and Rickettsia sp. IRS3/IRS4 in Ixodes ricinus Ticks Found on Humans in Spain. Eur. J. Clin. Microbiol. Infect. Dis. 2004, 23, 648–649. [Google Scholar] [CrossRef] [PubMed]
  26. Merino, F.J.; Nebreda, T.; Serrano, J.L.; Fernández-Soto, P.; Encinas, A.; Pérez-Sánchez, R. Tick Species and Tick-Borne Infections Identified in Population from a Rural Area of Spain. Epidemiol. Infect. 2005, 133, 943–949. [Google Scholar] [CrossRef]
  27. Oteo, J.A.; Portillo, A.; Santibáñez, S.; Pérez-Martínez, L.; Blanco, J.R.; Jiménez, S.; Ibarra, V.; Pérez-Palacios, A.; Sanz, M. Prevalence of Spotted Fever Group Rickettsia Species Detected in Ticks in La Rioja, Spain. Ann. N. Y. Acad. Sci. 2006, 1078, 320–323. [Google Scholar] [CrossRef] [PubMed]
  28. Ramos, J.M.; Jado, I.; Padilla, S.; Masiá, M.; Anda, P.; Gutiérrez, F. Human Infection with Rickettsia sibirica mongolitimonae, Spain, 2007–2011. Emerg. Infect. Dis. 2013, 19, 267–269. [Google Scholar] [CrossRef]
  29. Barandika, J.F.; Hurtado, A.; García-Sanmartín, J.; Juste, R.A.; Anda, P.; García-Pérez, A.L. Prevalence of Tick-Borne Zoonotic Bacteria in Questing Adult Ticks from Northern Spain. Vector-Borne Zoonotic Dis. 2008, 8, 829–835. [Google Scholar] [CrossRef]
  30. del Cerro, A.; Oleaga, A.; Somoano, A.; Barandika, J.F.; García-Pérez, A.L.; Espí, A. Molecular Identification of Tick-Borne Pathogens (Rickettsia spp., Anaplasma phagocytophilum, Borrelia burgdorferi Sensu Lato, Coxiella burnetii and Piroplasms) in Questing and Feeding Hard Ticks from North-Western Spain. Ticks Tick-Borne Dis. 2022, 13, 101961. [Google Scholar] [CrossRef]
  31. Remesar, S.; Díaz, P.; Portillo, A.; Santibáñez, S.; Prieto, A.; Díaz-Cao, J.M.; López, C.M.; Panadero, R.; Fernández, G.; Díez-Baños, P.; et al. Prevalence and Molecular Characterization of Rickettsia spp. in Questing Ticks from North-Western Spain. Exp. Appl. Acarol. 2019, 79, 267–278. [Google Scholar] [CrossRef] [PubMed]
  32. Woldehiwet, Z. The Natural History of Anaplasma phagocytophilum. Vet. Parasitol. 2010, 167, 108–122. [Google Scholar] [CrossRef]
  33. Matei, I.A.; Estrada-Peña, A.; Cutler, S.J.; Vayssier-Taussat, M.; Varela-Castro, L.; Potkonjak, A.; Zeller, H.; Mihalca, A.D. A Review on the Eco-Epidemiology and Clinical Management of Human Granulocytic Anaplasmosis and Its Agent in Europe. Parasit. Vectors 2019, 12, 599. [Google Scholar] [CrossRef]
  34. Stuen, S.; Granquist, E.G.; Silaghi, C. Anaplasma phagocytophilum—A Widespread Multi-Host Pathogen with Highly Adaptive Strategies. Front. Cell. Infect. Microbiol. 2013, 3, 31. [Google Scholar] [CrossRef] [PubMed]
  35. Gray, J.; Kahl, O.; Zintl, A. Pathogens Transmitted by Ixodes ricinus. Ticks Tick-Borne Dis. 2024, 15, 102402. [Google Scholar] [CrossRef] [PubMed]
  36. Barandika, J.F.; Hurtado, A.; García-Esteban, C.; Gil, H.; Escudero, R.; Barral, M.; Jado, I.; Juste, R.A.; Anda, P.; García-Pérez, A.L. Tick-Borne Zoonotic Bacteria in Wild and Domestic Small Mammals in Northern Spain. Appl. Environ. Microbiol. 2007, 73, 6166–6171. [Google Scholar] [CrossRef]
  37. García-Pérez, A.L.; Oporto, B.; Espí, A.; del Cerro, A.; Barral, M.; Povedano, I.; Barandika, J.F.; Hurtado, A. Anaplasmataceae in Wild Ungulates and Carnivores in Northern Spain. Ticks Tick-Borne Dis. 2016, 7, 264–269. [Google Scholar] [CrossRef]
  38. Garcia-Perez, A.L.; Barandika, J.; Oporto, B.; Povedano, I.; Juste, R.A. Anaplasma phagocytophila as an Abortifacient Agent in Sheep Farms from Northern Spain. Ann. N. Y. Acad. Sci. 2003, 990, 429–432. [Google Scholar] [CrossRef] [PubMed]
  39. Montes, M.; Cilla, G.; Vicente, D.; Nieto, V.; Ercibengoa, M.; Perez-Trallero, E. Gipuzkoa, Basque Country, Spain (1984–2004): A Hyperendemic Area of Q Fever. Ann. N. Y. Acad. Sci. 2006, 1078, 129–132. [Google Scholar] [CrossRef] [PubMed]
  40. Hurtado, A.; Zendoia, I.I.; Alonso, E.; Beraza, X.; Bidaurrazaga, J.; Ocabo, B.; Arrazola, I.; Cevidanes, A.; Barandika, J.F.; García-Pérez, A.L. A Q Fever Outbreak among Visitors to a Natural Cave, Bizkaia, Spain, December 2020 to October 2021. Euro Surveill. 2023, 28, 2200824. [Google Scholar] [CrossRef]
  41. Alonso, E.; Lopez-Etxaniz, I.; Hurtado, A.; Liendo, P.; Urbaneja, F.; Aspiritxaga, I.; Olaizola, J.I.; Piñero, A.; Arrazola, I.; Barandika, J.F.; et al. Q Fever Outbreak among Workers at a Waste-Sorting Plant. PLoS ONE 2015, 10, e0138817. [Google Scholar] [CrossRef]
  42. Arricau-Bouvery, N.; Rodolakis, A. Is Q Fever an Emerging or Re-Emerging Zoonosis? Vet. Res. 2005, 36, 327–349. [Google Scholar] [CrossRef]
  43. Maurin, M.; Raoult, D. Q Fever. Clin. Microbiol. Rev. 1999, 12, 518–553. [Google Scholar] [CrossRef]
  44. Astobiza, I.; Barral, M.; Ruiz-Fons, F.; Barandika, J.F.; Gerrikagoitia, X.; Hurtado, A.; García-Pérez, A.L. Molecular Investigation of the Occurrence of Coxiella burnetii in Wildlife and Ticks in an Endemic Area. Vet. Microbiol. 2011, 147, 190–194. [Google Scholar] [CrossRef] [PubMed]
  45. Estrada-Peña, A.; Mihalca, A.D.; Petney Editors, T.N. Ticks of Europe and North Africa A Guide to Species Identification; Springer: Cham, Switzerland, 2017; ISBN 978-3-319-63759-4. [Google Scholar]
  46. Delgado-Serra, S.; Viader, M.; Ruiz-Arrondo, I.; Miranda, M.Á.; Barceló, C.; Bueno-Marí, R.; Hernández-Triana, L.M.; Miquel, M.; Lester, K.; Jurado-Rivera, J.A.; et al. Molecular Characterization of Mosquito Diversity in the Balearic Islands. J. Med. Entomol. 2021, 58, 608–615. [Google Scholar] [CrossRef]
  47. Strube, C.; Montenegro, V.M.; Epe, C.; Eckelt, E.; Schnieder, T. Establishment of a Minor Groove Binder-Probe Based Quantitative Real Time PCR to Detect Borrelia burgdorferi Sensu Lato and Differentiation of Borrelia spielmanii by OspA-Specific Conventional PCR. Parasit. Vectors 2010, 3, 69. [Google Scholar] [CrossRef] [PubMed]
  48. Stenos, J.; Graves, S.R.; Unsworth, N.B. A Highly Sensitive and Specific Real-Time PCR Assay for the Detection of Spotted Fever and Typhus Group Rickettsiae. Am. J. Trop. Med. Hyg. 2005, 73, 1083–1085. [Google Scholar] [CrossRef]
  49. Raulf, M.K.; Jordan, D.; Fingerle, V.; Strube, C. Association of Borrelia and Rickettsia spp. and Bacterial Loads in Ixodes ricinus Ticks. Ticks Tick-Borne Dis. 2018, 9, 18–24. [Google Scholar] [CrossRef]
  50. Rijpkema, S.G.T.; Molkenboer, M.J.C.H.; Schouls, L.M.; Jongejan, F.; Schellekens, J.F.P. Simultaneous Detection and Genotyping of Three Genomic Groups of Borrelia burgdorferi Sensu Lato in Dutch Ixodes Ricinus Ticks by Characterization of the Amplified Intergenic Spacer Region between 5S and 23S RRNA Genes. J. Clin. Microbiol. 1995, 33, 3091–3095. [Google Scholar] [CrossRef]
  51. Gern, L.; Douet, V.; López, Z.; Rais, O.; Cadenas, F.M. Diversity of Borrelia Genospecies in Ixodes ricinus Ticks in a Lyme Borreliosis Endemic Area in Switzerland Identified by Using New Probes for Reverse Line Blotting. Ticks Tick-Borne Dis. 2010, 1, 23–29. [Google Scholar] [CrossRef]
  52. Poupon, M.A.; Lommano, E.; Humair, P.F.; Douet, V.; Rais, O.; Schaad, M.; Jenni, L.; Gern, L. Prevalence of Borrelia burgdorferi Sensu Lato in Ticks Collected from Migratory Birds in Switzerland. Appl. Environ. Microbiol. 2006, 72, 976–979. [Google Scholar] [CrossRef]
  53. Choi, Y.-J.; Jang, W.-J.; Kim, J.-H.; Ryu, J.-S.; Lee, S.-H.; Park, K.-H.; Paik, H.-S.; Koh, Y.-S.; Choi, M.-S.; Kim, I.-S. Choi_2005_Spotted Fever Group and Typhus Group Rickettsioses in Humans, South Korea. Emerg. Infect. Dis. 2005, 11, 237–244. [Google Scholar] [CrossRef]
  54. Roux, V.; Fournier, P.-E.; Raoult, D. Differentiation of Spotted Fever Group Rickettsiae by Sequencing and Analysis of Restriction Fragment Length Polymorphism of PCR-Amplified DNA of the Gene Encoding the Protein ROmpA. J. Clin. Microbiol. 1996, 34, 2058–2065. [Google Scholar] [CrossRef] [PubMed]
  55. Regnery, R.L.; Spruill, C.L.; Plikaytis, B.D. Genotypic Identification of Rickettsiae and Estimation of Intraspecies Sequence Divergence for Portions of Two Rickettsial Genes. J. Bacteriol. 1991, 173, 1576–1589. [Google Scholar] [CrossRef] [PubMed]
  56. Hurtado, A.; Barandika, J.F.; Oporto, B.; Minguijón, E.; Povedano, I.; García-Pérez, A.L. Risks of Suffering Tick-Borne Diseases in Sheep Translocated to a Tick Infested Area: A Laboratory Approach for the Investigation of an Outbreak. Ticks Tick-Borne Dis. 2015, 6, 31–37. [Google Scholar] [CrossRef]
  57. Song, J.; Zhao, S.; Li, Y.; Wang, H.; Zhang, L.; Wang, J.; Ning, C.; Peng, Y. Duplex TaqMan Real-Time PCR Assay for Simultaneous Detection and Quantification of Anaplasma capra and Anaplasma phagocytophilum Infection. Mol. Cell. Probes 2020, 49, 101487. [Google Scholar] [CrossRef]
  58. Schets, F.M.; de Heer, L.; de Roda Husman, A.M. Coxiella burnetii in Sewage Water at Sewage Water Treatment Plants in a Q Fever Epidemic Area. Int. J. Hyg. Environ. Health 2013, 216, 698–702. [Google Scholar] [CrossRef] [PubMed]
  59. Khademi, P.; Tukmechi, A.; Sgroi, G.; Ownagh, A.; Enferadi, A.; Khalili, M.; Mardani, K. Molecular and Genotyping Techniques in Diagnosis of Coxiella burnetii: An Overview. Infect. Genet. Evol. 2024, 123, 105655. [Google Scholar] [CrossRef]
  60. Sevestre, J.; Diarra, A.Z.; Oumarou, H.A.; Durant, J.; Delaunay, P.; Parola, P. Detection of Emerging Tick-Borne Disease Agents in the Alpes-Maritimes Region, Southeastern France. Ticks Tick-Borne Dis. 2021, 12, 101800. [Google Scholar] [CrossRef]
  61. Barandika, J.F.; Olmeda, S.A.; Casado-Nistal, M.A.; Hurtado, A.; Juste, R.A.; Valcárcel, F.; Anda, P.; García-Pérez, A.L. Differences in Questing Tick Species Distribution between Atlantic and Continental Climate Regions in Spain. J. Med. Entomol. 2011, 48, 13–19. [Google Scholar] [CrossRef]
  62. Estrada-Peña, A.; Martínez-Estéllez, M.A.H.; Pradera, C.; Castellà, J. The Historical Baseline of Hard Tick Records in Spain (1985–2024). Pathogens 2025, 14, 173. [Google Scholar] [CrossRef]
  63. Barandika, J.F.; Hurtado, A.; Juste, R.A.; García-Pérez, A.L. Seasonal Dynamics of Ixodes ricinus in a 3-Year Period in Northern Spain: First Survey on the Presence of Tick-Borne Encephalitis Virus. Vector Borne Zoonotic Dis. 2010, 10, 1027–1035. [Google Scholar] [CrossRef] [PubMed]
  64. Peralbo-Moreno, A.; Espí, A.; Barandika, J.F.; García-Pérez, A.L.; Acevedo, P.; Ruiz-Fons, F. Spatiotemporal Dynamics of Ixodes ricinus Abundance in Northern Spain. Ticks Tick-Borne Dis. 2024, 15, 102373. [Google Scholar] [CrossRef]
  65. Vieira Lista, M.C.; Belhassen-García, M.; Vicente Santiago, M.B.; Sánchez-Montejo, J.; Pedroza Pérez, C.; Monsalve Arteaga, L.C.; Herrador, Z.; Del Álamo-Sanz, R.; Benito, A.; Soto López, J.D.; et al. Identification and Distribution of Human-Biting Ticks in Northwestern Spain. Insects 2022, 13, 469. [Google Scholar] [CrossRef] [PubMed]
  66. James, M.C.; Bowman, A.S.; Forbes, K.J.; Lewis, F.; McLeod, J.E.; Gilbert, L. Environmental Determinants of Ixodes ricinus Ticks and the Incidence of Borrelia burgdorferi Sensu Lato, the Agent of Lyme Borreliosis, in Scotland. Parasitology 2013, 140, 237–246. [Google Scholar] [CrossRef]
  67. Rizzoli, A.; Silaghi, C.; Obiegala, A.; Rudolf, I.; Hubálek, Z.; Földvári, G.; Plantard, O.; Vayssier-Taussat, M.; Bonnet, S.; Špitalská, E.; et al. Ixodes ricinus and Its Transmitted Pathogens in Urban and Peri-Urban Areas in Europe: New Hazards and Relevance for Public Health. Front. Public Health 2014, 2, 251. [Google Scholar] [CrossRef] [PubMed]
  68. Díaz, P.; Remesar, S.; Venzal, J.M.; Vázquez-López, M.E.; Fernández, G.; López, C.; Díez-Baños, P.; Morrondo, P.; Panadero, R. Occurrence of Borrelia and Borreliella Species in Ixodes ricinus Collected from Roe Deer in Northwestern Spain. Med. Vet. Entomol. 2019, 33, 427–430. [Google Scholar] [CrossRef]
  69. Ruiz-Fons, F.; Fernández-de-Mera, I.G.; Acevedo, P.; Höfle, U.; Vicente, J.; de la Fuente, J.; Gortazár, C. Ixodid Ticks Parasitizing Iberian Red Deer (Cervus elaphus hispanicus) and European Wild Boar (Sus. scrofa) from Spain: Geographical and Temporal Distribution. Vet. Parasitol. 2006, 140, 133–142. [Google Scholar] [CrossRef]
  70. Wilhelmsson, P.; Lindblom, P.; Fryland, L.; Nyman, D.; Jaenson, T.G.; Forsberg, P.; Lindgren, P.-E. Ixodes ricinus Ticks Removed from Humans in Northern Europe: Seasonal Pattern of Infestation, Attachment Sites and Duration of Feeding. Parasit. Vectors 2013, 6, 362. [Google Scholar] [CrossRef]
  71. Remesar, S.; Díaz, P.; Venzal, J.M.; Prieto, A.; Estrada-Peña, A.; López, C.M.; Panadero, R.; Fernández, G.; Díez-Baños, P.; Morrondo, P. Longitudinal Study of Infection with Borrelia Spp. in Questing Ticks from North-Western Spain. Vector Borne Zoonotic Dis. 2019, 19, 785–792. [Google Scholar] [CrossRef]
  72. Espí, A.; Del Cerro, A.; Somoano, A.; García, V.; Prieto, J.M.; Barandika, J.F.; García-Pérez, A.L. Borrelia burgdorferi Sensu Lato Prevalence and Diversity in Ticks and Small Mammals in a Lyme Borreliosis Endemic Nature Reserve in North-Western Spain. Incidence in Surrounding Human Populations. Enferm. Infecc. Microbiol. Clin. 2017, 35, 563–568. [Google Scholar] [CrossRef]
  73. Strnad, M.; Hönig, V.; Růžek, D.; Grubhoffer, L.; Rego, R.O.M. Europe-Wide Meta-Analysis of Borrelia burgdorferi Sensu Lato Prevalence in Questing Ixodes ricinus Ticks. Appl. Environ. Microbiol. 2017, 83, e00609–e00617. [Google Scholar] [CrossRef]
  74. Simser, J.A.; Palmer, A.T.; Fingerle, V.; Wilske, B.; Kurtti, T.J.; Munderloh, U.G. Rickettsia monacensis sp. Nov., a Spotted Fever Group Rickettsia, from Ticks (Ixodes ricinus) Collected in a European City Park. Appl. Environ. Microbiol. 2002, 68, 4559–4566. [Google Scholar] [CrossRef]
  75. Márquez, F.J.; Rodríguez-Liébana, J.J.; Soriguer, R.C.; Muniaín, M.A.; Bernabeu-Wittel, M.; Caruz, A.; Contreras-Chova, F. Spotted Fever Group Rickettsia in Brown Dog Ticks Rhipicephalus sanguineus in Southwestern Spain. Parasitol. Res. 2008, 103, 119–122. [Google Scholar] [CrossRef] [PubMed]
  76. Moerbeck, L.; Domingos, A.; Antunes, S. Tick-Borne Rickettsioses in the Iberian Peninsula. Pathogens 2022, 11, 1377. [Google Scholar] [CrossRef] [PubMed]
  77. Azagi, T.; Hoornstra, D.; Kremer, K.; Hovius, J.W.R.; Sprong, H. Evaluation of Disease Causality of Rare Ixodes Ricinus-Borne Infections in Europe. Pathogens 2020, 9, 150. [Google Scholar] [CrossRef] [PubMed]
  78. Toledo, A.; Jado, I.; Olmeda, A.S.; Casado-Nistal, M.A.; Gil, H.; Escudero, R.; Anda, P. Detection of Coxiella burnetii in Ticks Collected from Central Spain. Vector Borne Zoonotic Dis. 2009, 9, 465–468. [Google Scholar] [CrossRef]
  79. Randolph, S.E.; Gem, L.; Nuttall, P.A. Co-Feeding Ticks: Epidemiological Significance for Tick-Borne Pathogen Transmission. Parasitol. Today 1996, 12, 472–479. [Google Scholar] [CrossRef]
Table 1. Number of tick samples by species and developmental stage and season of collection, along with results of pathogen detection, including the number of positive samples and, in parentheses, the percentage of positivity relative to the total number of tick samples analysed for each species, stage and/or season.
Table 1. Number of tick samples by species and developmental stage and season of collection, along with results of pathogen detection, including the number of positive samples and, in parentheses, the percentage of positivity relative to the total number of tick samples analysed for each species, stage and/or season.
Analysed SamplesA. phagocytophilumCoxiella spp.Borrelia spp.Rickettsia spp.
Tick species/stage
I. ricinus1374 (2.9)3 (2.2)9 (6.6)4 (2.9)
Female291 (3.4)000
Nymph104 *3 (2.9)3 (2.9)9 (8.7)4 (3.8)
Larvae4 *0000
R. bursa60001 (16.7)
Female30001 (33.3)
Male30000
H. punctata6001 (16.7)0
Female40000
Male2001 (50.0)0
D. reticulatus50002 (40.0)
Female30001 (33.3)
Male20001 (50.0)
D. marginatus30001 (33.3)
Female10000
Nymph20001 (50.0)
Season
Spring632 (3.2)2 (3.2)5 (7.9)5 (7.9)
Summer732 (2.7)1 (1.4)3 (4.1)2 (2.7)
Autumn10001 (10.0)0
Winter11001 (9.1)1 (9.1)
Overall1574 (2.5)3 (1.9)10 (6.4)8 (5.1)
* Note that one I. ricinus larva sample corresponds to a pool of three larvae and that twenty-two of the I. ricinus nymph samples correspond to pools of two nymphs each.
Table 2. Identification of Borrelia species based on RLB and 16S gene sequences obtained in this study.
Table 2. Identification of Borrelia species based on RLB and 16S gene sequences obtained in this study.
Tick Species-SNo.RLBSanger Sequencing
I. ricinus-N1B. afzelii-
I. ricinus-N1B. afzelii-
I. ricinus-N1B. afzelii + B. burgdorferi s.s.-
I. ricinus-N2B. afzelii + B. garinii-
I. ricinus-N1B. garinii-
I. ricinus-N1B. valaisiana-
I. ricinus-N2B. valaisiana-
I. ricinus-N1negB. miyamotoi
I. ricinus-N1negB. miyamotoi
H. punctata-M1negBorrelia sp.
S, stage: M, male or N, nymph; No., number of tick specimens in the analysed sample; neg, negative.
Table 3. Identification of Rickettsia species based on gltA and ompA gene sequences obtained in this study. For each positive sample, the amplified gene, sequence length, closest match in GenBank and the consensus species identification are shown. All sequences showed 100% query coverage and identity with the corresponding GenBank sequences. All samples corresponded to a single tick specimen.
Table 3. Identification of Rickettsia species based on gltA and ompA gene sequences obtained in this study. For each positive sample, the amplified gene, sequence length, closest match in GenBank and the consensus species identification are shown. All sequences showed 100% query coverage and identity with the corresponding GenBank sequences. All samples corresponded to a single tick specimen.
Tick
Species-S		gltAompAConsensus
PbANSpeciesPbANSpecie
I. ricinus-N309MK792589R. monacensis421KY073124R. monacensisR. monacensis
I. ricinus-N311OR399958R. monacensis494HM161767R. monacensisR. monacensis
I. ricinus-N311MK792589R. monacensisnrs--R. monacensis
I. ricinus-N312MK792578R. helveticanrs--R. helvetica
R. bursa-F304PP835452R. massiliae490MZ420708R. massiliaeR. massiliae
D. marginatus-N296AY129300Rickettsia sp.489MW817120Ca R. riojaCa R. rioja
D. reticulatus-Fnrs--372MW817127Ca R. riojaCa R. rioja
D. reticulatus-Mnrs--423MW817127Ca R. riojaCa R. rioja
S, stage: F, female, M, male or N, nymph; Pb, pair base size; AN, accession number; nrs, non-readable sequences.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ibarrondo-Mendiola, P.; Vázquez, P.; Alkorta, M.; Zugazaga, C.; García-Pérez, A.L.; Barandika, J.F.; Cevidanes, A. Tick Species Identification and Zoonotic Bacteria Detection from Healthcare-Extracted Specimens from Humans in the Basque Country, Northern Iberian Peninsula. Pathogens 2025, 14, 561. https://doi.org/10.3390/pathogens14060561

AMA Style

Ibarrondo-Mendiola P, Vázquez P, Alkorta M, Zugazaga C, García-Pérez AL, Barandika JF, Cevidanes A. Tick Species Identification and Zoonotic Bacteria Detection from Healthcare-Extracted Specimens from Humans in the Basque Country, Northern Iberian Peninsula. Pathogens. 2025; 14(6):561. https://doi.org/10.3390/pathogens14060561

Chicago/Turabian Style

Ibarrondo-Mendiola, Patirke, Patricia Vázquez, Miriam Alkorta, Cristina Zugazaga, Ana L. García-Pérez, Jesús F. Barandika, and Aitor Cevidanes. 2025. "Tick Species Identification and Zoonotic Bacteria Detection from Healthcare-Extracted Specimens from Humans in the Basque Country, Northern Iberian Peninsula" Pathogens 14, no. 6: 561. https://doi.org/10.3390/pathogens14060561

APA Style

Ibarrondo-Mendiola, P., Vázquez, P., Alkorta, M., Zugazaga, C., García-Pérez, A. L., Barandika, J. F., & Cevidanes, A. (2025). Tick Species Identification and Zoonotic Bacteria Detection from Healthcare-Extracted Specimens from Humans in the Basque Country, Northern Iberian Peninsula. Pathogens, 14(6), 561. https://doi.org/10.3390/pathogens14060561

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop